معلومة

سؤال حول فحص إنزيم DNA glycosylase / تحميل العازلة فورماميد جل

سؤال حول فحص إنزيم DNA glycosylase / تحميل العازلة فورماميد جل


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

في كثير من الأحيان بالنسبة لمقايسة إنزيم جليكوزيلاز الحمض النووي ، يمكننا أن نرى أن جليكوزيلاز الحمض النووي محتضن مع قليل النوكليوتيد في 37 درجة مئوية ثم يتم إيقاف التفاعل عن طريق إضافة محلول تحميل جل فورماميد (80٪ فورماميد / 1 مم EDTA ، درجة الحموضة 8.0y0.1٪ أزرق بروموفينول / 0.1٪ زيلين سيانول). كيف يتم إيقاف رد الفعل بواسطة هذا المخزن المؤقت؟


الإشريكية القولونية النواة الداخلية III (التي سأشير إليها الآن باسم Nth) ، والمتماثل البشري hNTH1 ، لهما نشاط glycosylase و AP lyase. يصف قسم المقالة الذي تشير إليه اختبار نشاط اللياز. اختبر الاختبار كلاً من Nth و hNTH1 بالإضافة إلى HAP1 ، وهو هيدروليز AP بشري يشق 5 'في موقع AP. تم العثور على Nth و hNTH1 بواسطة هذا الاختبار للانقسام 3 'إلى موقع AP. HAP1 يعتمد على $ Mg ^ {2 +} $ للنشاط الحفاز. يعتمد hNTH1 (ومن المحتمل Nth ، نظرًا للحفظ العالي) على $ Mg ^ {2 +} $ لخصوصية الركيزة (إيدي وآخرون ، 2001). يحتوي hNTH1 و Nth على ملف $ Fe-S $ المجموعة التي تشارك في ربط الحمض النووي (ثاير وآخرون ، 1995).

في الأصل اعتقدت أن رد الفعل توقف مع EDTA. EDTA هو عامل مخلب. يربط ويفصل أيونات المعادن ويمنع استخدامها بواسطة الإنزيمات. سوف يمنع EDTA التحفيز بواسطة HAP1 وربط الحمض النووي بواسطة Nth / hTNH1.

ومع ذلك ، أشار كريس إلى أن المخزن المؤقت للتحميل يحتوي على 1 ملي مولار EDTA بينما يحتوي المخزن المؤقت للتفاعل على 5 ملي مولار $ MgCl_2 $. في حين أن الورق لا يعطي أحجام التفاعل ومخزن التحميل المختلط معًا ، فمن غير المحتمل أن يكون خلخال EDTA لـ $ Mg ^ {2 +} $ هي الآلية الوحيدة لإيقاف التفاعل. يمكن أن يكون التركيز العالي للفورماميد (80٪) في المخزن المؤقت للتحميل مسؤولاً. يستخدم فورماميد بشكل شائع في تغيير طبيعة الأحماض النووية ، وفي التركيزات العالية ، من المحتمل أن يكون له تأثير على وظيفة الإنزيم.

مراجع

Eide L، Luna L، Gustad EC، Henderson PT، Essigmann JM، Demple B، Seeberg E. 2001. يعمل نوكلياز الإنسان III بشكل تفضيلي على تلف الحمض النووي مقابل بقايا الجوانين في الحمض النووي. الكيمياء الحيوية-الولايات المتحدة. 40 (22): 6653-6659

ثاير مم ، أهيرن إتش ، شينغ د ، كننغهام آر بي ، تاينر جا. 1995. زخارف جديدة مرتبطة بالحمض النووي في التركيب البلوري لإنزيم نوكلياز III لإصلاح الحمض النووي. EMBO J. 14 (16): 4108-4120.


سؤال حول مقايسة إنزيم جليكوزيلاز الحمض النووي / المخزن المؤقت لتحميل هلام الفورماميد - علم الأحياء

5-Formyluracil (fU) هو آفة رئيسية من الثايمين تنتج عن جذور الأكسجين التفاعلية والأكسدة الحساسة للضوء. لقد أظهرنا سابقًا أن FU هي آفة يحتمل أن تسبب الطفرات الجينية بسبب تواترها المرتفع لخطأ مع الجوانين. لذلك ، يمكن أن توجد fU في DNA كإقران صحيح fU: نموذج أو شكل fU: G مقترن بشكل غير صحيح. في هذا العمل ، تم دمج fU في الموقع على وجه التحديد مقابل A في ركائز قليلة النوكليوتيد لتحديد آلية الإصلاح الخلوي لل fU المقترنة بـ A. تم تحفيز نشاط إصلاح fU في الإشريكية القولونية عند التعرض ل ن-الميثيل-ن′ -نيترو-ن-nitrosoguanidine ، وكان الحث يعتمد على ألكا الجين ، مما يشير إلى أن AlkA (3-methyladenine DNA glycosylase II) كانت مسؤولة عن النشاط المرصود. كشف اختبار النشاط وتحديد المعلمات الحركية باستخدام AlkA المنقى وركائز oligonucleotide المحددة التي تحتوي على fU أو 5-hydroxymethyluracil (hU) أو 7-methylguanine (7mG) أن fU تم التعرف عليه بواسطة AlkA بكفاءة مماثلة لتلك التي تبلغ 7mG ، ركيزة جيدة بالنسبة لـ AlkA ، في حين أن hU ، أحد منتجات أكسدة ميثيل الثايمين الرئيسية الأخرى ، لم يكن ركيزة. أشارت التحولات الكيميائية 1 H و 13 C NMR لـ 5-formyl-2′-deoxyuridine إلى أن مجموعة 5-formyl تسببت في نقص الإلكترون في القاعدة C-6 والسكر C-1 ، والذي ثبت أنه يؤدي إلى زعزعة استقرار ن-رابطة غليكوسيدية. هذه الميزات شائعة في ركائز جيدة أخرى لـ AlkA ويقترح أن تلعب أدوارًا رئيسية في التعرف التفاضلي على fU و hU والثايمين السليم. ثلاثة إنزيمات إصلاح للثدييات لقواعد مؤكسدة وألكلة مستنسخة حتى الآن (MPG ، Nth1 ، و OGG1) لم تتعرف على fU ، مما يعني أن نشاط إصلاح الثدييات لـ fU كان موجودًا على بروتين غير معروف حتى الآن. في الورقة المصاحبة (Terato، H.، Masaoka، A.، Kobayashi، M.، Fukushima، S.، Ohyama، Y.، Yoshida، M.، and Ide، H.، J. بيول. تشيم. 274 ، 25144-25150) ، تم الإبلاغ عن آليات إصلاح محتملة للوحدة المزروعة بشكل خاطئ مع G.


مطلوب Glyceraldehyde-3-phosphate dehydrogenase للإصلاح الفعال لآفات الحمض النووي السامة للخلايا في الإشريكية القولونية

إنزيم نازعة الهيدروجين Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) هو بروتين متعدد الوظائف له وظائف بيولوجية متنوعة في الخلايا البشرية. في البكتيريا ، تم وصف وظائف GAPDH الإضافية فقط للبروتين المفرز في مسببات الأمراض أو البروبيوتيك. على المستوى داخل الخلايا ، أبلغنا سابقًا عن تفاعل الإشريكية القولونية GAPDH مع phosphoglycolate phosphatase ، وهو بروتين يشارك في عملية التمثيل الغذائي لمنتج إصلاح الحمض النووي 2-phosphoglycolate ، مما يشير إلى الدور المفترض لـ GAPDH في عمليات إصلاح الحمض النووي. هنا ، نقدم دليلًا على أن GAPDH مطلوب للإصلاح الفعال لآفات الحمض النووي في بكتريا قولونية. نوضح أن الخلايا التي تعاني من نقص GAPDH أكثر حساسية للبليوميسين أو ميثان سلفونات الميثيل. في الخلايا التي يتم تحديها بهذه العوامل السامة للجينات ، يؤدي نقص GAPDH إلى انخفاض قابلية الخلية للنمو والنمو الخيطي. بالإضافة إلى ذلك ، فإن فجوة طافرة الضربة القاضية تتراكم عددًا أكبر من المواقع العفوية العفوية وتعرض ترددات طفرة تلقائية أعلى من السلالة الأبوية. تُظهر التجارب المنسدلة في خلفيات وراثية مختلفة تفاعلًا بين GAPDH وأنزيمات مسار إصلاح استئصال القاعدة ، وهي AP-endonuclease Endo IV و uracil DNA glycosylase. تشير هذه النتيجة إلى أن GAPDH هو أحد مكونات مركب بروتيني مخصص للحفاظ على سلامة الحمض النووي الجيني. تظهر نتائجنا أيضًا تفاعل GAPDH مع بروتين ربط الحمض النووي أحادي السلسلة. قد يؤدي هذا التفاعل إلى تجنيد GAPDH في مواقع الإصلاح ويورط GAPDH في مسارات إصلاح الحمض النووي التي يتم تنشيطها عن طريق تلف الحمض النووي الغزير ، مثل إعادة التركيب المتماثل أو استجابة SOS.


سؤال حول مقايسة إنزيم جليكوزيلاز الحمض النووي / المخزن المؤقت لتحميل هلام الفورماميد - علم الأحياء

يتم البدء في إصلاح مواقع apurinic / apyrimidinic (AP) بواسطة نوكلياز AP ​​، مثل بروتين Ape1 البشري (يُسمى أيضًا Hap1 و Apex و Ref1). تُظهر هذه الإنزيمات والأنزيمات ذات الصلة اعتمادًا قويًا على الكاتيونات ثنائية التكافؤ ، وخاصة المغنيسيوم. هنا نستكشف دور هذا المعدن في مراحل مختلفة من تفاعل Ape1: ربط الركيزة ، والانقسام ، وإطلاق المنتج. قمنا بفحص ربط الحمض النووي باستخدام نهج الكهربي وانقسام الحمض النووي في ردود الفعل أحادية الدوران والحالة المستقرة. أدى المغنيسيوم بتركيزات منخفضة إلى معتدلة إلى تسريع إطلاق كل من الركيزة والمنتج بواسطة بروتين Ape1 من النوع البري. بالنسبة لبروتين Ape1 متحور مع استبدال الأسبارتات بالألانين في البقايا 308 ، تم شق الركيزة في مجمعات البروتين والحمض النووي بشكل أكثر كفاءة قبل إطلاقها على عكس النوع البري Ape1 ، في حين تم تسريع إطلاق المنتج بشكل كبير. كان اعتماد المغنيسيوم لتفاعلات نوكلياز AP ​​المستقرة سيني لكل من النوع البري والأسبارتات 308 لبروتين ألانين ولكنه لم يكن سينيًا لأسبارتات 283 لمشتق ألانين من Ape1. تظهر هذه النتائج أن المغنيسيوم يؤثر على كل من تفاعلات الحمض النووي وانقسام الفوسفوديستر بواسطة Ape1 ويمكن أن يغير خطوة الحد من معدل التفاعل. سوف تحتاج الدراسات الهيكلية إلى أن يتم تفسيرها في سياق هذه التأثيرات المتنوعة للمعادن.

تم دعم هذا العمل من قبل Grants GM40000 و CA71993 و ES03926 من المعاهد الوطنية للصحة. تم تحمل تكاليف نشر هذه المقالة جزئيًا عن طريق دفع رسوم الصفحة. لذلك يجب وضع علامة على المقالة بموجب هذا "الإعلانات"وفقًا لـ 18 U.S.C. القسم 1734 فقط للإشارة إلى هذه الحقيقة.

العنوان الحالي: قسم علم الأحياء التطوري وعلم الأورام ، معهد البحوث لبيولوجيا الإشعاع والطب ، جامعة هيروشيما ، 1-2-3 كاسومي ، مينامي-كو ، هيروشيما 734-8553 ، اليابان.


المواد والأساليب

مواد كيميائية

[γ- 32 P] ATP (3000 Ci / mmol) ، [α- 32 P] dTTP (3000 Ci / mmol) و Sephadex G-25 كانت من DNTPs غير المسماة بـ Amersham Biosciences من Roche Molecular Biochemicals. كانت Oligonucleotides من Microsynth (سويسرا). كان THF (dSpacer) من Glen Research. كانت جميع الكواشف الأخرى من الدرجة التحليلية وتم شراؤها من Merck أو Fluka.

ركائز الحمض النووي

تم تصنيع وتنقية أليغنوكليوتيد 100 ميكر الذي يحتوي على موقع AP الاصطناعي (THF) بالإضافة إلى الشريط التكميلي والبادئات المقابلة كيميائياً على هلام بولي أكريلاميد تغيير طبيعة. تسلسل 100 mer مع جزء THF كما يلي: 5′ATCCTGATTGCTATCTGAATGGTGGTGGTGGGCGCCGGCG (X / G)تجتجاتكجكاكتجككجتكاتكجتجاتكتاتكتاكاجتاتجكتكتججتجتا 3 ′

بين قوسين ، يُشار إلى موضع الآفة الموجود 43 من الطرف 5 أو بقايا G المقابلة في القالب غير التالف بأحرف غامقة (جزء X ، THF). تم استخدام هذه الركيزة المزدوجة التي تقطعت بها السبل لمقايسات الإنزيم الفردي وكذلك من أجل LP-BER المعاد تكوينه في المختبر. بدلاً من ذلك ، تم حظر نهايات الركيزة بالبيوتين عن طريق صلب خيط يحتوي على جزء من THF إلى الشريط التكميلي ، الذي يحتوي على البيوتين عند الطرف 3 و 5 على التوالي. لمقايسة pol ، احتوت الركيزة على فجوة نيوكليوتيد إضافية 1 لمقايسة Fen 1 ، رفرف 10 nt (5′-ATCTGATCGC) و Lig I a nick. تم توضيح هياكل هذه الركائز في الشكل 1B.

البروتينات والركائز المستخدمة في إعادة تشكيل إصلاح ختان قاعدة الرقعة الطويلة في المختبر.(أ) تمت تنقية البروتينات المؤتلفة كما هو موضح في "المواد والطرق" وتم فصلها على هلام SDS-PAGE متدرج بنسبة 8-20٪ ، وتم تلطيخها باستخدام Coomassie Blue. المسار 1: حارة علامات الوزن الجزيئي 2: APE 1 (2 ميكروغرام) الممر 3: Pol β (2 ميكروغرام) الممر 4: Fen 1 (2 ميكروغرام) الممر 5: Lig I (2 ميكروغرام) الحارة 6: 9-1-1 مركب (6 ميكروغرام). (ب) التمثيل التخطيطي للركائز قليلة النوكليوتيد المسمى بـ 32 P-5′ المستخدمة في الدراسة: تم استخدام أليغنوكليوتيد مزدوج 100 زوج قاعدي يحتوي على جزء THF في الموضع 43 لتفاعلات الإصلاح ، وكانت نهايات الركيزة إما حرة (ركيزة غير مقفلة) أو تم حظره ببيوتين في كل طرف (ركيزة مسدودة) تم استخدام أليغنوكليوتيد مزدوج 100 نقطة أساس مع فجوة نيوكليوتيد 1 في نفس الموضع لمقايسة Pol مع شق لمقايسة Lig I ومع رفرف نيوكليوتيد 10 لـ Fen 1 تفاعل

البروتينات والركائز المستخدمة في إعادة تشكيل إصلاح ختان قاعدة الرقعة الطويلة في المختبر.(أ) تمت تنقية البروتينات المؤتلفة كما هو موضح في "المواد والطرق" وتم فصلها على هلام SDS-PAGE متدرج بنسبة 8-20٪ ، وتم تلطيخها باستخدام Coomassie Blue. المسار 1: حارة علامات الوزن الجزيئي 2: APE 1 (2 ميكروغرام) الممر 3: Pol β (2 ميكروغرام) الممر 4: Fen 1 (2 ميكروغرام) الممر 5: Lig I (2 ميكروغرام) الحارة 6: 9-1-1 مركب (6 ميكروغرام). (ب) التمثيل التخطيطي للركائز قليلة النوكليوتيد المسمى بـ 32 P-5′ المستخدمة في الدراسة: تم استخدام أليغنوكليوتيد مزدوج 100 زوج قاعدي يحتوي على جزء THF في الموضع 43 لتفاعلات الإصلاح ، وكانت نهايات الركيزة إما حرة (ركيزة غير مقفلة) أو تم حظره ببيوتين في كل طرف (ركيزة مسدودة) تم استخدام أليغنوكليوتيد مزدوج 100 نقطة أساس مع فجوة نيوكليوتيد 1 في نفس الموضع لمقايسة Pol مع شق لمقايسة Lig I ومع 10 نيوكليوتيد رفرف لـ Fen 1 تفاعل

البروتينات والأجسام المضادة

تم الحصول على نوكلياز الإنسان AP 1 من Enzymax LLC. تم شراء ألبومين مصل الأبقار (BSA) من New England BioLabs. تم عزل المركب 9-1-1 من خلال التعبير المشترك في خلايا Sf21 عن فيروسات البكتيريا الثلاثة التي تشفر hRad1 و his-hRad9 و hHus1 المؤتلف. تم تنقية المجمع لاحقًا كما هو موضح سابقًا (39). تم إنتاج PCNA البشري في الإشريكية القولونية باستخدام البلازميد pT7 / hPCNA وتنقيته إلى التجانس كما هو موصوف (46). تم التعبير عن المؤتلف البشري Pol β و Fen 1 و Lig I في بكتريا قولونية وتنقيته كما سبق وصفه (47-49). الأجسام المضادة لـ Hus1 و Rad9 الموصوفة في Toueille et al. (39) كانت هدية من R. Freire (تينيريف ، إسبانيا). كان الجسم المضاد للماعز المضاد لـ Rad1 (N18) ، وكذلك الجسم المضاد لـ APE 1 (Anti-Ref1 ، H300) للأرنب من التكنولوجيا الحيوية في سانتا كروز.

