معلومة

هل من الممكن إزالة خيط واحد من DNA مزدوج الشريطة في الجسم الحي؟

هل من الممكن إزالة خيط واحد من DNA مزدوج الشريطة في الجسم الحي؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لنفترض أن لدينا تسلسل DNA مزدوج تقطعت به السبل في الخلايا البشرية ، على سبيل المثال

... ATCGATATCGATTGCAGAGCATAGCTATAA ... TAGCTATAGCTATAAGCTCTCGTATCGATATT ...

الآن أريد أن أشق خصلة واحدة ، هكذا لدي

... ATC ... TAA ... TAGCTATAGCTATAAGCTCTCGTATCGATATT ...

المسافة ليست مهمة جدًا بالنسبة لي ، لذلك يمكن أن تكون 20 نقطة أساس أقوم بإزالتها أو 1000 ثانية. وبالتالي ، إذا كنت بحاجة إلى بعض PAM أو نحو ذلك ولم يكن قريبًا من موقع الحذف المستهدف ، فسأنتقل ببساطة في 5 'على التوالي. 3 'حتى أجدها وألتصق بها ، طالما تم التأكد من أن الموقع المستهدف قد تقطعت به السبل بعد ذلك.

سأكون ممتنًا جدًا لأنك تمكنت من مساعدتي هنا!


تستخدم كل من تقنيات تحرير الجينات TALEN و ZFN زوجًا من نوكليازات أحادية السلسلة تؤدي في النهاية إلى كسر حبلا مزدوج. ومع ذلك ، فإن Cas9 في تقنية CRISPR-Cas يقطع كل من خيوط الحمض النووي (هناك بعض إنزيمات Cas في بعض الأنواع البكتيرية التي تقطع فقط خيطًا واحدًا [المرجع]).


الصورة مجاملة: http://www.xenbase.org/other/static/CRISPr.jsp

لذا ، إذا كنت تستخدم وحدة واحدة من الزوج ، يمكنك قطع خيط واحد من الحمض النووي. يمكنك استخدام نوكلياز آخر لنقل قطع في موقع آخر في نفس الخيط. هذا لن يؤدي إلى إزالة تسلسل الحمض النووي بين موقعي القطع. لا توجد تقنية متاحة يمكنها القيام بذلك في الجسم الحي. من المحتمل (تخمين جامح) ، يمكنك استخدام قليل النوكليوتيد المعدل (أو حتى الحمض النووي الريبي المركب IVT) الذي يمكنه الارتباط بهذا الامتداد من التسلسل وكسر تفاعله مع خيط الحمض النووي الآخر. على أي حال ، فإن امتداد ssDNA لن يكون مستقرًا ويمكن إصلاحه بسرعة بواسطة البوليميراز.


New & ldquoPrime Editing وطريقة rdquo تعمل فقط على قطع الحمض النووي المفرد الذي تقطعت به السبل

إيما ياسينسكي
21 أكتوبر 2019

تقنية جديدة لتحرير الجينات تسمى التحرير الأولي ، تم اختبارها في خلايا بشرية وفأرية ، تعيد كتابة الحمض النووي عن طريق قطع خيط واحد فقط لإضافة أزواج قاعدية أو إزالتها أو استبدالها. قد تسمح هذه الطريقة للباحثين بتعديل أنواع من الطفرات الجينية أكثر من أساليب تحرير الجينوم الحالية مثل CRISPR-Cas9 ، حسبما أفاد الباحثون اليوم (21 أكتوبر) في طبيعة سجية.

إيما هابانييمي ، قائدة مجموعة في مركز الطب الجزيئي بالنرويج تدرس تعديل الجينات لعلاج الأمراض النادرة ولم تكن جزءًا من العمل لتطوير التحرير الأولي ، كما تقول العالم أن النهج "مبتكر وجديد" ، على الرغم من أن التقنية بالطبع "لا تزال نموذجًا أوليًا" وستحتاج إلى تحسين.

أدى اكتشاف إمكانية تسخير تقنية CRISPR-Cas9 واستخدامها لتعديل الجينات البشرية والحيوانية إلى دخول حقبة جديدة من الأبحاث الجينية على مدار السنوات العديدة الماضية. أصبحت هذه التقنية أداة لا غنى عنها في العديد من المعامل البحثية ، مما يتيح للعلماء إنشاء نماذج حيوانية للأمراض الوراثية بسهولة أكبر. بينما كان CRISPR-Cas9 يشق طريقه نحو العيادة ، فإن استخدامه العملي في علاج الأمراض البشرية كان مقيدًا بالاعتبارات الأخلاقية ، وتحديات التسليم ، والدقة - على وجه الخصوص ، ما يسمى بالتأثيرات غير المستهدفة التي تغير الحمض النووي في المواقع غير المقصودة في الجينوم.