المقايسات الأنزيمية

قرد 1 فحص شق. تم تحضير ركيزة قليلة النوكليوتيد مزدوجة النوكليوتيد 100 نقطة أساس على النحو التالي: تم تلدين أليغنوكليوتيد 100 مير يحتوي على جزء THF في الموضع 43 إلى الشريط التكميلي (الشكل 1 ب). قبل التلدين ، كانت الآفة المحتوية على حبلا موصوفة بـ 5′ نهاية بـ T4 polynucleotide kinase و [γ- 32 P] ATP. تمت إزالة النيوكليوتيدات المسمى غير المدمجة على عمود دوران Sephadex G-25. تم إجراء تفاعلات شق APE 1 في خليط تفاعل (10 ميكرولتر) يحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي مولار EDTA ، 0.1 مجم / مل من BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة قليلة النوكليوتيد ، والكميات المشار إليها من APE 1. كانت نهايات ركيزة قليل النوكليوتيد إما حرة أو مسدودة بالبيوتين كما هو موضح في أساطير شخصية. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. لتحديد تأثير المركب 9-1-1 على نشاط APE 1 ، تم إجراء التفاعلات كما هو موضح أعلاه ، باستثناء أنه تم تضمين كميات ثابتة من APE 1 في خليط التفاعل وزيادة كمية 9-1-1 تمت إضافة المجمع كما هو موضح في الشكل 4 أ.

بول β فحص

تمت إضافة علامة إشعاعية على أليغنوكليوتيد 42 ميكر عند نهاية 5 وتم تلدينها باستخدام أليغنوكليوتيد 57 ميكر في اتجاه مجرى النهر إلى الشريط التكميلي 100 ميكر. يحتوي أليغنوكليوتيد مزدوج المسمى 32 P الناتج على فجوة 1-nt في الموضع 43 (الشكل 1B). تم تحديد توليف Pol DNA عن طريق قياس إدخال النوكليوتيدات في ركيزة DNA الموصوفة أعلاه. تم إجراء التفاعلات في حجم نهائي قدره 10 ميكرولتر يحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل BSA ، 2 ملي ATP ، 20 ميكرومتر لكل من dATP ، dCTP ، dGTP ، dTTP ، 50 fmol من ركيزة oligonucleotide المقطوعة ، والكميات المحددة من Pol. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي.

بول β مقايسة النشاط على الركيزة المحتوية على الآفة

تم تقييم نشاط Pol على ركيزة قليلة النوكليوتيد المزدوجة المسمى P-5′ والتي تحتوي على جزء THF في الموضع 43 في وجود كمية ثابتة من APE 1. تم تحضين التفاعلات لمدة 20 دقيقة عند 37 درجة مئوية في المخزن المؤقت للتفاعل (10 ميكرولتر) التي تحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي MgCl2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل BSA ، 2 ملي ATP ، 20 ميكرومتر لكل من dATP ، dCTP ، dGTP ، dTTP ، 50 fmol من THF تحتوي على ركيزة قليلة النوكليوتيد ، 55.5 fmol من APE 1 ، والمقادير المحددة من بول β. بعد الحضانة ، تم إيقاف التفاعلات بإضافة حجم متساوٍ من المخزن المؤقت لتحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، 0.02٪ زيلين سيانول) ، تم تسخينها عند 100 درجة مئوية لمدة 5 دقائق ، وتم فصل المنتجات عن طريق الرحلان الكهربي على هلام بولي أكريلاميد مفسد لطبيعة 10٪ وتصور بواسطة التصوير الشعاعي الذاتي.

فين 1 مقايسة نوكلياز داخلية

تم إجراء اختبار Fen 1 كما هو موضح مع بعض التعديلات (42). لتحضير ركيزة رفرف ، تم تلدين أليغنوكليوتيدات 42 و 68 مير إلى حبلا مكمل 100 مير. قبل التلدين ، تمت إضافة علامة إشعاعية على أليغنوكليوتيد 68 مير في نهاية 3 مع ديوكسينوكليوتيديل ترانسفيراز الطرفي و [α- 32 P] ddATP. كان قليل النوكليوتيد المزدوج المسمى P 32 ، الذي تم إعداده على هذا النحو ، يحتوي على رفرف 10-nt في الموضع 43 (الشكل 1B). تم إجراء مقايسة الانقسام Fen 1 في خليط التفاعل (10 ميكرولتر) المحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مولار كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل من BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة أليغنوكليوتيد رفرف ، والكميات المشار إليها من Fen 1. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة مكافئ حجم المخزن المؤقت لتحميل الهلام (95٪ فورماميد ، 20 مم EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. من أجل قياس التأثير التحفيزي للمركب 9-1-1 على نشاط نوكلياز Fen 1 ، تم إجراء التفاعلات في نفس الظروف ، باستثناء أن الكميات الثابتة من Fen 1 كانت موجودة في مخزن التفاعل (25 fmol) والكميات المحددة تمت إضافة مجمع 9-1-1 كما هو موضح في الشكل 8C.

الفحص الأول Lig

تم إجراء اختبار Lig I كما هو موصوف مع التعديلات (40) باستخدام 42 mer و 32 P-5′ المسمى 58 mer oligonucleotides المصلب إلى 100 mer التكميلي. تحتوي مخاليط التفاعل (10 ميكرولتر) على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي MgCl2، 2 ملي ديثيوثريتول ، 0.5 ملي مولار EDTA ، 0.1 مجم / مل BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة قليلة النوكليوتيد المكسوة ، والكميات المشار إليها من Lig I تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 مم EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. لقياس التأثير التحفيزي للمركب 9-1-1 على نشاط Lig I ، تم إجراء التفاعلات في نفس الظروف باستثناء وجود كميات ثابتة من Lig I في المخزن المؤقت للتفاعل (0.5 fmol) والكميات المشار إليها من 9- تمت إضافة مجمع 1-1 كما هو موضح في الشكل 8 د.

معاد تكوينه في المختبر LP-BER

تم إجراء اختبار LP-BER كما هو موضح سابقًا مع التعديلات (14 ، 50). تم إجراء تفاعلات الإصلاح الكاملة في المخزن المؤقت للتفاعل (10 ميكرولتر) الذي تضمن: 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مولار بوكل ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل من BSA ، 2 ملي ATP ، 20 ميكرومتر لكل o dATP ، dCTP ، dGTP ، dTTP ، و 50 fmol من 32 P-5′ المسمى 100 زوج من النوكليوتيد يحتوي على THF الشق في الموضع 43. كانت نهايات الركيزة قليلة النوكليوتيد إما حرة أو مسدودة بالبيوتين كما هو موضح في أساطير الشكل. لإعادة تكوين LP-BER باستخدام الركيزة غير المسماة ، تم استخدام نفس الشروط باستثناء أنه تم تقليل تركيز dTTP إلى 8 ميكرومتر وأضيف [α- 32 P] dTTP (2.5 μCi) إلى مخاليط التفاعل. بدأت التفاعلات بإضافة APE 1 المنقى (55 fmol) ، Pol (64 fmol) ، Fen 1 (93 fmol) ، و Lig I (245 fmol). تمت إضافة كميات متزايدة من مجمع 9-1-1 إلى LP-BER المعاد تكوينه في المختبر التفاعل في ظل ظروف محدودة لكل من الإنزيمات الأربعة APE 1 و Pol و Fen 1 و Lig I (انظر "النتائج"). بعد الحضانة عند 37 درجة مئوية لمدة 20 دقيقة ، تم إيقاف التفاعلات بإضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، 0.02٪ زيلين سيانول) ، تم تسخينها عند 100 درجة مئوية لـ 5 دقائق ، وتم فصل المنتجات النهائية عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10 ٪ وتم تصورها بواسطة التصوير الإشعاعي الذاتي.

فحوصات المنسدلة

بالنسبة إلى عمليات السحب الخاصة به ، تم تحضين 6 ميكروغرام من مجمع 9-1-1 الذي يحمل علاماته أو الوحدات الفرعية ذات العلامات Rad9 أو Rad1 أو Hus1 مع 1 ميكروغرام من APE 1 لمدة ساعتين عند 4 درجات مئوية في المخزن المؤقت المنسدل [50 ملي مولار) Tris-HCl (درجة الحموضة 8.0) ، 100 ملي كلوريد الصوديوم ، 0.05٪ (حجم / حجم) NP-40]. تم بعد ذلك إضافة حبات Ni 2+ ، المغلفة مسبقًا بحضانة طوال الليل في محلول منسدل يحتوي على 5 ملغ / مل من BSA ، متبوعًا بثلاث غسالات في المخزن المنسدل ، إلى البروتينات. تم تحضين العينات بعد ذلك عند 4 درجات مئوية لمدة ساعة واحدة. بعد الغسيل خمس مرات في محلول منسدل يحتوي على 5 ملي إيميدازول ، تم تسخين الحبيبات لمدة 5 دقائق عند 95 درجة مئوية في عازلة Laemmli وتم تحليل البروتينات المشتركة المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المحددة.

بالنسبة لسحب APE 1-sepharose ، تم ربط APE 1 أو BSA المنقى ، المستخدم كعنصر تحكم سلبي ، بشكل تساهمي مع Sepharose المنشط CNBr (Amersham Pharmacia Biotech) كما هو موصوف من قبل المورد ، بنسبة نهائية 1 ميكروغرام من البروتين / ميكرولتر من الخرز. تم غسل APE 1-sepharose أو BSA-sepharose (10 ميكرولتر) مرة واحدة في المخزن المنسدل الذي يحتوي على 10 مجم / مل من BSA وثلاث مرات في المخزن المنسدل. تم تحضين الخرزات بعد ذلك بـ 300 نانوغرام من مركبته 9-1-1 لمدة ساعتين في المخزن المؤقت المنسدل عند 4 درجات مئوية. بعد الغسيل خمس مرات في المخزن المنسدل ، تم تسخين الحبيبات لمدة 5 دقائق عند 95 درجة مئوية في محلول Laemmli وتم تحليل البروتينات المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المحددة.

مقتطفات الخلية الكاملة

لتحضير مستخلصات الخلايا الكلية ، تم حصاد 7 × 10 6293T خلايا عن طريق التربسيني يليها الطرد المركزي. تم تفكيك حبيبات الخلية لاحقًا في محلول تحلل الخلية [50 ملي مولار Hepes-KOH ، درجة الحموضة 7.5 ، 400 ملي كلوريد الصوديوم ، 1 ملي مولار DTT ، 2.5 ملي مولار كلوريد الصوديوم2، 20٪ جلسرين ، 0.5٪ (حجم / حجم) NP40 ، 2 ميكروغرام / مل ليوبتين ، 1 ميكروغرام / مل بيستاتين ، 1 ميكروغرام / مل بيبستاتين ، 2 ملي PMSF ، 10 ملي جلسيروفوسفات ، 1 ملي نايف ، 10 ملي نا4ص2ا7] لمدة 15 دقيقة عند 4 درجات مئوية. تم بعد ذلك الطرد المركزي لمحلول الخلية لمدة 15 دقيقة عند 10000 دورة في الدقيقة ، وتم جمع المادة الطافية وحفظها كمستخلص خلية كلي. تم تحديد تركيز البروتين باستخدام اختبار برادفورد.

المناعية

بالنسبة للتداعيات المناعية ، تم طلاء 25 ميكرولتر من البروتين G sepharose لمدة 3 ساعات عند 4 درجات مئوية مع 100 ميكروغرام من BSA في المخزن المؤقت IP (40 ملي مولار Hepes-KOH ، درجة الحموضة 7.5 ، 100 ملي كلوريد الصوديوم ، 8 ملي MgCl2، 2 ميكروغرام / مل ليوبتين ، 1 ميكروغرام / مل بيستاتين ، 1 ميكروغرام / مل بيبستاتين ، 2 ملي PMSF ، 10 ملي جلسيروفوسفات ، 1 ملي مولار NaF ، 10 ملي مولار Na4ص2ا7) ثم حضنت طوال الليل بـ 3 ميكروغرام من الأجسام المضادة لـ Rad9 أو IgG الأرنب غير المحصن. بعد ثلاث غسلات في محلول IP ، تم تحضين الحبيبات بـ 1 مجم من خلاصة الخلايا الكلية 293 T لمدة 3 ساعات عند 4 درجات مئوية. بعد الحضانة ، تم غسل الحبيبات ثلاث مرات في محلول IP يحتوي على 0.05 ٪ NP40 ثم تم تسخينها بعد ذلك لمدة 5 دقائق عند 95 درجة مئوية في محلول Laemmli. تم تحليل البروتينات المشتركة المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المعمول بها.


النتائج

فحص هليكاز في الوقت الحقيقي

الإسفار هو تقنية حساسة لها ميزة واضحة تتمثل في مراقبة عملية التفاعل في الوقت الفعلي ، بتركيز منخفض وبإنتاجية عالية. لهذا السبب ، تم تصميم اختبار هيليكاز لمراقبة عملية تفكيك نظام DNA المسمى بالفلوروفور. تنتقل مروحيات Pif1 في اتجاه 5 إلى 3 أوم وتتطلب ذيل 5 أوم للتحميل على الركيزة (2 ، 22). وبالتالي ، قمنا بتصميم نظام الحمض النووي لاحتواء عنصر التعرف هذا (الشكل 1). تم استخدام منطقة 5 ′ أحادية الجديلة من 11 deoxyadenines لإنشاء موقع Pif1p المطلوب لرسو السفن. بناء على ما سبق في المختبر دراسات Pif1 ، 11 نيوكليوتيدات كافية لتحميل Pif1p (23). تحتوي الركيزة أيضًا على منطقة تشكيل G4 (الجدول 1) وذيل 3 من 17 نيوكليوتيدًا متصلًا تساهميًا في نهايته 3 ببقايا dabcyl. يتم تلدين أليغنوكليوتيد مكمل في نهايته 5 مع فلوروفور FAM إلى 15 نيوكليوتيد على الجانب 3 من قليل النوكليوتيد المسمى dabcyl ، لتشكيل ركيزة مزدوجة تقطعت بهم السبل. في هذا التصميم ، يفصل نوعان من النيوكليوتيدات تسلسل تشكيل G4 عن جزء الازدواج. هذه النيوكليوتيدات الفاصلة ضرورية لتجنب زعزعة استقرار بنية G4 عند تكوين هيكل مزدوج ولكن لا يُتوقع منها توفير موقع لرسو السفن Pif1. بالإضافة إلى ذلك ، في هذا النظام ، يروي dabcyl مضان FAM عندما يتم تشكيل الازدواج. يتم تحميل الهيليكس أولاً على الذيل 5 ، وبعد إضافة ATP ، يتم فك هيكل G4 ثم الحمض النووي المزدوج المسمى الفلورسنت. هذا يطلق المسبار المسمى FAM من حبلا المسمى dabcyl ، مما أدى إلى زيادة مضان قابلة للقياس لمسبار FAM.

رسم توضيحي لتفاعل الهليكس مع نظام الحمض النووي G4 / مزدوج. تحتوي الركيزة على منطقة أحادية الجديلة ومنطقة G4 ومنطقة مزدوجة. عندما يتم تشكيل الطباعة على الوجهين ، يتم إخماد مضان FAM (الرمز البرتقالي) الذي يصف الشريط المفرد. في الخطوة الأولى من التفاعل ، ترتبط هليكاز Pif1p بطرف 5 أحادي الخيط. بعد إضافة ATP ، تستمر الهليكاز في اتجاه 5 إلى 3 لفك بنية G-quadruplex أولاً ثم الحمض النووي المزدوج. يؤدي فك وحدة الطباعة على الوجهين إلى إطلاق المسبار المفرد الذي تقطعت به السبل والذي يُصدر مضانًا قويًا حيث لم يعد يخمد بواسطة dabcyl (رمز أرجواني) على الشريط التكميلي.

رسم توضيحي لتفاعل الهليكس مع نظام الحمض النووي G4 / مزدوج. تحتوي الركيزة على منطقة أحادية الجديلة ومنطقة G4 ومنطقة مزدوجة. عندما يتم تشكيل الطباعة على الوجهين ، يتم إخماد مضان FAM (الرمز البرتقالي) الذي يصف الشريط المفرد. في الخطوة الأولى من التفاعل ، ترتبط هليكاز Pif1p بطرف 5 أحادي الخيط. بعد إضافة ATP ، تستمر الهليكاز في اتجاه 5 إلى 3 لفك بنية G-quadruplex أولاً ثم الحمض النووي المزدوج. يؤدي فك وحدة الطباعة على الوجهين إلى إطلاق المسبار المفرد الذي تقطعت به السبل ، والذي ينبعث منه مضانًا قويًا حيث لم يعد يخمد بواسطة dabcyl (رمز أرجواني) على الشريط التكميلي.

تم اختبار ركيزتين مختلفتين من أجل التحقق من صحة الفحص ولتحسين كمية الحمض النووي والإنزيم المطلوب. في أول بناء من سميك G4 ، تم تضمين تسلسل 16-mer المصمم من نسخة متحولة من 3-جزء من مروج NHEIII لـ c-MYC في تجميع الحمض النووي (S- سميك التصميم ، الجدول 1). يتم طي هذا التسلسل المتحور إلى بنية G4 أقل تعددًا وأكثر تجانسًا من تسلسل c-MYC الطبيعي. وهي تعتمد بنية G4 متوازية في وجود الكاتيونات أحادية التكافؤ ، والتي تم الحفاظ عليها في S- سميك النظام (الشكل التكميلي S1). في البناء الثاني تم تحور العديد من الجوانين في ج- myc التسلسل من أجل منع تكوين بنية G4 مستقرة. وبالتالي ، في هذا النظام ، يتبع منطقة طويلة أحادية الخيط من قبل DNA مزدوج قصير (S- موت التصميم ، الجدول 1).

Pif1 نشط في وجود أي من Na + أو K + التركيز الأمثل للكاتيونات أحادية التكافؤ هو 50-60 ملي مولار ، لكن Pif1 لا يزال نشطًا للغاية عند قوة أيونية أعلى (100 ملي مولار) (23). تم تقييم العديد من تركيزات Pif1 في مخزن مؤقت يحتوي على 1 ملي مولار بوكل و 99 ملي مول كلوريد الصوديوم باستخدام S- سميك النظام. أدت إضافة ATP إلى هذا الحل إلى تنشيط إنزيم الهليكاز مما أدى إلى إطلاق حبلا أحادي المسمى FAM (الشكل 2 أ). الحد الأقصى للانبعاثات التي لوحظت وكانت حركيات التفاعل تعتمد بشكل مباشر على تركيز الإنزيم مع بلوغ أقصى نشاط للإنزيم عند تركيز Pif1 بمقدار 12 نانومتر (الشكل 2 ب). أجريت تجارب مماثلة في مخزن مؤقت يحتوي على 100 ملي بوكل. في تركيز KCl هذا ، لم نلاحظ أي تحسين مضان ، مما يشير إلى أن الهليكاز غير نشط في KCl عند هذه القوة الأيونية أو أن cmyc G4 مستقر جدًا بحيث لا يمكن التخلص منه بواسطة Pif1. للتمييز بين هذين الاحتمالين ، تم إجراء تجربة مماثلة مع S-mut النظام ، الذي لا يمكن أن يشكل بنية G4. وجدنا تحسينات انبعاث مضان متشابهة تقريبًا في كلا المخازن المؤقتة (1 ملي KCl / 99 ملي كلوريد الصوديوم و 100 ملي كلوريد الصوديوم ، الشكل التكميلي S2) ، مما يشير إلى أن نشاط Pif1 هيليكاز على الجزء المزدوج كان مستقلاً عن طبيعة الكاتيون أحادي التكافؤ في هذه القوة الأيونية . وبالتالي ، كان الاختلاف في النشاط نتيجة لاختلاف في استقرار الركيزة G4 التي سيتم الكشف عنها. هذا هو أول دليل على أن G4 المستقر داخل الجزيء يمكن أن يقاوم التفتح بواسطة هليكاز Pif1.

(أ) تحسين الانبعاث في الوقت الحقيقي لـ S- سميك النظام كدالة لتركيز Pif1p. تم تحضين هليكاز Pif1p بتركيزات متعددة (3 و 6 و 12 و 25 و 50 و 100 نانومتر) باستخدام رباعي الاتجاه مزدوج S- سميك نظام (40 نانومتر) في المخزن المؤقت 1 ملي بوكل / 99 ملي كلوريد الصوديوم. تمت مراقبة الانبعاث بمرور الوقت بعد إضافة ATP. (ب) تم تحقيق أقصى تعزيز للانبعاثات لـ S- سميك النظام بعد إضافة ATP كدالة لتركيز Pif1. تشير أشرطة الخطأ إلى الانحراف المعياري لثلاث تجارب مستقلة.

(أ) تحسين الانبعاث في الوقت الحقيقي لـ S- سميك النظام كدالة لتركيز Pif1p. تم تحضين هليكاز Pif1p بتركيزات متعددة (3 و 6 و 12 و 25 و 50 و 100 نانومتر) باستخدام رباعي الاتجاه مزدوج S- سميك نظام (40 نانومتر) في المخزن المؤقت 1 ملي بوكل / 99 ملي كلوريد الصوديوم. تمت مراقبة الانبعاث بمرور الوقت بعد إضافة ATP. (ب) تم تحقيق أقصى تعزيز للانبعاثات لـ S- سميك النظام بعد إضافة ATP كدالة لتركيز Pif1. تشير أشرطة الخطأ إلى الانحراف المعياري لثلاث تجارب مستقلة.

تم اختيار محلول المخزن المؤقت التعسفي 1 ملي KCl / 99 ملي كلوريد الصوديوم لمزيد من الدراسات في هذا البحث. تم العثور على خليط K / Na هذا بمثابة حل وسط جيد للسماح بالنشاط الأمثل للبروتين بينما يتم طي الهيكل الرباعي بشكل صحيح. ستؤدي زيادة تركيز K + إلى التركيز الفسيولوجي (∼150 ملي مولار) إلى استقرار بنية G4 بشكل كبير مما يتطلب كميات أكبر من الإنزيم. بالإضافة إلى ذلك ، فإن التركيز العالي من monocations من شأنه أن يقلل من في المختبر نشاط الهليكاز (وهو الأمثل عند 50-60 مم من الأحادية).

في نظامنا ، يتنافس رد فعل الفك مع إعادة تهجين الخيوط المنفصلة ، والتي تكون إما تلقائية أو يتم تعزيزها بواسطة الهليكاز نفسه (24). إن إعادة تشكيل الحمض النووي المزدوج بطيء ولكن لا يمكن إهماله ، حتى عند تركيز الخيط المنخفض (40 نانومتر). لوحظ في آثار الفك بعد بضع دقائق (الشكل التكميلي S3). يصل نشاط الهليكاز لـ Pif1 إلى الحد الأقصى فورًا بعد إضافة ATP ، ومع ذلك ، بعد بضع دقائق ، يتناقص نشاط الإنزيم وينتج عن تكوين الازدواج إخماد انبعاث FAM fluorophore ، وهي ظاهرة يمكن ملاحظتها في الوقت الفعلي. للتغلب على هذا القيد ، توصلنا إلى أن إضافة قليل النوكليوتيد المحاصر إلى خليط التفاعل سيمنع إعادة الربط المزدوج (25). أليغنوكليوتيد قصير أحادي الخيط (فخ) مكمل تمامًا للخيط الذي يحمل علامة FAM إلى خليط التفاعل. بمجرد فك الإنزيم في البنية المزدوجة ، من المتوقع أن يتم محاصرة تسلسل FAM المنفرد الذي تقطعت به السبل بواسطة الشريط التكميلي غير المسمى. هذا ما لاحظناه ، نظرًا لأن الزيادة الصغيرة في قليل النوكليوتيد الصياد هذا نتج عنه مضان مستقر حتى بعد 30 دقيقة (الشكل التكميلي S3).

كانت الخطوة التالية في هذا البحث هي تحديد النشاط الأنزيمي. لقياس الحد الأقصى لمستوى انبعاث التألق للركيزة غير الملتفة ، يجب تحقيق الفصل الكامل للطراز المزدوج المسمى FAM-dabcyl. تحقيقا لهذه الغاية ، تم تقديم خطوة الملاءمة الثانية. بمجرد اكتمال تفاعل الهليكاز ووصول انبعاث التألق إلى هضبة مستقرة ، فإن قليل النوكليوتيد مكمل لتسلسل كامل الطول المسمى dabcyl (سي-موت) في التفاعل. يزيح حبلا DNA هذا التسلسل المسمى FAM في أي نظام G4 مزدوج الاتجاه غير متفاعل ، مما يؤدي إلى DNA مزدوج عالي الاستقرار (44 نقطة أساس طويلة) في عملية شبه لا رجعة فيها (انظر الشكل التكميلي S4). يوضح الشكل 3 توضيحًا لهذا التفاعل المكون من خطوتين لـ S- سميك النظام. تتضمن الخطوة الأولى فصل G4 / مزدوج الاتجاه بواسطة الهليكاز ويعتمد على ATP. بمجرد أن يصل التفاعل إلى هضبة مستقرة ، يتم إضافة التسلسل التكميلي C- سميك يقود التفاعل عن طريق إزاحة أي نظام G4-dx غير متفاعل في هذه الخطوة الثانية كونه مستقل عن ATP. وهكذا ، فإن نشاط هليكاز Pif1 على S- سميك يمكن حساب الركيزة بمقارنة انبعاث التألق في المرحلتين الأولى والثانية من التفاعل.

(أعلى) رسم توضيحي لتفاعل الهليكاز المكون من خطوتين المفترض حدوثه في S- سميك النظام. في الخطوة الأولى ، عند إضافة ATP ، تقوم طائرة Pif1p بإرخاء G4 / مزدوج الاتجاه لتحرير المسبار المفرد الذي تقطعت به السبل. في الخطوة الثانية ، الخيط التكميلي dabcyl C- سميك هذا يزيح أي ازدواج متبقي مما يؤدي إلى أقصى إشارة انبعاث ممكنة. (أسفل) تتم مراقبة عملية فك اللف في الوقت الفعلي من خلال تسجيل تحسين الانبعاث للنظام الذي يحمل علامة FAM.

(أعلى) رسم توضيحي لتفاعل الهليكاز المكون من خطوتين المفترض حدوثه في S- سميك النظام. في الخطوة الأولى ، عند إضافة ATP ، تقوم طائرة Pif1p بإرخاء G4 / مزدوج الاتجاه لتحرير المسبار المفرد الذي تقطعت به السبل. في الخطوة الثانية ، الخيط التكميلي dabcyl C- سميك هذا يزيح أي ازدواج متبقي مما يؤدي إلى أقصى إشارة انبعاث ممكنة. (أسفل) تتم مراقبة عملية فك اللف في الوقت الفعلي من خلال تسجيل تحسين الانبعاث للنظام الذي يحمل علامة FAM.

تسمح بساطة وسرعة هذا الاختبار بضبط ظروف المخزن المؤقت بالإضافة إلى تركيزات قليل النوكليوتيد وهليكاز لتحسين الفحص لطائرة مختلفة أو ركائز G4 مختلفة. رد فعل هليكاز ل S- سميك تم تنفيذ النظام في مخزن مؤقت يحتوي على 1 ملي مولار بوكل و 99 ملي مول كلوريد الصوديوم. أدى وجود 100 ملي بوكل ، وهو ذو صلة من الناحية الفسيولوجية ، إلى استقرار ج- myc عزر G4 في S- سميك النظام وأسفر عن عقبة أمام الإنزيم. من أجل إثبات تعدد استخدامات هذا الاختبار ، تمت إعادة تحسين ظروف اختبار هيليكاز لـ S- سميك النظام عند 100 ملي بوكل. كما هو مبين في الشكل 4 ، فإن زيادة تركيز Pif1 من 20 نانومتر (والذي كان تركيز إنزيم مشبع في محلول مؤقت لكلوريد الصوديوم 1 ملي مولار / 99 ملي مولار) إلى 100 نانومتر كان كافياً لاستعادة نشاط الهليكاز في هذا النظام.

نشاط Helicase ضد S- سميك نظام DNA في المخزن المؤقت الذي يحتوي على 100 ملي بوكل في 20 و 40 و 100 و 200 نانومتر Pif1. تشير أشرطة الخطأ إلى متوسط ​​الانحراف بين تجربتين مستقلتين.

نشاط Helicase ضد S- سميك نظام DNA في المخزن المؤقت الذي يحتوي على 100 ملي بوكل في 20 و 40 و 100 و 200 نانومتر Pif1. تشير أشرطة الخطأ إلى متوسط ​​الانحراف بين تجربتين مستقلتين.

تم التحقيق مؤخرًا في عملية فك نموذج مزدوج مباشرة بعد هيكل رباعي بواسطة عمل هليكاز Pif1 بواسطة (19). في اختبار FRET لجزيء واحد ، وجدوا أن Pif1 هيليكاز لم تكن قادرة على حل بنية مزدوجة عندما يسبقها شكل رباعي. نظرًا لأن هذه الهليكاز قادرة على حل مشكلة S- سميك النظام ، الذي يشبه نسبيًا ركيزة Zhou ، تم اقتراح تصميم جديد للتحقق من الاختلافات المعينة بين تصميم Zhou والتصميم المقترح في اختبار الهليكاز الحالي. تم التحقيق في نشاط هليكاز Pif1 في بناء يتكون من نموذج مزدوج متبوعًا بحبل واحد ، وعزف رباعي وثاني مزدوج (الشكل التكميلي S5) تحت نفس الحالة كما هو موضح سابقًا لاختبار الهليكاز. ومن المثير للاهتمام ، أن Pif1 كان قادرًا على فك كل من الحافز الرباعي والمزدوج التالي ، مما يُظهر سلوكًا مختلفًا عن دراسة Zhou. هذا الاختلاف في السلوك يرجع بالتالي إلى الاختلافات بين التصميمين التجريبيين (جزيء واحد مقابل رد فعل جماعي مع الاصطياد) وليس بسبب خلل في التسلسل (انظر المناقشة).