من المعروف أن نظام تحرير الجينات CRISPR-Cas9 ينتج قطعًا إضافية في أقسام خاطئة من الحمض النووي ، والتي يمكن أن تعطل وظيفة الخلية. يعد تحرير القاعدة نوعًا آخر من تحرير الجينات لا يعتمد على فواصل الحمض النووي وكان يُعتقد أنه يقلل من عدم الدقة ، حيث يمكن للإنزيم استبدال نوكلياز DNA بآخر ، ولكن هذه الإستراتيجية تقدم خيارات محدودة حيث يمكنها فقط إنشاء أربعة من أصل 12. تغييرات محتملة في زوج القاعدة ، وقد أشارت بعض الأعمال الحديثة إلى أنها ليست دقيقة كما اعتقد العلماء في البداية.

عندما انضم باحث ما بعد الدكتوراة والمؤلف الرئيسي للدراسة ، أندرو أنزالون ، إلى مختبر ديفيد ليو في معهد برود ، الذي طور سابقًا تقنية تحرير القواعد ، كان متحمسًا بشكل خاص لإمكانية تحرير الجينات دون استخدام فواصل الحمض النووي.

بناءً على ما عرفه الاثنان عن تحرير القاعدة و CRISPR-Cas9 ، بدأوا العمل على تقنية جديدة لقطع خيط واحد فقط من الحمض النووي ، وترك الآخر سليمًا. يستخدم نفس نوكلياز Cas9 الذي يتم نشره بشكل متكرر في نظام كريسبر ولكنه يجمع الإنزيم مع كواشفين جديدين: دليل RNA يسمى pegRNA ، والذي يقود Cas9 إلى النقطة المرغوبة في الجينوم ، ونسخة عكسية تبدأ في إضافة مادة جديدة. تسلسل أو قاعدة في الجينوم. بمجرد دمج المادة الجينية الجديدة في الشريط المقطوع من الحمض النووي ، يقوم المحرر الرئيسي بقطع الخيط غير المحرر ، مشيرًا إلى الخلية لإعادة بنائها لتتناسب مع الخيط المحرر.

اختبر الفريق التحرير الأولي في المختبر في أربعة أنواع مختلفة من الخلايا العصبية للخلايا البشرية والفأر.

قال ليو في مؤتمر صحفي: "ما لاحظناه كان رائعًا جدًا". من أجل مقارنة دقتها مع CRISPR-Cas9 ، استخدم الفريق تقنيتها لتحرير أربع طفرات جينية. أظهرت الدراسات السابقة أنه عندما استهدفت تقنية CRISPR-Cas9 هذه الطفرات نفسها ، فقد تسببت في حدوث تغييرات في الحمض النووي خارج الهدف في 16 موقعًا يمكن التنبؤ به. قام التحرير الأولي بتغيير ثلاثة فقط من هذه المواقع ، مما يشير إلى أنه أكثر دقة من CRISPR-Cas9.

يعد التحرير الأولي أكثر تعقيدًا من تحرير كريسبر. يتطلب ثلاث خطوات منفصلة يجب أن يتطابق فيها الحمض النووي مع أجزاء من نظام التحرير الأساسي. يقول ليو إنه يعتقد أن هذا قد يكون سر دقته. تعتمد تقنية CRISPR-Cas9 على خطوة إقران واحدة: يجب أن يقترن دليل RNA بالحمض النووي المستهدف. يتطلب التحرير الأولي هذه الخطوة الأولى ، ولكنه يشتمل أيضًا على مكونين آخرين ، يجب أيضًا ربط جزء من دليل RNA يسمى التمهيدي بالموقع المستهدف ويجب أن يرتبط الحمض النووي الذي تم إدخاله حديثًا بالموقع الأصلي. يقول ليو: "إذا فشل أي من أحداث اقتران الحمض النووي الثلاثة ، فلا يمكن مواصلة التحرير الأولي". ويضيف: "نعتقد أن أحداث الاقتران الثلاثة المستقلة هذه توفر فرصة لرفض التسلسلات غير المستهدفة".