فحص هيكل G-quadruplex

باستخدام الاختبار المكون من خطوتين ، تم فحص سلسلة من هياكل G4 لقدرتها على تثبيط Pif1. تم أيضًا تضمين نظامين لا يحتويان على G4 كعناصر تحكم (الجدول 1): الأول كان النظام المفرد الذي تقطعت به السبل الموصوف سابقًا S- موت النظام والثاني كان S-DX النظام الذي يتكون من S-mut النظام الذي يضاف إليه قليل النوكليوتيد 17-نيوكليوتيد غير مسمى إلى المنطقة الطافرة الغنية بـ G-rich. ركيزة التحكم الأولى عبارة عن ركيزة مفردة تقطعت بها السبل ، بينما تتضمن الثانية طبقة مزدوجة. تضمنت سلسلة متواليات G4 التي تم فحصها عددًا من هياكل G4 المتميزة جيدًا (الجدول 1): S-htelo، الحمض النووي التيلومري البشري ح-تيلو تسلسل (26) S-cmyc ، S-ckit1, S-ckit2 و S- كراس أنظمة ، تحتوي على تسلسلات G4 الموجودة في مناطق المروج للجينات المسرطنة المعروفة (ج- myc ( 27), c-kit1 ( 28), c-kit2 (29) و 27 كراس (30) على التوالي) S-CEB، التي تحتوي على منطقة G-rich من القمر الصناعي الصغير CEB25 ( 31) S-TBA، الأبتامر المرتبط بالثرومبين يُعلن لاحقًا تسلسل (32) S-CTA، التي تحتوي على متغير التيلومير البشري CTA (33). فيما عدا S-TBA الركيزة ، أظهرت جميع الأنظمة المقترحة بنية رباعية في ظل ظروف المخزن المؤقت التي تم النظر فيها لهذا الاختبار (الشكل التكميلي S1). النظام S-TBA ومع ذلك فشلت في الانطواء إلى هيكل رباعي مستقر. يُعلن لاحقًا quadruplex هو رباعي الاتجاه يتكون من اثنين فقط من G-tetrads ويظهر ثباتًا ضعيفًا ومن ثم وجود تسلسل بولي طويل (dA) عند النهاية 5 وعزف مزدوج عند الطرف 3′ (S-TBA التصميم) قد يكون ضارًا بتكوين G4.

يوضح الشكل 5 أ بيانات من اختبار تمثيلي من خطوتين يراقب تأثير Pif1 على تسلسل G4 في الوقت الفعلي في 1 ملي مولار بوكل و 99 ملي كلوريد الصوديوم. أدت إضافة ATP إلى محلول الإنزيم والحمض النووي إلى تنشيط Pif1 وأدى إلى تفكيك مزدوج الحمض النووي ، مما أدى إلى زيادة انبعاث التألق. بعد 30 دقيقة ، تم الوصول إلى هضبة مستقرة من انبعاث مضان في جميع الحالات. في 30 دقيقة ، تمت إضافة الخيط التكميلي لكل تسلسل يحمل علامة dabcyl. أدى ذلك إلى الكشف الكامل لجميع هياكل G4 وإزاحة التسلسل المسمى FAM. أدى الإصدار الكامل للخيوط التي تحمل علامة FAM إلى أقصى انبعاث ممكن مع كل نظام. يتم توفير البيانات الأولية لكل نظام فردي في الشكل التكميلي S6.

(أ) قطع تمثيلية للانبعاث كدالة زمنية لفك أنظمة الحمض النووي المحددة (S-mut, S-DX, S- سميك, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S- كراس و S-CTA). تمت إضافة ATP لبدء التفاعل (t = 0 min) الخيوط التكميلية (سي-موت, C- سميك, C- هتلو, C-ckit1, C-ckit2, C-TBA, C-CEB, سي كراس و C-CTA، على التوالي) بمجرد وصول التفاعلات إلى هضبة (t = 30 دقيقة). (ب) يشير التقدير الكمي لنشاط هيليكاز Pif1p مقابل أشرطة خطأ أنظمة الحمض النووي المحددة إلى الانحراف المعياري لثلاث تجارب مستقلة.

(أ) قطع تمثيلية للانبعاث كدالة زمنية لفك أنظمة الحمض النووي المحددة (S-mut, S-DX, S- سميك, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S- كراس و S-CTA). تمت إضافة ATP لبدء التفاعل (t = 0 min) الخيوط التكميلية (سي-موت, C- سميك, C- هتلو, C-ckit1, C-ckit2, C-TBA, C-CEB, سي كراس و C-CTA، على التوالي) بمجرد وصول التفاعلات إلى هضبة (t = 30 دقيقة). (ب) يشير التقدير الكمي لنشاط هيليكاز Pif1p مقابل أشرطة خطأ أنظمة الحمض النووي المحددة إلى الانحراف المعياري لثلاث تجارب مستقلة.

يوضح الشكل 5 ب نشاط هليكاز Pif1 المحدد في وجود كل هيكل تمت دراسته. في ظل هذه الظروف ، لم يكن أي من بنية G4 قادرًا على منع نشاط الهليكسز تمامًا لأنزيم Pif1. ومع ذلك ، كان وجود هياكل G4 المستقرة في بعض التجمعات عقبة أمام الإنزيم ، وبالتالي ، تم تقليل نشاط الفك بشكل طفيف على النحو المحدد من خلال مقارنة شدة الانبعاث بعد الخطوتين الأولى والثانية من التفاعل. كانت معظم الملامح الحركية زائدية باستثناء تلك التي تم الحصول عليها باستخدام متواليتي c-kit التي كانت سينية. شكلت هذه التسلسلات هياكل عالية المستوى لم تدخل الهلام أثناء الرحلان الكهربائي (الشكل التكميلي S7). يمكن أن يفسر وجود هذه الهياكل ذات الترتيب الأعلى ، والتي يُفترض أنها بين الجزيئات ، هذا السلوك. المنحنى الملاحظ لـ S- كراس ومع ذلك ، لم تكن الركيزة G4 ، التي تعرض أيضًا تكوين هياكل عالية المستوى (الشكل التكميلي S7) ، سينية.

مما لا يثير الدهشة ، من تقطعت بهم السبل S-mut كان التجميع الأكثر تفاعلًا ووجد أن الفك شبه مكتمل (90٪). وبالمثل ، فإن يُعلن لاحقًا تم العثور على الركيزة ، التي تحتوي على نموذج G4 غير مستقر نسبيًا يتكون من تكديس اثنين فقط من الجوانين الرباعية ، بنسبة 90 ٪ غير مطوية. حل Pif1 هياكل G4 الأخرى بكفاءات 65-85٪. ومن المثير للاهتمام ، أن الحمض النووي المزدوج المكون من 17 قاعدة في S-DX كان التصميم هو أقوى عقبة أمام بروتين Pif1 من الهياكل التي تم اختبارها عند تركيز 1 ملي مولار من البوتاسيوم. يؤكد هذا التقارير السابقة التي تستخدم تركيبات G4 بين الجزيئات والتي أظهرت أن Pif1 قادر على حل هياكل G4 بشكل أكثر كفاءة من هياكل الحمض النووي المزدوجة في المختبر ( 10, 15).

تمت مقارنة ثبات ركائز الحمض النووي ضد إنزيم Pif1 مع الثبات الحراري لبنية المجموعة الرباعية. لهذا الغرض ، تم تحديد Tm للعنصر رباعي النواة لكل نظام. كان التحديد الدقيق لـ Tm لهيكل G4 المدمج في النظام الكامل أمرًا صعبًا حيث ساهمت الخيوط المفردة والعبور المزدوجة في الامتصاص وتلوث الإشارة. كشفت Tm لهياكل النوى الرباعية الاتجاه نفسه في الاستقرار كما لوحظ في اختبار الهليكاز (الشكل التكميلي S8). تم العثور على Tm للزخارف الأساسية الرباعية S-cmyc و S-htelo و S-CTA ، والتي تتوافق مع أنظمة الحمض النووي التي قدمت حاجزًا أعلى للإنزيم ، لإظهار أعلى قيم Tm (59.9 درجة مئوية ، 56.8 درجة مئوية) و 57.9 درجة مئوية على التوالي). على العكس من ذلك ، وجد أن نواة TBA الرباعية هي الأقل ثباتًا ديناميكيًا حراريًا (29.5 درجة مئوية).

لاستكشاف مدى تنوع هذا الاختبار ، S-htelo تمت دراسة النظام أيضًا في ظروف فسيولوجية أكثر [K +]. كما هو موضح سابقًا لـ S- سميك (الشكل 4) ، فإن وجود كمية أعلى من كاتيونات البوتاسيوم يمنع Pif1p من تفكك ، والذي يمكن التغلب عليه عن طريق زيادة تركيز الإنزيم في التفاعل. مرة أخرى ، يشير هذا إلى أن التركيز العالي لـ K + يعمل على استقرار الرباعي ، وبالتالي يكون تركيز الإنزيم الأمثل لفك الرباعي أعلى في هذا المخزن المؤقت (الشكل 4).

فحص الترابط الرباعي

تمت دراسة فك الهياكل G4 بواسطة Pif1 بشكل أكبر عن طريق زيادة ثبات الشكل G4 باستخدام روابط G4 المعروفة. تم تقييم أربعة روابط G4 جيدة التوصيف: مركب أكريدين ثلاثي المستبدلة براكو 19 (34) ، بيسكينولينيوم PhenDC3 (35) ، بيريدين مكرر (كينولينيل) بيريدوستاتين (36) و triazoniatrinaphthylene تريس كيو (37) (الشكل 6). أنظمة الحمض النووي التي تحتوي على G4 ، و S-mut النظام (كمثال على الركيزة التي تحتوي على DNA أحادي الجديلة غير منظم بدلاً من شكل رباعي الاتجاه) ، و S-DX تم اختبار التصميم (كمثال على هيكل مزدوج) بتنسيق عالي الإنتاجية في وجود وغياب كل رابط باستخدام استراتيجية الفحص المكونة من خطوتين. يوضح الشكل 6 أ و ب منحنيات فك اللفة في الوقت الحقيقي لـ S-mut و S- سميك أنظمة ، على التوالي ، بواسطة Pif1 في وجود وغياب يجند. فيما عدا براكو 19 مما أدى إلى إبطاء نشاط الإنزيم ، فإن وجود روابط G4 في وسط التفاعل لم يؤثر بشكل كبير على نشاط فك Pif1 على S-mut المادة المتفاعلة. كان هذا متوقعًا لأن الروابط المختارة تربط هياكل G4 ولكن ليس الحمض النووي المزدوج أو أحادي الجديلة (الشكل التكميلي S9). براكو 19 أظهر تثبيطًا ضعيفًا لنشاط Pif1 في هذين النظامين ، ويعزى هذا الانخفاض إلى تغيير في حركية التفاعل. تم تقليل نشاط Pif1 بشكل كبير على S- سميك الركيزة عند وجود أي من روابط G4 ، مما يشير إلى أن تكوين مجمع G4-ligand يمنع فك الإنزيم.

تتكشف في الوقت الحقيقي النموذجي لـ (أ) S- سميك و (ب) S-mut أنظمة في غياب أو وجود روابط محددة (Braco19 (34) ، Pyridostatin (36) ، Phen DC3 (35) و TrisQ (37)). تمت إضافة ATP عند t = 0 الخيط التكميلي (سي-موت و C- سميك، على التوالي) عند t = 45 دقيقة.

تتكشف في الوقت الحقيقي النموذجي لـ (أ) S- سميك و (ب) S-mut أنظمة في غياب أو وجود روابط محددة (Braco19 (34) ، Pyridostatin (36) ، Phen DC3 (35) و TrisQ (37)). تمت إضافة ATP عند t = 0 الخيط التكميلي (سي-موت و C- سميك، على التوالي) عند t = 45 دقيقة.

تم العثور على نتائج مماثلة عندما تم فحص سلسلة الهياكل G4 في وجود هذه الروابط G4 (الشكل 7). كما لوحظ في التجربة الأولية ، تفكيك S-mut أو S-DX لم يتأثر بشكل كبير بوجود الموثق G4. على العكس من ذلك ، فإن جميع روابط G4 تمنع فك ركائز G4. ومن المثير للاهتمام، تريس كيو كان التثبيط انتقائيًا: تريس كيو منع نشاط الإنزيم بنسبة تزيد عن 50٪ S- سميك, S-ckit1, S-ckit2 و S-CEB ركائز ، لكنها فشلت في التأثير على فك الأنظمة الأخرى (S-htelo, S- كراس و S-CTA). S-htelo تم العثور على الركيزة ، التي تحتوي على تسلسل التيلوميرات البشرية ، لتكون النظام الأقل تأثرًا بإضافة الروابط. S-TBA قدم النظام سلوكًا مثيرًا للاهتمام. كما ذكرنا من قبل ، لم يتم طي هذه الركيزة في هيكل رباعي في ظل ظروف الاختبار المخزنة مؤقتًا. ومع ذلك ، فقد وجد أنه عقبة أمام هليكاز Pif1 في وجود روابط G4. هذا يشير إلى أنه على الرغم من أن S-TBA تحتوي الركيزة على نموذج رباعي ثابت ، وقد تعمل روابط G4 كمرافقين لتعزيز تكوينها وبالتالي تعمل كحاجز للإنزيم.

نشاط الهليكاز Pif1 ضد أنظمة الحمض النووي S-mut, S-DX, S- سميك, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S- كراس و S-CTA في غياب أو وجود روابط G4 المختارة (Braco-19 و Pyridostatin و PhenDC3 و TrisQ). تشير أشرطة الخطأ إلى الانحراف المعياري لثلاث تجارب مستقلة.

نشاط الهليكاز Pif1 ضد أنظمة الحمض النووي S-mut, S-DX, S- سميك, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S- كراس و S-CTA في غياب أو وجود روابط G4 المختارة (Braco-19 و Pyridostatin و PhenDC3 و TrisQ). تشير أشرطة الخطأ إلى الانحراف المعياري لثلاث تجارب مستقلة.

بشكل عام ، تُظهر هذه النتائج أنه يمكن تثبيط نشاط Pif1 من خلال وجود روابط G4 ، وأن هذه الروابط G4 تبدو وكأنها مثبطات حقيقية لنشاط حل G4 لـ Pif1p.


نقاش

نقدم نظام التعبير الاصطناعي C3P3-G1 المحسن لاستخداماته في خلايا الثدييات المستزرعة. على حد علمنا ، هذا هو أول نظام تعبير اصطناعي يزاوج بنجاح النسخ وما بعد النسخ ، وهما عمليتان من التعقيد الرائع في حقيقيات النوى. يعتمد C3P3-G1 على إنزيم خيمري أحادي الوحدة يتكون من اندماج إنزيم mRNA مع بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي. يتم نسخ جزء بوليميراز الحمض النووي الريبي من إنزيم C3P3 في السليلو قوالب DNA محددة تحت سيطرة محفز C3P3 وتوليف سلاسل الحمض النووي الريبي ، والتي يتم تغطيتها لاحقًا بواسطة مجموعة إنزيم السد. في المقابل ، يتم تصنيع بولي أدينيل لنصوص C3P3 عن طريق نسخ مسار بوليادينوسين من قوالب الحمض النووي. لذلك ، بمجرد التحضير ، يقوم نظام التعبير C3P3 بشكل مستقل بتوليف سلاسل الحمض النووي الريبي في سيتوبلازم الخلية المضيفة ويولد التعديلات الرئيسية المطلوبة لترجمتها.

لضمان تغطية mRNA لنصوص C3P3-G1 ، اتبعنا نهجًا استفاد بشكل كبير من نظام التعبير عن فيروس اللقاح- T7RNAP. يستخدم هذا النهج الأخير فيروس اللقاح المؤتلف الذي يشفر T7RNAP ، في حين أن الجين المستهدف ، تحت سيطرة محفز T7 ، يكون إما مضمنًا في البلازميد أو فيروس اللقاح المأشوب الثاني (28 ، 29). نظرًا لأن فيروس اللقاح عبارة عن طفيلي داخل الخلايا يتكاثر بشكل حصري في سيتوبلازم الخلية المضيفة ، فإن نسخ T7 هي 5-capped و 3-polyadenylated في سيتوبلازم الخلية المضيفة بواسطة إنزيمات فيروس اللقاح (30). على الرغم من أن كميات الرنا المرسال التي ينتجها هذا النظام عالية للغاية ، وتشكل 30 ٪ من إجمالي الحمض النووي الريبي المستقر في السيتوبلازم ، إلا أن الكميات المعتدلة فقط من نسخ T7 يتم تغطيتها بشكل صحيح 5′ (30). يتم تقديم تفسير معقول لهذه النتائج من خلال البيئة المزدحمة للسيتوبلازم ، والتي تحتوي على شبكة كثيفة من خيوط الهيكل الخلوي ، مما يعيق الانتشار الحر للجزيئات الكبيرة مثل البروتينات والحمض النووي و الرنا المرسال (61). نظرًا لعدم وجود اقتران بين إنزيم الحد من فيروس اللقاح و T7RNAP ، فإن نسخ T7 تتم معالجتها بشكل سيئ 5′ بواسطة إنزيم تغطية فيروس اللقاح. كان هذا الافتراض محوريًا لتطوير إنزيم C3P3-G1 ، والذي يُفضل الاندماج بين إنزيم الحد من فيروس حمى الخنازير الأفريقي وبوليميراز الجراثيم الطافرة K1E RNA.

بالإضافة إلى غطاء m7 GpppN في نهاياتها 5′ ، تحتوي جميع جزيئات mRNAs حقيقية النواة تقريبًا على ذيل بولي (A) يتكون من إضافة مستقلة عن القالب لبقايا أدينوسين أحادي الفوسفات إلى مجموعات الهيدروكسيل ثلاثية الأطراف. يتعاون الذيل 3′-poly (A) الناتج بشكل تآزري مع السد 5′ لتحفيز الترجمة بتقوية فوق مضافة ، ويفترض عن طريق تعميم mRNA (62). بالإضافة إلى ذلك ، تعمل ذيول poly (A) على تعزيز استقرار النصوص ، في حين أن deadenylation هي خطوة رئيسية لتحديد المعدل في تحلل الرنا المرسال (63 ، 64). على النقيض من مادة البولي أدينيل النووية ، يتم إنشاء ذيل بولي (A) لـ C3P3-G1 عن طريق النسخ المعتمد على القالب لمسار أدينوزين قصير 40 من قالب الحمض النووي ، متبوعًا بتسلسل ريبوزيم ذاتي الانقسام. وبالتالي فإن طول ذيل بولي (A) لنصوص C3P3-G1 المشفرة بواسطة القوالب أقصر بكثير من نصوص الثدييات ، التي تخرج من النواة بطول موحد 250 نيوكليوتيدات (65-68). نظرًا لأن طول ذيل poly (A) يرتبط ارتباطًا وثيقًا بمستوى التعبير الجيني (69) ، يمكن اعتبار polyadenylation من نظام التعبير C3P3-G1 دون المستوى الأمثل. ستعمل الأجيال الأخرى من نظام C3P3 على تحسين عملية إضافة عديد الأدينيل ، ربما عن طريق ربط بوليميريز بولي (A) بنصوص C3P3.

يتمثل النقص الحالي في نظام C3P3 في الكفاءة الترجمية غير الكاملة لنصوص C3P3 ، أي نسبة mRNA: نسبة التألق الأقل باستخدام نظام C3P3-G1 من نظام التعبير النووي القياسي. يمكن تفسير هذه الكفاءة الترجمية غير المكتملة لـ mRNA من خلال آليات مختلفة. أولاً ، قد تكون تعديلات mRNA التي أجراها الجيل الحالي من نظام C3P3 غير مكتملة. يشير اختبارنا شبه الكمي (الشكل 4) إلى أن غالبية الرنا المرسال يتم تغطيتها بواسطة C3P3-G1. ومع ذلك ، حتى الكميات الصغيرة من الحمض النووي الريبي غير المغطى بخمس فوسفات ثلاثي الفوسفات قد تحفز استجابة بروتين ألفا المحفز بحمض الريتينويك (RIG-I) بوساطة interferon-α وإغلاق ترجمة الخلية المضيفة (70 ، 71). يمكن أيضًا تحفيز استجابة Interferon-α بسبب عدم وجود غطاء 1 في نهايات 5′ للنصوص ، والتي لا يتم استيعابها بواسطة C3P3-G1 (72). اللافت للنظر ، لم يتم التركيز على أي تعديلات صريحة لأنماط توزيع الريبوسوم من خلال تحليل التنميط المتعدد. لا تدعم هذه النتيجة فرضية التثبيط العالمي لترجمة الخلية المضيفة كما هو متوقع في حالة الاستجابة القوية للإنترفيرون ، ولكن التحقيق عن كثب في محتوى الكسور متعددة الخصائص. من المعروف أيضًا أن طول ذيل بولي أدينيل ضروري لترجمة الرنا المرسال ويجب زيادته بواسطة أجيال أخرى من نظام C3P3. ثانيًا ، قد تكون التعديلات الأخرى اللاحقة للنسخ والتي لا يتم تنفيذها بواسطة C3P3-G1 حاسمة لكفاءة ترجمة mRNA. على سبيل المثال ، يمكن عكسها N6،2′-ا- وجد مؤخرًا أن مثيلة ثنائي ميثيل أدينوسين عند أول نيوكليوتيد مشفر مجاور للغطاء يؤثر على مصير mRNA الخلوي (73). بدلاً من ذلك ، قد يؤدي عدم وجود تعديلات أخرى إلى إيقاف ترجمة الخلية المضيفة ، عبر مسار الإنترفيرون أو غيره (70). على سبيل المثال ، يمكن أن تخضع القواعد الداخلية لتعديلات مثل الترشيح الكاذب أو المثيلة في بقايا اليوريدين أو السيتوزين ، مما يقلل من تنشيط بروتين كيناز المعتمد على الحمض النووي الريبي (RNA) استجابةً للحمض النووي الريبي الخارجي ، ثم فسفوريلات عامل بدء الترجمة 2-α (eIF2-α) ويثبط ترجمة (74 ، 75). ثالثًا ، قد تشارك بروتينات الخلية المضيفة ، التي تترسب في النهاية على RNA أو mRNA ، في الترجمة. على سبيل المثال ، يساهم مجمع تقاطع exon ، الذي يتم تجميعه على RNA ما قبل الرسول في المرحلة النووية ، في كل من كفاءة ترجمة الرنا المرسال والانحلال (76 ، 77). رابعًا ، قد يتم وضع نصوص C3P3 بشكل غير مناسب في المقصورة السيتوبلازمية لترجمتها بواسطة آلية الخلية المضيفة. للمقارنة ، تشكل فيروسات الحمض النووي المتكاثرة السيتوبلازمية الكبيرة ، مثل Poxvirus أو Asfarvirus ، مصانع فيروسية تعزل عوامل النسخ ، والريبوسومات ، والمرافقين في مقصورات فرعية حشوية مقيدة. إجمالاً ، سيتم استكشاف هذه الفرضيات بشكل منهجي من خلال تحليل نسخي وتحليلي أعمق لمزيد من التحسينات لنظام C3P3.

على عكس أنظمة التعبير النووي القياسية التي تتطلب الوصول إلى آلية النسخ النووية للخلية المضيفة ، تم تصميم نظام C3P3-G1 كنظام تعبير حشوي مستقل. لذلك ، بمجرد أن يتم تحضير التعبير عن إنزيم C3P3 ، يصبح مستقلاً عن الانتشار السلبي للحمض النووي المدخل من خلال المسام النووية. يشرح قطر القناة الرئيسية ، وهو أصغر من القطر الكلاسيكي للحمض النووي البلازميدي ، انتشارها المحدود للنواة وربما الفعالية المحدودة للترنسفكأيشن العابر (78). على سبيل المثال ، يمكن أن تصل نسبة 1-10٪ فقط من البلازميدات المنقولة إلى الخلايا المستنبتة بشكل فعال إلى نواتها وفقًا لتقييم RT-PCR الكمي أو تحليل اللطخة الجنوبية أو الفحص المجهري الإلكتروني (79 ، 80). ومن ثم ، فإن العملية السيتوبلازمية لنظام C3P3 تبدو جذابة للعلاج الجيني غير الفيروسي العابر ، وهو نهج جذاب لتقديم الأحماض النووية العلاجية للعلاجات البشرية (81). يبدو العلاج الجيني غير الفيروسي أكثر أمانًا وأقل مناعة من الفيروسات المؤتلفة ولديه القدرة على تقديم حمولات وراثية أكبر (81). ومع ذلك ، تبدو فعاليته محدودة نسبيًا ، مما أعاق استخداماته بشكل كبير (82). لذلك نتوقع أنه يمكن استخدام نظام C3P3 في العلاج الجيني غير الفيروسي ، خاصةً بالنسبة للاضطرابات التي تشمل الخلايا الهادئة مثل خلايا الكبد أو الخلايا العضلية الهيكلية أو الخلايا المناعية الساذجة B أو T.

إلى جانب استخداماته العلاجية ، يجب أيضًا مراعاة نظام التعبير C3P3 لتطبيقاته في السليلو. على سبيل المثال ، يمكن أيضًا استخدام نظام التعبير C3P3 لدراسات التعبير العابر لفحص النمط الظاهري أو غيرها.ومع ذلك ، فإن الطبيعة الاصطناعية لنظام C3P3-G1 تجعله غير مناسب للتحقيق في تنظيم النسخ أو الترجمة للخلية المضيفة. بالإضافة إلى ذلك ، فإن الأداء العالي لنظام C3P3-G1 في خلايا CHO-K1 وعدم وجود سمية خلوية يمكن اكتشافها لإنزيم C3P3 تشير إلى أنه يمكن إنشاء خطوط خلايا C3P3 مستقرة لإنتاج البروتينات المؤتلفة.

تطبيق آخر مثير للاهتمام لهذا النظام يتعلق بإنتاج فيروسات الحمض النووي الريبي. مؤخرًا ، إيتون وآخرون. أظهر (83) أن نظام C3P3-G1 يزيد من تعبير بروتين الفيروسات بنسبة 5 إلى 10 أضعاف وإنقاذ الفيروسات بنسبة 100 ضعف ، مقارنةً بنظام الوراثة العكسية الحالي. فيروسات Reovirus هي فيروسات غير مسببة للأمراض تظهر نشاطًا مضادًا للورم ويتم استكشافها لعلاج السرطان (84). وبالتالي ، فإن هذه النتائج مشجعة لاستخدام نظام C3P3-G1 لإنتاج فيروسات تحتوي على رنا 5-capped RNAs ، بما في ذلك Retroviridae ، Rhabdoviridae ، Paramyxoviridae ، Filoviridae أو Reoviridae.

في الختام ، يلخص نظام التعبير الاصطناعي C3P3-G1 تعديلات mRNA الرئيسية المطلوبة لترجمة mRNA ، بما في ذلك توليف الحمض النووي الريبي ، والسد ، وفي جزء من مادة البولي أدينيل. تم تحسين هذا النظام للثدييات ، على الرغم من أنه يمكن نظريًا تكييفه مع أي نوع آخر من حقيقيات النوى. يجب أن يُنظر إلى نظام C3P3 على أنه نظام متعدد الاستخدامات ومتعدد الاستخدامات في السليلو و في الجسم الحي التطبيقات. الأهم من ذلك ، يجب اعتبار نظام C3P3-G1 الحالي كنموذج أولي متقدم ، حيث سيتم تحسين الأداء بشكل كبير في الأجيال القادمة دون شك.


المواد والأساليب

مواد كيميائية

[γ- 32 P] ATP (3000 Ci / mmol) ، [α- 32 P] dTTP (3000 Ci / mmol) و Sephadex G-25 كانت من DNTPs غير المسماة بـ Amersham Biosciences من Roche Molecular Biochemicals. كانت Oligonucleotides من Microsynth (سويسرا). كان THF (dSpacer) من Glen Research. كانت جميع الكواشف الأخرى من الدرجة التحليلية وتم شراؤها من Merck أو Fluka.

ركائز الحمض النووي

تم تصنيع وتنقية أليغنوكليوتيد 100 ميكر الذي يحتوي على موقع AP الاصطناعي (THF) بالإضافة إلى الشريط التكميلي والبادئات المقابلة كيميائياً على هلام بولي أكريلاميد تغيير طبيعة. تسلسل 100 mer مع جزء THF كما يلي: 5′ATCCTGATTGCTATCTGAATGGTGGTGGTGGGCGCCGGCG (X / G)تجتجاتكجكاكتجككجتكاتكجتجاتكتاتكتاكاجتاتجكتكتججتجتا 3 ′

بين قوسين ، يُشار إلى موضع الآفة الموجود 43 من الطرف 5 أو بقايا G المقابلة في القالب غير التالف بأحرف غامقة (جزء X ، THF). تم استخدام هذه الركيزة المزدوجة التي تقطعت بها السبل لمقايسات الإنزيم الفردي وكذلك من أجل LP-BER المعاد تكوينه في المختبر. بدلاً من ذلك ، تم حظر نهايات الركيزة بالبيوتين عن طريق صلب خيط يحتوي على جزء من THF إلى الشريط التكميلي ، الذي يحتوي على البيوتين عند الطرف 3 و 5 على التوالي. لمقايسة pol ، احتوت الركيزة على فجوة نيوكليوتيد إضافية 1 لمقايسة Fen 1 ، رفرف 10 nt (5′-ATCTGATCGC) و Lig I a nick. تم توضيح هياكل هذه الركائز في الشكل 1B.

البروتينات والركائز المستخدمة في إعادة تشكيل إصلاح ختان قاعدة الرقعة الطويلة في المختبر.(أ) تمت تنقية البروتينات المؤتلفة كما هو موضح في "المواد والطرق" وتم فصلها على هلام SDS-PAGE متدرج بنسبة 8-20٪ ، وتم تلطيخها باستخدام Coomassie Blue. المسار 1: حارة علامات الوزن الجزيئي 2: APE 1 (2 ميكروغرام) الممر 3: Pol β (2 ميكروغرام) الممر 4: Fen 1 (2 ميكروغرام) الممر 5: Lig I (2 ميكروغرام) الحارة 6: 9-1-1 مركب (6 ميكروغرام). (ب) التمثيل التخطيطي للركائز قليلة النوكليوتيد المسمى بـ 32 P-5′ المستخدمة في الدراسة: تم استخدام أليغنوكليوتيد مزدوج 100 زوج قاعدي يحتوي على جزء THF في الموضع 43 لتفاعلات الإصلاح ، وكانت نهايات الركيزة إما حرة (ركيزة غير مقفلة) أو تم حظره ببيوتين في كل طرف (ركيزة مسدودة) تم استخدام أليغنوكليوتيد مزدوج 100 نقطة أساس مع فجوة نيوكليوتيد 1 في نفس الموضع لمقايسة Pol مع شق لمقايسة Lig I ومع 10 نيوكليوتيد رفرف لـ Fen 1 تفاعل

البروتينات والركائز المستخدمة في إعادة تشكيل إصلاح ختان قاعدة الرقعة الطويلة في المختبر.(أ) تمت تنقية البروتينات المؤتلفة كما هو موضح في "المواد والطرق" وتم فصلها على هلام SDS-PAGE متدرج بنسبة 8-20٪ ، وتم تلطيخها باستخدام Coomassie Blue. المسار 1: حارة علامات الوزن الجزيئي 2: APE 1 (2 ميكروغرام) الممر 3: Pol β (2 ميكروغرام) الممر 4: Fen 1 (2 ميكروغرام) الممر 5: Lig I (2 ميكروغرام) الحارة 6: 9-1-1 مركب (6 ميكروغرام). (ب) التمثيل التخطيطي للركائز قليلة النوكليوتيد المسمى بـ 32 P-5′ المستخدمة في الدراسة: تم استخدام أليغنوكليوتيد مزدوج 100 زوج قاعدي يحتوي على جزء THF في الموضع 43 لتفاعلات الإصلاح ، وكانت نهايات الركيزة إما حرة (ركيزة غير مقفلة) أو تم حظره ببيوتين في كل طرف (ركيزة مسدودة) تم استخدام أليغنوكليوتيد مزدوج 100 نقطة أساس مع فجوة نيوكليوتيد 1 في نفس الموضع لمقايسة Pol مع شق لمقايسة Lig I ومع 10 نيوكليوتيد رفرف لـ Fen 1 تفاعل

البروتينات والأجسام المضادة

تم الحصول على نوكلياز الإنسان AP 1 من Enzymax LLC. تم شراء ألبومين مصل الأبقار (BSA) من New England BioLabs. تم عزل المركب 9-1-1 من خلال التعبير المشترك في خلايا Sf21 عن فيروسات البكتيريا الثلاثة التي تشفر hRad1 و his-hRad9 و hHus1 المؤتلف. تم تنقية المجمع لاحقًا كما هو موضح سابقًا (39). تم إنتاج PCNA البشري في الإشريكية القولونية باستخدام البلازميد pT7 / hPCNA وتنقيته إلى التجانس كما هو موصوف (46). تم التعبير عن المؤتلف البشري Pol β و Fen 1 و Lig I في بكتريا قولونية وتنقيته كما سبق وصفه (47-49). الأجسام المضادة لـ Hus1 و Rad9 الموصوفة في Toueille et al. (39) كانت هدية من R. Freire (تينيريف ، إسبانيا). كان الجسم المضاد للماعز المضاد لـ Rad1 (N18) ، وكذلك الجسم المضاد لـ APE 1 (Anti-Ref1 ، H300) للأرنب من التكنولوجيا الحيوية في سانتا كروز.

المقايسات الأنزيمية

قرد 1 فحص شق. تم تحضير ركيزة قليلة النوكليوتيد مزدوجة النوكليوتيد 100 نقطة أساس على النحو التالي: تم تلدين أليغنوكليوتيد 100 مير يحتوي على جزء THF في الموضع 43 إلى الشريط التكميلي (الشكل 1 ب). قبل التلدين ، كانت الآفة المحتوية على حبلا موصوفة بـ 5′ نهاية بـ T4 polynucleotide kinase و [γ- 32 P] ATP. تمت إزالة النيوكليوتيدات المسمى غير المدمجة على عمود دوران Sephadex G-25. تم إجراء تفاعلات شق APE 1 في خليط تفاعل (10 ميكرولتر) يحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي مولار EDTA ، 0.1 مجم / مل من BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة قليلة النوكليوتيد ، والكميات المشار إليها من APE 1. كانت نهايات ركيزة قليل النوكليوتيد إما حرة أو مسدودة بالبيوتين كما هو موضح في أساطير شخصية. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. لتحديد تأثير المركب 9-1-1 على نشاط APE 1 ، تم إجراء التفاعلات كما هو موضح أعلاه ، باستثناء أنه تم تضمين كميات ثابتة من APE 1 في خليط التفاعل وزيادة كمية 9-1-1 تمت إضافة المجمع كما هو موضح في الشكل 4 أ.

بول β فحص

تمت إضافة علامة إشعاعية على أليغنوكليوتيد 42 ميكر عند نهاية 5 وتم تلدينها باستخدام أليغنوكليوتيد 57 ميكر في اتجاه مجرى النهر إلى الشريط التكميلي 100 ميكر. يحتوي أليغنوكليوتيد مزدوج المسمى 32 P الناتج على فجوة 1-nt في الموضع 43 (الشكل 1B). تم تحديد توليف Pol DNA عن طريق قياس إدخال النوكليوتيدات في ركيزة DNA الموصوفة أعلاه. تم إجراء التفاعلات في حجم نهائي قدره 10 ميكرولتر يحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل BSA ، 2 ملي ATP ، 20 ميكرومتر لكل من dATP ، dCTP ، dGTP ، dTTP ، 50 fmol من ركيزة oligonucleotide المقطوعة ، والكميات المحددة من Pol. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي.

بول β مقايسة النشاط على الركيزة المحتوية على الآفة

تم تقييم نشاط Pol على ركيزة قليلة النوكليوتيد المزدوجة المسمى P-5′ والتي تحتوي على جزء THF في الموضع 43 في وجود كمية ثابتة من APE 1. تم تحضين التفاعلات لمدة 20 دقيقة عند 37 درجة مئوية في المخزن المؤقت للتفاعل (10 ميكرولتر) التي تحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي MgCl2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل BSA ، 2 ملي ATP ، 20 ميكرومتر لكل من dATP ، dCTP ، dGTP ، dTTP ، 50 fmol من THF تحتوي على ركيزة قليلة النوكليوتيد ، 55.5 fmol من APE 1 ، والمقادير المحددة من بول β. بعد الحضانة ، تم إيقاف التفاعلات بإضافة حجم متساوٍ من المخزن المؤقت لتحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، 0.02٪ زيلين سيانول) ، تم تسخينها عند 100 درجة مئوية لمدة 5 دقائق ، وتم فصل المنتجات عن طريق الرحلان الكهربي على هلام بولي أكريلاميد مفسد لطبيعة 10٪ وتصور بواسطة التصوير الشعاعي الذاتي.

فين 1 مقايسة نوكلياز داخلية

تم إجراء اختبار Fen 1 كما هو موضح مع بعض التعديلات (42). لتحضير ركيزة رفرف ، تم تلدين أليغنوكليوتيدات 42 و 68 مير إلى حبلا مكمل 100 مير. قبل التلدين ، تمت إضافة علامة إشعاعية على أليغنوكليوتيد 68 مير في نهاية 3 مع ديوكسينوكليوتيديل ترانسفيراز الطرفي و [α- 32 P] ddATP. كان قليل النوكليوتيد المزدوج المسمى P 32 ، الذي تم إعداده على هذا النحو ، يحتوي على رفرف 10-nt في الموضع 43 (الشكل 1B). تم إجراء مقايسة الانقسام Fen 1 في خليط التفاعل (10 ميكرولتر) المحتوي على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي مولار كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل من BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة أليغنوكليوتيد رفرف ، والكميات المشار إليها من Fen 1. تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة مكافئ حجم المخزن المؤقت لتحميل الهلام (95٪ فورماميد ، 20 مم EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. من أجل قياس التأثير التحفيزي للمركب 9-1-1 على نشاط نوكلياز Fen 1 ، تم إجراء التفاعلات في نفس الظروف ، باستثناء أن الكميات الثابتة من Fen 1 كانت موجودة في مخزن التفاعل (25 fmol) والكميات المحددة تمت إضافة مجمع 9-1-1 كما هو موضح في الشكل 8C.

الفحص الأول Lig

تم إجراء اختبار Lig I كما هو موصوف مع التعديلات (40) باستخدام 42 mer و 32 P-5′ المسمى 58 mer oligonucleotides المصلب إلى 100 mer التكميلي. تحتوي مخاليط التفاعل (10 ميكرولتر) على 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مول كلوريد ، 7.5 ملي MgCl2، 2 ملي ديثيوثريتول ، 0.5 ملي مولار EDTA ، 0.1 مجم / مل BSA ، 2 ملي مولار ATP ، 50 fmol من ركيزة قليلة النوكليوتيد المكسوة ، والكميات المشار إليها من Lig I تم تحضين التفاعلات عند 37 درجة مئوية لمدة 20 دقيقة وتوقفت عن طريق إضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 مم EDTA ، 0.02٪ بروموفينول أزرق ، و 0.02٪ زيلين سيانول). بعد الحضانة عند 100 درجة مئوية لمدة 5 دقائق ، تم فصل نواتج التفاعل عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10٪ وتم تصورها بواسطة التصوير الشعاعي الذاتي. لقياس التأثير التحفيزي للمركب 9-1-1 على نشاط Lig I ، تم إجراء التفاعلات في نفس الظروف باستثناء وجود كميات ثابتة من Lig I في المخزن المؤقت للتفاعل (0.5 fmol) والكميات المشار إليها من 9- تمت إضافة مجمع 1-1 كما هو موضح في الشكل 8 د.

معاد تكوينه في المختبر LP-BER

تم إجراء اختبار LP-BER كما هو موضح سابقًا مع التعديلات (14 ، 50). تم إجراء تفاعلات الإصلاح الكاملة في المخزن المؤقت للتفاعل (10 ميكرولتر) الذي تضمن: 45 ملي مولار Hepes / KOH (الرقم الهيدروجيني 7.8) ، 70 ملي مولار بوكل ، 7.5 ملي مول كلوريد2، 2 ملي ديثيوثريتول ، 0.5 ملي EDTA ، 0.1 مجم / مل من BSA ، 2 ملي ATP ، 20 ميكرومتر لكل o dATP ، dCTP ، dGTP ، dTTP ، و 50 fmol من 32 P-5′ المسمى 100 زوج من النوكليوتيد يحتوي على THF الشق في الموضع 43. كانت نهايات الركيزة قليلة النوكليوتيد إما حرة أو مسدودة بالبيوتين كما هو موضح في أساطير الشكل. لإعادة تكوين LP-BER باستخدام الركيزة غير المسماة ، تم استخدام نفس الشروط باستثناء أنه تم تقليل تركيز dTTP إلى 8 ميكرومتر وأضيف [α- 32 P] dTTP (2.5 μCi) إلى مخاليط التفاعل. بدأت التفاعلات بإضافة APE 1 المنقى (55 fmol) ، Pol (64 fmol) ، Fen 1 (93 fmol) ، و Lig I (245 fmol). تمت إضافة كميات متزايدة من مجمع 9-1-1 إلى LP-BER المعاد تكوينه في المختبر التفاعل في ظل ظروف محدودة لكل من الإنزيمات الأربعة APE 1 و Pol و Fen 1 و Lig I (انظر "النتائج"). بعد الحضانة عند 37 درجة مئوية لمدة 20 دقيقة ، تم إيقاف التفاعلات بإضافة حجم متساوٍ من محلول تحميل الهلام (95٪ فورماميد ، 20 ملي مولار EDTA ، 0.02٪ بروموفينول أزرق ، 0.02٪ زيلين سيانول) ، تم تسخينها عند 100 درجة مئوية لـ 5 دقائق ، وتم فصل المنتجات النهائية عن طريق الرحلان الكهربي على هلام بولي أكريلاميد بنسبة 10 ٪ وتم تصورها بواسطة التصوير الإشعاعي الذاتي.

فحوصات المنسدلة

بالنسبة إلى عمليات السحب الخاصة به ، تم تحضين 6 ميكروغرام من مجمع 9-1-1 الذي يحمل علاماته أو الوحدات الفرعية ذات العلامات Rad9 أو Rad1 أو Hus1 مع 1 ميكروغرام من APE 1 لمدة ساعتين عند 4 درجات مئوية في المخزن المؤقت المنسدل [50 ملي مولار) Tris-HCl (درجة الحموضة 8.0) ، 100 ملي كلوريد الصوديوم ، 0.05٪ (حجم / حجم) NP-40]. تم بعد ذلك إضافة حبات Ni 2+ ، المغلفة مسبقًا بحضانة طوال الليل في محلول منسدل يحتوي على 5 ملغ / مل من BSA ، متبوعًا بثلاث غسالات في المخزن المنسدل ، إلى البروتينات. تم تحضين العينات بعد ذلك عند 4 درجات مئوية لمدة ساعة واحدة. بعد الغسيل خمس مرات في محلول منسدل يحتوي على 5 ملي إيميدازول ، تم تسخين الحبيبات لمدة 5 دقائق عند 95 درجة مئوية في عازلة Laemmli وتم تحليل البروتينات المشتركة المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المحددة.

بالنسبة لسحب APE 1-sepharose ، تم ربط APE 1 أو BSA المنقى ، المستخدم كعنصر تحكم سلبي ، بشكل تساهمي مع Sepharose المنشط CNBr (Amersham Pharmacia Biotech) كما هو موصوف من قبل المورد ، بنسبة نهائية 1 ميكروغرام من البروتين / ميكرولتر من الخرز. تم غسل APE 1-sepharose أو BSA-sepharose (10 ميكرولتر) مرة واحدة في المخزن المنسدل الذي يحتوي على 10 مجم / مل من BSA وثلاث مرات في المخزن المنسدل. تم تحضين الخرزات بعد ذلك بـ 300 نانوغرام من مركبته 9-1-1 لمدة ساعتين في المخزن المؤقت المنسدل عند 4 درجات مئوية. بعد الغسيل خمس مرات في المخزن المنسدل ، تم تسخين الحبيبات لمدة 5 دقائق عند 95 درجة مئوية في محلول Laemmli وتم تحليل البروتينات المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المحددة.

مقتطفات الخلية الكاملة

لتحضير مستخلصات الخلايا الكلية ، تم حصاد 7 × 10 6293T خلايا عن طريق التربسيني يليها الطرد المركزي. تم تفكيك حبيبات الخلية لاحقًا في محلول تحلل الخلية [50 ملي مولار Hepes-KOH ، درجة الحموضة 7.5 ، 400 ملي كلوريد الصوديوم ، 1 ملي مولار DTT ، 2.5 ملي مولار كلوريد الصوديوم2، 20٪ جلسرين ، 0.5٪ (حجم / حجم) NP40 ، 2 ميكروغرام / مل ليوبتين ، 1 ميكروغرام / مل بيستاتين ، 1 ميكروغرام / مل بيبستاتين ، 2 ملي PMSF ، 10 ملي جلسيروفوسفات ، 1 ملي نايف ، 10 ملي نا4ص2ا7] لمدة 15 دقيقة عند 4 درجات مئوية. تم بعد ذلك الطرد المركزي لمحلول الخلية لمدة 15 دقيقة عند 10000 دورة في الدقيقة ، وتم جمع المادة الطافية وحفظها كمستخلص خلية كلي. تم تحديد تركيز البروتين باستخدام اختبار برادفورد.

المناعية

بالنسبة للتداعيات المناعية ، تم طلاء 25 ميكرولتر من البروتين G sepharose لمدة 3 ساعات عند 4 درجات مئوية مع 100 ميكروغرام من BSA في المخزن المؤقت IP (40 ملي مولار Hepes-KOH ، درجة الحموضة 7.5 ، 100 ملي كلوريد الصوديوم ، 8 ملي MgCl2، 2 ميكروغرام / مل ليوبتين ، 1 ميكروغرام / مل بيستاتين ، 1 ميكروغرام / مل بيبستاتين ، 2 ملي PMSF ، 10 ملي جلسيروفوسفات ، 1 ملي مولار NaF ، 10 ملي مولار Na4ص2ا7) ثم حضنت طوال الليل بـ 3 ميكروغرام من الأجسام المضادة لـ Rad9 أو IgG الأرنب غير المحصن. بعد ثلاث غسلات في محلول IP ، تم تحضين الحبيبات بـ 1 مجم من خلاصة الخلايا الكلية 293 T لمدة 3 ساعات عند 4 درجات مئوية. بعد الحضانة ، تم غسل الحبيبات ثلاث مرات في محلول IP يحتوي على 0.05 ٪ NP40 ثم تم تسخينها بعد ذلك لمدة 5 دقائق عند 95 درجة مئوية في محلول Laemmli. تم تحليل البروتينات المشتركة المترسبة بواسطة لطخة غربية باستخدام الأجسام المضادة المقابلة وفقًا للطرق المعمول بها.


النتائج

موقع AP في حلقة 7-nt التي تقطعت بها السبل لا يتم التعرف عليها بشكل جيد بواسطة نوكليازات الخميرة AP

لقد أثبتنا وآخرون أنه يمكن استخدام ssOligos الذي يحتوي على آفة فريدة لدراسة مجازة الآفة في الخميرة [21 ، 22]. ال lys2 & # x00394A746 الأليل هو & # x022121 أليل انزاح إطار وقد ثبت أنه مفيد بشكل خاص لدراسة تجاوز الآفة [21 ، 22]. ميزة فريدة من نوعها lys2 & # x00394A746 الأليل هو أن تغيير إطار +1 التعويضي يمكن أن يحدث في أي مكان داخل نافذة انعكاس 150 bp & # x0201d تقريبًا & # x0201d ، وبالتالي ، يمكن أن يحتوي تحويل ssOligos على نيوكليوتيد أو آفة مصححة في أي مكان داخل هذه النافذة [21 ، 22 ، 27]. بالإضافة إلى ذلك ، فإن lys2 & # x00394A746 يمكن أن تقبل نافذة الانعكاس عددًا كبيرًا من إدخالات النوكليوتيدات بخطوات 3n +1 (ن = 0،1،2،3.). وقد تم إثبات ذلك من خلال عملنا الأخير الذي أظهر أن الخميرة يمكن أن تتحول بشكل فعال باستخدام ssOligos الذي يصلب إلى الحمض النووي الصبغي لتوليد إما حلقة 1-nt أو 7-nt [22]. هاتان السمتان المميزتان تجعل lys2 & # x00394A746 الأليل جذاب للغاية لدراسة آليات الطفرات ، لا سيما فيما يتعلق بتأثير سياق التسلسل على تجاوز الآفة الطفرية.

يمكن لمعظم إنزيمات إصلاح الحمض النووي ، بما في ذلك APN1 ، التعرف بشكل فعال على تلف الحمض النووي فقط عندما تكون الآفة في سياق الحمض النووي المزدوج الشريطة. أظهرت دراستنا السابقة أنه عندما يتم تحويل الخميرة باستخدام ssOligo الذي يولد حلقة 1-nt تحتوي على موقع AP ، لوحظ التحول الفعال فقط في الخميرة. apn1 المسوخات التي تفتقر إلى نوكلياز AP ​​الرئيسي ، APN1 [21]. تشير هذه البيانات إلى أن الخميرة APN1 لا يزال بإمكانها التعرف على موقع AP عندما تقع الآفة في حلقة 1-nt. ومع ذلك ، من المتوقع أنه عندما يقع موقع AP في حلقة مفردة أكبر ، سيتوقف APN1 عن التعرف على آفة AP.من أجل تأكيد ذلك ، تم فحص ssOligo الذي يصلب لإنشاء حلقة مفردة 7-nt تحتوي على موقع AP ذو موقع مركزي للتحقق من قابليته للتأثر بالركيزة باستخدام الخميرة النقية APN1 (الشكل 1). تم تحضير Duplex D-U4 و heteroduplex D - (+ 7) U4 عن طريق تهجين قليل النوكليوتيد COD (+7) -U4 إلى CS و CS-7 ، على التوالي. ثم تم تحضير Duplex D-S4 و heteroduplex D - (+ 7) S4 ، الذي يحتوي على موقع AP الموجود في حالة ازدواج مثالية أو في حلقة 7-nt ، على التوالي ، عن طريق احتضان D-U4 على الوجهين ومضاعف مزدوج D - (+ 7) U4 بكمية زائدة من جليكوزيلاز DNA uracil. تمت معالجة Duplex D-S4 و heteroduplex D - (+ 7) S4 بتركيزات مختلفة من الخميرة APN1. يوضح الشكل 1 أن APN1 يتعرف بكفاءة على آفة AP عندما تكون في DNA مزدوج مثالي (الممرات 3 & # x022126) ومع ذلك ، فشل APN1 في التعرف على موقع AP عندما كان موقع AP في حلقة 7-nt (الممرات 7 & # x0221210) . لوحظ خدش ملحوظ للطراز D-S4 المزدوج عند 6 نانوغرام من APN1 (الشكل 1 ، الممر 4) ، ولوحظ وجود خدش أكبر من 90 ٪ من D-S4 مزدوج الاتجاه عند تركيزات APN1 أكبر من 30 نانوغرام (الشكل 2 ، حارة 6). على النقيض من ذلك ، في ظل نفس ظروف التفاعل ، لم يلاحظ أي خدش ملموس للزاوية المزدوجة D - (+ 7) S4 حتى عند 150 نانوغرام من APN1 (الشكل 1 ، الممر 10). عندما يصلب ssOligo COD (+7) -S4 إلى الجينوم lys2 & # x00394A746 أليل من النوع البري APN1 الخميرة (SJR922) ، سيتم إنشاء حلقة متطابقة 7-nt تحتوي على موقع AP ذو موقع مركزي (انظر الشكل 1 ، البيانات التكميلية). من المتوقع أن يكون موقع AP في الحلقة 7-nt مقاومًا لنشاط APN1 الخلوي ، وبالتالي من المتوقع أن يتمكن المرء من دراسة تجاوز موقع AP في خميرة من النوع البري وتتقن الإصلاح. لإثبات ذلك ، قمنا بمقارنة عدد المحولات التي تم الحصول عليها عن طريق تحويل سلالات متحولة مختلفة ناقصة الإصلاح مع 300 ميكرولتر من COD (+7) -S4. لقد أوضحنا سابقًا أن 300 ميكرومتر من ssOligo هو الأمثل وضمن النطاق الخطي للتحول [21 ، 22]. يوضح الجدول الأول أن متوسط ​​عدد المحولات التي تم الحصول عليها كان مشابهًا لجميع السلالات التي تم اختبارها ، بما في ذلك الخميرة البرية SJR922 ، SJR1777 (apn1 & # x00394) ، SJR1780 (apn1 & # x00394 apn2 & # x00394) و SJR2367 (apn1 & # x00394 ogg1 & # x00394). تشير هذه البيانات إلى أنه لا APN1 ولا إنزيمات إصلاح الحمض النووي الأخرى مثل APN2 و OGG1 قادرة على بدء إصلاح موقع AP عندما تقع الآفة في منتصف حلقة 7-nt.

ركائز مزدوجة (D-S1 و D-S2 و D-S3 و D-S5 و D-S6 و D-S7) وركائز مضاعفة غير متجانسة تحتوي على حلقة 7-nt [D (+7) -S1، D (+7 ) -S2 ، D (+7) -S3 ، D (+7) -S5 ، D (+7) -S6 ، و D (+7) -S7] تم تحضيرها كما هو موضح في الإجراءات التجريبية. تمت معالجة خمسين fmoles من الركائز المزدوجة وغير المتجانسة التي تحتوي على موقع AP بكميات متفاوتة من الخميرة APN1 عند 37 & # x000b0C لمدة 15 دقيقة. اللوحة S1: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S1 Panel S2: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S2 Panel S3: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S3 Panel S5: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S5 Panel S6: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S6 Panel S7: ركائز مبنية باستخدام قليل النوكليوتيد COD (+7) -S7.

الجدول الأول

عدد المحولات التي تم الحصول عليها باستخدام COD (+7) -S4 في Lys2 & # x00394A746 أليل.

التركيب الجيني ذي الصلةإكسب # 1إكسب # 2إكسب # 3متوسط
WT1150222817661715 & # x000b1540
& # x00394apn1994233011001474 & # x000b1742
& # x00394apn1 & # x00394apn21116212624481897 & # x000b1 695
& # x00394apn1 & # x00394ogg11104216225441924 & # x000b1741

كانت الانتكاسات الخلفية لكل من هذه السلالات في نطاق 40 & # x0221260 مستعمرة ، مع أو بدون 300 بيكومول من قليل النوكليوتيد المتحكم ، COD-AR.

قد يختلف نشاط APN1 على موقع AP اعتمادًا على ما إذا كان موقع AP في القاعدة 5 & # x02019 أو في القاعدة 3 & # x02019 للحلقة. لتحديد ما إذا كان موضع موقع AP داخل حلقة 7-nt يؤثر على نشاط APN1 ، تم التعامل مع ركائز حلقة 7-nt تحتوي على موقع AP في مواقع مختلفة داخل الحلقة باستخدام APN1. يوضح الشكل 2 أنه عندما يقع موقع AP في المواضع S2 إلى S7 (انظر الشكل 1 ، البيانات التكميلية) في الحلقة 7-nt ، لم يلاحظ أي خدوش ملحوظة للركائز متغايرة الازدواج بواسطة APN1 حتى عند 75 نانوغرام من APN1 (الشكل 2) ، اللوحات من S2 إلى S7). ومع ذلك ، عندما يقع موقع AP في الموضع 5 & # x02019 للحلقة (موضع S1 ، الشكل 1 ، البيانات التكميلية) ، لوحظ انقسام كبير في الركيزة بتركيزات عالية من APN1 (الشكل 2 ، اللوحة S1). عند 30 نانوغرام و 75 نانوغرام من APN1 ، تم شق 13٪ و 78٪ من ركائز الحلقة 7-nt (الشكل 2 ، اللوحة S1 ، الممرات 2 و 3). في المقابل ، عند 6 نانوغرام من APN1 ، يكون أكبر من 95 ٪ من الركيزة المزدوجة مشقوقًا (الشكل 2 ، اللوحة S1 ، الممر 4). تشير هذه البيانات إلى أن هذا النظام مناسب بشكل عام لدراسة تجاوز موقع AP في خلايا الخميرة من النوع البري والتي تتسم بالكفاءة في الإصلاح. عندما يقع موقع AP في القاعدة 5 & # x02019 للحلقة 7-nt (موضع S1 ، الشكل 1 ، البيانات التكميلية) ، ومع ذلك ، من المتوقع انخفاض كفاءة التحويل بسبب الإصلاح المحتمل بواسطة نشاط APN1 الخلوي. يظهر هذا بوضوح في الشكل 3. يوضح الشكل 3 أن متوسط ​​عدد المحولات التي تم الحصول عليها مع كل أليغنوكليوتيدات COD [COD (+7) -S2 إلى COD (+7) -S7] ، باستثناء COD (+7) -S1 ، متشابهة لكل من البرية- اكتب و apn1 خميرة. على سبيل المثال ، WT و apn1 تحولت الخميرة مع 300 ميكرومتر من COD (+7) -S7 أنتجت 1144 و 1374 Lys + محولات ، على التوالي. في المقابل ، WT و apn1 تحولت الخميرة مع 300 ميكرومتر من COD (+7) -S1 أنتجت 709 و 1450 Lys + محولات ، على التوالي. هذا يتفق مع الملاحظة أنه عندما يقع موقع AP في القاعدة 5 & # x02019 من الحلقة 7-nt (موضع S1 ، الشكل 1 ، البيانات التكميلية) ، لا يزال بإمكان APN1 شق آفة موقع AP ، وبالتالي إنشاء أقل عدد محولات الخميرة البرية.

كل من WT و apn1 تم تحويل الخميرة الطافرة باستخدام 300 ميكرولتر من أليغنوكليوتيدات COD. تم رسم عدد المحولات التي تم الحصول عليها مقابل موضع موقع AP داخل حلقة 7-nt. تمثل كل بيانات متوسط ​​تحولين مستقلين ، وشريط الخطأ المرسوم هو نموذج الانحراف المعياري.

التحقق من صحة نظام الحلقة 7-nt لدراسة مجازة الآفة في الخميرة البرية

توضح التجربة أعلاه بوضوح أنه يمكن استخدام COD ssOligos التي تحتوي على موقع AP لدراسة تجاوز موقع AP في الخميرة التي تتسم بالكفاءة في الإصلاح. للتحقق من أن ssOligos الذي يحتوي على حلقة a7-nt مناسب لدراسة تجاوز الآفة ، سنحدد دور بوليمرات تجاوز آفة الحمض النووي المختلفة في تجاوز موقع AP. تم إجراء التحويل باستخدام ssOligos COD (+7) -S4 و COD (+7) -F4 الذي يحتوي على موقع AP فريد ورباعي هيدروفيوران ، نظير موقع AP ، على التوالي. تم تحويل الخميرة البرية من النوع الكهربي (SJR922) بمزيج يحتوي على 300 ميكرولتر من ssOligo و 5 نانوغرام من pSR313 بلازميد ، أ HIS3-تحتوي CEN بلازميد. تم استخدام نسبة مستعمرات Lys + / His + لمقارنة كفاءة تحويل عنصر تحكم ssOligo [COD (+7) -A4] مع نسبة ssOligos التي تحتوي على موقع AP أو رباعي هيدروفيوران [COD (+7) -S4 و COD (+7) -F4] ، وتم استخدامه لحساب كفاءة تجاوز موقع AP (الجدول II). يوضح الجدول II أنه تم تجاوز كل من موقع AP و THF بكفاءات عالية نسبيًا ، عند 65٪ و 59٪ على التوالي. كانت الكفاءات الالتفافية الملحوظة أعلى بكثير من تلك التي أبلغنا عنها سابقًا والآخرون [14-16 ، 19-21]. في النتائج السابقة باستخدام ssOligos التي تولد حلقة +1 nt تحتوي على موقع AP ، لوحظ أن كفاءة التجاوز في النوع البري أقل من 10٪ لكل من lys2 & # x00394A746[21] و cyc1 & # x022121 الأليلات [20].

الجدول الثاني

تجاوز الكفاءة في موقع AP و THF في الخميرة التي تتطلب كفاءة في الإصلاح.

التحكم في DNA COD (+7) -A4AP DNA COD (+7) -S4THF DNA COD (+7) -F4
إكسب. # 1إكسب. # 2إكسب. # 1إكسب. # 2إكسب. # 1إكسب. # 2
pRS313 أ (P)288002064017600207203056020880
ssOligo ب (L)308023401260144016401574
L / ف0.1070.1130.0720.0700.0540.075
المتوسط ​​(L / P)0.11 & # x000b10.00420.071 & # x000b10.00140.065 & # x000b10.0148
كفاءة الالتفافية ج 10.650.59

لقد أظهرنا نحن وآخرون أن تجاوز موقع AP يتطلب المشاركة النشطة لـ REV1 و Pol & # x003b6 (REV3 / REV7) ولكن ليس RAD30 Polymerase & # x003b7) [14-16 ، 20 ، 21]. من أجل إثبات أن تجاوز موقع AP في الخميرة البرية يعتمد أيضًا بشكل أساسي على بروتينات REV1 و REV3 ، فإن طفرات الخميرة تفتقر إلى REV1, REV3 أو RAD30 تم تحويل الجين باستخدام COD (+7) -S4 و COD (+7) -F4. يوضح الشكل 4 أنه عند استخدام COD (+7) -S4 لتحويل الخميرة ، انخفضت الكفاءات الالتفافية لموقع AP بشكل ملحوظ في rev1 & # x00394(7.4٪) و rev3& # x00394 (2.7٪) طفرات ، ولم تتأثر بها rad30 & # x00394 متحولة (88٪). لوحظ انخفاض أقل في كفاءة الالتفافية لـ THF rev1 & # x00394, rev3 & # x00394 و rad30 & # x00394 المسوخ (21٪ و 11٪ و 55٪ على التوالي). تتوافق هذه البيانات مع الملاحظات السابقة التي تتجاوز كفاءات THF في كليهما rev1 & # x00394 و rev3 & # x00394 كانت الطفرات أعلى بكثير من كفاءة الالتفافية لموقع AP ، مما يشير إلى أن قدرًا كبيرًا من الالتفافية في بقايا THF يتم توسطه بواسطة بوليمرات أخرى غير REV1 و REV3 [20 ، 21]. من المحتمل أن يكون جزء على الأقل من تجاوز THF المتبقي بسبب Pol & # x003b7.

تم استخدام oligonucloetide COD أحادي الجديلة (+7) -S4 لتحويل النوع البري ، rev1 & # x00394 ، rev3 & # x00394 ، و rad30 & # x00394 سلالات. تم تحديد الكفاءات الالتفافية لمواقع AP و THF كما هو موضح في الجدول II.

لمزيد من فحص أدوار REV1 و Pol & # x003b6 في Pol & # x003b7 ، التجاوز وموقع AP الذي تم إنشاؤه بواسطة COD (+7) -S4 ، تم تسلسل المحولات وتم الحصول على خصوصية الطفرة لكل من سلالات الخميرة (الجدول الثالث) ). كما هو متوقع ، كانت dC (68 ٪) متبوعة بـ dA (32 ٪) هي النيوكليوتيدات الرئيسية التي تم إدخالها عبر موقع AP وهي خميرة من النوع البري (الجدول III). حذف REV1 أو REV3 أدى الجين إلى تقليل التيار المستمر وزيادة تواتر دمج dA عبر موقع AP (إدخال dA في النوع البري هو 31٪ مقارنة بـ 64٪ و 82٪ لـ & # x00394rev1 و & # x00394rev3، على التوالى). كان النمط العكسي واضحًا في Pol & # x003b7- معيب راد 30 متحولة ، مع زيادة دمج dC إلى 81٪ وتراجع dA إلى 19٪. يتوافق هذا مع التفسير القائل بأن Pol & # x003b7 يلعب دورًا ثانويًا في إدراج dA مقابل موقع AP.

الجدول الثالث

خصوصية تجاوز موقع نقطة الوصول التي تم إنشاؤها بواسطة COD (+7) -S4 في الخميرة المتقنة للإصلاح.

سلالة الخميرةتم إدخال٪ نوكليوتيد عبر موقع نقطة الوصول (لا أ)
ددي جيتيار مستمردي تي
النوع البري32.0 (8)-68.0 (17)-
& # x00394rad3019.1 (4)-80.9 (17)-
& # x00394rev163.6 (14)9.1 (2)18.2 (4)9.1 (2)
& # x00394rev381.8 (18)13.6 (3)4.5 (1)-

تأثير سياق التسلسل على تجاوز موقع AP

من أجل فحص تأثير سياق التسلسل على تجاوز موقع AP ، تم استخدام ssOligos التي تحتوي على مواقع AP المضمنة في سياق تسلسل مختلف لمقايسة التحويل (الشكل 1 ، البيانات التكميلية). سلسلة COD و NC من قليل النوكليوتيدات هي ssOligos لها نفس تسلسل السلاسل المشفرة وغير المشفرة في LYS2 الجين ، على التوالي. في سياق تكرار الكروموسوم ، LYS2 يتم تكرار الجين بشكل أساسي من أصل المنبع ، مما يجعل السلاسل المشفرة وغير المشفرة هي السلاسل المتخلفة والرائدة للنسخ المتماثل ، على التوالي [31]. يوضح الجدول الرابع أن تجاوز الكفاءات لمواقع AP التي لوحظت في التجارب التي تستخدم ثمانية أنواع من COD ssOligos تراوحت من 7 ٪ إلى 74 ٪. وبالمثل ، عندما تم إجراء تحويلات الخميرة باستخدام NC ssOligos ، تباينت أيضًا الكفاءات الالتفافية لمواقع AP بشكل كبير ، واعتمادًا على موضع موقع AP داخل الحلقة 7-nt ، تراوحت من 8٪ إلى 35٪. تدعم هذه البيانات بوضوح فكرة أن تجاوز كفاءة موقع AP يتأثر بشكل كبير بسياق التسلسل الذي يحيط بالآفة. لتأكيد تأثير سياق التسلسل على تجاوز موقع AP ، قمنا بمقارنة كفاءات تجاوز اثنين من ssOligos لهما موقع AP في نفس الموضع في الحلقة ، ولكن في سياق تسلسل مختلف. أظهر الجدول الرابع أن تجاوز كفاءة موقع AP الذي تمت ملاحظته باستخدام COD (+7) -S4 & # x02019 كان أقل بكثير من COD (+7) -S4 (16٪ مقابل 74٪) ، مما يدعم فكرة أن سياق التسلسل المحيط بـ AP يمكن أن يؤثر الموقع على الكفاءة الالتفافية لموقع AP. ومع ذلك ، هناك احتمال أن يتم التعرف على مواقع AP في الجزء السفلي من الحلقة أو بالقرب منها بواسطة APN1 ، مما يؤدي إلى انخفاض كفاءة التجاوز بشكل واضح. كما هو موضح سابقًا ، فقط عندما كان موقع AP موجودًا في القاعدة 5 & # x02019 من الحلقة ، لاحظنا اعترافًا كبيرًا من قبل APN1 (الشكل 2 ، اللوحة S1) ، وهذا قد يفسر انخفاض كفاءة تجاوز AP الذي لوحظ في 5 & # قاعدة الحلقة x02019 [COD (+7) -S1 و NS (+7) -S7 ssOligos ، الجدول الرابع] مقارنة بقاعدة الحلقة 3 & # x02019 [COD (+7) -S7 و NC (+7 ) -S1 ssOligos ، الجدول الرابع].

الجدول الرابع

تأثير سياق التسلسل على كفاءة تجاوز موقع AP في الخميرة من النوع البري.

تصلب قليل النوكليوتيدات لتجاوز موقع AP حبلا رائد على حبلا متخلفة.٪ تجاوز أ (WT)قليل النوكليوتيدات يصلب إلى مسار موقع AP المتخلف على الخيط الرئيسي.٪ تجاوز b (WT)٪ تجاوز ب (rev1 & # x00394)٪ تجاوز ب (rev3 & # x00394)٪ تجاوز ب (rad30 & # x00394)
COD (+7) -S17.3 & # x000b1 4.4NC (+7) -S111.5 & # x000b1 7.21.1 & # x000b1 0.40.8 & # x000b1 0.715.1 & # x000b1 4.3
COD (+7) -S224.5 & # x000b1 2.3NC (+7) -S222.0 & # x000b1 12.61.8 & # x000b1 0.10.8 & # x000b1 0.518.9 & # x000b1 6.0
COD (+7) -S344.6 & # x000b1 18.3NC (+7) -S321.7 & # x000b1 10.72.0 & # x000b1 0.51.5 & # x000b1 0.534.7 & # x000b1 13.1
COD (+7) -S473.5 & # x000b1 11.4NC (+7) -S434.9 & # x000b1 3.911.4 & # x000b1 4.38.0 & # x000b1 5.936.5 & # x000b1 0.7
COD (+7) -S418.3 & # x000b1 5.4 ج --------------------
COD (+7) -S530.0 & # x000b1 6.2NC (+7) -S518.4 & # x000b1 0.47.5 & # x000b1 1.11.9 & # x000b1 0.528.8 & # x000b1 6.7
COD (+7) -S633.0 & # x000b1 6.1NC (+7) -S614.5 & # x000b1 1.31.2 & # x000b1 1.00.6 & # x000b1 0.113.1 & # x000b1 3.7
COD (+7) -S714.6 & # x000b1 3.3NC (+7) -S77.8 & # x000b1 1.01.1 & # x000b1 0.20.7 & # x000b1 0.36.4 & # x000b1 2.9

لتحديد تأثير سياق التسلسل على أنشطة REV1 و Pol & # x003b6 و Pol & # x003b7 ، تم إجراء تحويلات ssOligo بوساطة في rev1 & # x00394 ، rev3 & # x00394 و rad30 & # x00394 المسوخ (الجدول الرابع ، الجدول الأول في البيانات التكميلية يوضح بيانات التجاوز الفعلية للتحولين المستقلين اللذين تم إجراؤهما لهذه السلالات المتحولة). كما هو متوقع ، في حالة عدم وجود بروتين REV1 أو REV3 ، تضاءلت الكفاءة الالتفافية لمواقع AP بشكل كبير إلى نطاق من 1٪ إلى 11٪ (الجدول الرابع). كانت الكفاءات الالتفافية لموقع AP أقل باستمرار في rev3 & # x00394 مما كانت عليه في rev1 & # x00394 متحولة ، مما يشير إلى أن التجاوز لا يعتمد بشكل كامل على REV1. كما هو موضح في الجدول الرابع ، كانت الكفاءات الالتفافية في غياب REV1 أو REV3 تعتمد أيضًا على سياق التسلسل بطريقة تشبه الخميرة من النوع البري. في حالة عدم وجود REV1 أو REV3 ، من المحتمل أن يتم تنفيذ تجاوز موقع AP بواسطة Pol & # x003b1 / & # x003b4 [16] ، مما يشير إلى أن تجاوز موقع AP بواسطة Pol & # x003b1 / & # x003b4 قد يتأثر بالمثل حسب سياق التسلسل. كما هو متوقع ، لعب RAD30 دورًا ثانويًا فقط في تجاوز مواقع AP (الجدول الرابع) ، مع كفاءات تجاوز لمواقع AP التي لوحظت مع NC ssOligos في rad30 & # x00394 متحولة مماثلة لتلك التي لوحظت في الخميرة البرية (قارن rad30 & # x00394 عمود مع عمود NC في الجدول الرابع). مجتمعة ، تشير هذه البيانات إلى أن سياق التسلسل المحيط بموقع AP يمكن أن يكون له تأثير كبير على قدرة هذه البوليمرات على إدخال أو توسيع نيوكليوتيد عبر موقع AP.

عندما تم تسلسل المحولات المشتقة من سلسلة COD الخاصة بـ ssOligos في الخلفية البرية ، لوحظ أن dC هو النيوكليوتيد المفضل الذي تم إدخاله مقابل موقع AP (يتراوح من 52 ٪ إلى 66 ٪ ، الجدول V) كان dA هو ثاني أكثر إدراجًا بشكل متكرر النوكليوتيدات (تتراوح من 12٪ إلى 44٪ ، الجدول الخامس). تتوافق خصوصية الطفرة مع REV1 باعتباره الإنزيم الرئيسي المسؤول عن إدخال النوكليوتيدات عبر جميع مواقع AP بغض النظر عن سياق التسلسل.

الجدول الخامس

تأثير سياق التسلسل على خصوصية تجاوز موقع AP.

تسلسل قليل النوكليوتيد أ تم إدخال٪ نوكليوتيد (لا ب)
تيار مستمر د دي جي دي تي
COD (+7) -S764(9)36(5)--
5 & ​​# x02032 - GTCX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGسCGACCATTAA & # x020135 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S656(10)44(8)--
5 & ​​# x02032 - GTCTX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGAسGACCATTAA-5 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S552(9)12(2)-35(6)
5 & ​​# x02032 - GTCTGX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGACسACCATTAA-5 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S464(11)29(5)6(1)6(1)
5 & ​​# x02032 - GTCTGCX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGACGسCCATTAA-5 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S360(18)33(10)7(2)-
5 & ​​# x02032 - GTCTGCTX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGACGAسكاتا 5 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S266 (14)34 (7)--
5 & ​​# x02032 - GTCTGCTGX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGACGACسATTAA-5 & # x02032 & # x02003 & # x02003 & # x02003 & # x02003
COD (+7) -S156(18)38(12)-6(2)
5 & ​​# x02032 - GTCTGCTGGX
& # x000a0 & # x000a0 & # x000a0 & # x000a0 - CAGACGACCسTTAA-5 & # x02032

تأثير اتجاه النسخ المتماثل على تجاوز موقع AP

كانت الكفاءات الالتفافية لمواقع AP في الخميرة البرية المحددة باستخدام COD ssOligos [COD (+7) -S3 و -S4 و -S6 و -S7] أعلى مرتين تقريبًا من NC ssOligos [NC (+7 ) -S3 و -S4 و -S5 و -S7]. تهجين COD و NC ssOligos إلى السلاسل الرائدة والمتأخرة من النسخ المتماثل ، على التوالي ، في النوع البري SJR922 (الجدول الرابع).وبالتالي ، ستكون مواقع AP المشتقة من COD و NC ssOligo على القوالب المتأخرة والرائدة أثناء الجولة اللاحقة من تخليق الحمض النووي ، وسيحدث تجاوز موقع AP في التأخر والتقدم ، على التوالي (انظر الشكل 2 أ ، إضافي البيانات). تشير هذه البيانات إلى أن تجاوز مواقع AP قد يكون أكثر كفاءة في التأخر مقارنة بالخيط الرئيسي لتكرار الحمض النووي. حتى لأننا أظهرنا أن تجاوز موقع AP يتأثر بشكل كبير بسياق التسلسل المحيط بموقع AP ، فإن الاختلاف في كفاءات التجاوز بين NC و COD ssOligos قد يكون راجعاً فقط إلى الاختلافات في سياق التسلسل الذي يحيط بمواقع AP . من أجل تحديد ما إذا كان تجاوز موقع AP معين يتأثر باتجاه تكرار الحمض النووي ، تم إجراء تجاوز لمواقع AP في سلالتين من الخميرة ، SJR1454 و SJR1141 ، باستخدام نفس ssOligos (الجدول السادس). في SJR1141 ، تم إنشاء ملف LYS2 تم عكس الجين بالنسبة إلى أصل النسخ المتماثل في المنبع ، مما يعكس هوية السلاسل الرائدة والمتأخرة. لأن التقليب LYS2 الجين أدى أيضا إلى تعطيل RAD16 الجين ، أ rad16 & # x00394 تم استخدام مشتق من SJR922 (SJR1454) في هذه التجارب. وبالتالي ، فإن NC ssOligos سوف يصلب إلى السلاسل الرائدة والمتأخرة من LYS2 في SJR1141 و SJR1454 ، على التوالي ، وسيحدث تجاوز موقع AP في هذه السلالات على السلاسل المتأخرة والرائدة ، على التوالي (الشكل 2 ب ، البيانات التكميلية). على الرغم من أن بياناتنا السابقة تشير إلى أن تحويل الخميرة بواسطة قليل النوكليوتيد المنفرد الذي تقطعت به السبل يكون أكثر كفاءة بشكل ملحوظ عندما يتهجين قليل النوكليوتيد مع الخيط المتأخر ([22] انظر أيضًا الجدول الثاني ، البيانات التكميلية) ، يتم تصحيح الاختلافات في كفاءات تحويل الخيوط الرائدة والمتأخرة عندما يتم تطبيع الكفاءات الالتفافية لمواقع AP ضد قليل النوكليوتيدات التي لا تحتوي على مواقع AP (انظر الجدول II لمعرفة كيفية حساب كفاءة التجاوز). يوضح الجدول السادس أن الكفاءات الالتفافية لمواقع AP التي لوحظت مع NC ssOligos NC (+7) -S4 و NC (+7) -S5 و NC (+7) -S6 يبدو أنها أعلى مرتين في SJR1141 مقارنة بـ SJR1454 ، ولم يلاحظ وجود فروق ذات دلالة إحصائية في كفاءات الالتفاف مع ssOligos الأخرى ، لذلك فمن المحتمل ألا يتأثر تجاوز مواقع AP باتجاه تكرار الحمض النووي. تتفق هذه الملاحظة مع الملاحظات الأخيرة لصفحات وآخرون [18].

الجدول السادس

تجاوز موقع AP في الشريط الأمامي والمتخلف.

SJR1141 حبلا قيادية أ ٪ تجاوز ج SJR1454 حبلا متخلف ب ٪ تجاوز ج
NC (+7) -S126.1 & # x000b1 7.1NC (+7) -S120.3 & # x000b1 5.7
NC (+7) -S237.9 & # x000b1 11.0NC (+7) -S241.6 & # x000b1 14.4
NC (+7) -S339.2 & # x000b1 2.3NC (+7) -S337.9 & # x000b1 12.9
NC (+7) -S462.8 & # x000b1 17.9NC (+7) -S446.2 & # x000b1 16.1
NC (+7) -S559.5 & # x000b1 15.4NC (+7) -S524.9 & # x000b1 5.9
NC (+7) -S633.2 & # x000b1 8.6NC (+7) -S618.7 & # x000b1 10.2
NC (+7) -S713.2 & # x000b1 0.6NC (+7) -S79.0 & # x000b1 0.6

شكر وتقدير

نشكر Takeshi Shimizu على الاقتراحات والتوليف الكيميائي Tomomi Sekine و Akiko Okano و Motoko Uchida على الدعم الفني Tamio Saito و Hiroyuki Hirano لتوفير مركبات Siro Simizu لبناء مكتبة GLORIA Toshihiko Nogawa و Shunji Takahashi و Nobumoto Watanabe للحصول على اقتراحات. تم دعم هذا العمل من قبل برنامج RIKEN SPDR (إلى T.K.) و JSPS KAKENHI وبرنامج ترويج أبحاث العلوم والتكنولوجيا للزراعة والغابات ومصايد الأسماك وصناعة الأغذية.


شاهد الفيديو: pH PUFERA nakon mesanja slabih baza i jakih kis pH i ro (شهر نوفمبر 2022).