يقول نيكولاس كاتسانيس ، الذي يدرس الطب الوراثي في ​​مستشفى الأطفال في شيكاغو ، إنه "لا يمكن إنكار وجود بعض التأثيرات غير المستهدفة [باستخدام تقنية CRISPR-Cas9] ولكن الخوف من التأثيرات غير المستهدفة أكثر من الواقع." ومع ذلك ، فهو متحمس للأداة الجديدة و "مغرم" ببعض جوانب التكنولوجيا الجديدة ، مثل قدرتها المحتملة على تحرير مجموعة متنوعة من الأهداف أكثر مما تستطيع طرق تحرير الجينات الأخرى.

استخدم ليو وفريقه التعديل الأولي لاستهداف الجينات الكامنة وراء مرض تاي ساكس وفقر الدم المنجلي. تم تغيير الطفرات مرة أخرى إلى تسلسل الحمض النووي الصحي بكفاءة تتراوح بين 35 و 55 في المائة ، مماثلة للمعدلات التي من المحتمل أن تتحقق مع تحرير CRISPR-Cas9.

قام معهد Broad Institute بترخيص هذه التقنية لشركة Prime Medicine ، وهي شركة شارك في تأسيسها Liu ، بموجب نموذج "الابتكار الشامل" للمعهد ، والذي يسمح لـ Prime باستخدام التكنولوجيا حصريًا لتحقيق أهداف معينة ، ولكنه يوفر للشركات الأخرى الفرصة للتقدم بطلب للحصول على ترخيص لتحرير الجينات الأخرى. قامت مجموعة Liu أيضًا بإتاحة التقنية في قاعدة بيانات Addgene للاستخدام الأكاديمي. يقول ليو: "آمل أن يحاول مئات إن لم يكن الآلاف من الباحثين استخدام التحرير الأولي في الأسابيع والأشهر والسنوات القادمة". "من المهم حقًا أن يختبر المجتمع التحرير الأولي ، وإذا لزم الأمر ، يعمل على تحسين التحرير الأولي في أكبر عدد ممكن من أنواع الخلايا والكائنات الحية."

A. Anzalone et al. ، "البحث عن تحرير الجينوم واستبداله بدون فواصل مزدوجة أو DNA مانح ،" طبيعة سجية، دوى: 10.1038 / s41586-019-1711-4 ، 2019.

إيما ياسينسكي مراسلة مستقلة مقيمة في فلوريدا. تابعها على تويتر يارب احفظها.


مقدمة

تنشئ ترانسفيرازات ميثيل الحمض النووي أنماط مثيلة في الخلايا وتنقل هذه الأنماط عبر أجيال الخلية ، وبالتالي تؤثر على حالات التخلق اللاجينية لكل خلية. (انظر [1] للحصول على نظرة عامة حول ميثيل ترانسفيرازات ، والمواد التكميلية لـ [2] للحصول على مقدمة لميثيل الحمض النووي التي تستهدف غير البيولوجيين.) تم تحديد ثلاثة ناقلات ميثيل الحمض النووي الأولية في الثدييات: DNMT1 ، DNMT3A و DNMT3B [3] ، [4]. في حين أن DNMT3s هي المسؤولة في الغالب عن إنشاء أنماط مثيلة أثناء التطور المبكر وبالتالي فهي معروفة باسم de novo methyltransferases ، فإن DNMT1 هي المسؤولة في الغالب عن الحفاظ على أنماط المثيلة الموجودة على انقسامات الخلايا الجسدية ، وبالتالي فهي معروفة باسم صيانة ميثيل ترانسفيراز [1] .

يتمثل أحد المكونات المركزية للنموذج المقبول على نطاق واسع لصيانة مثيلة الحمض النووي في حقيقيات النوى في الإجراءات التصنيعية لميثيل ترانسفيراز DNMT1 في ثنائيات CpG ثنائية الميثيل بعد فترة وجيزة من تكرار الحمض النووي (الشكل 1 [1]). يعتمد هذا النموذج على خاصيتين لـ DNMT1: خصوصية الركيزة (أي العمل بطرق مختلفة أو بمعدلات مختلفة على أنواع مختلفة من الركيزة) والتجهيزية (أي الارتباط بالتتابع في مواقع متعددة على طول الحمض النووي). هذه هي الخصائص الرئيسية لـ DNA methyltransferases والعديد من الإنزيمات المرتبطة بالحمض النووي الأخرى [1] ، [5] ، وقد تم فحص كلتا الخواص على نطاق واسع في المختبر.

خيوط الابنة المصنعة حديثًا (الأحمر ، في الغالب ، والأخضر الشاحب) تكون في البداية غير ميثلة. بعد تكرار الحمض النووي ، يرتبط DNMT1 (الأرجواني) بصبغات CpG ثنائية الميثيل ، ربما بمساعدة مركب بروتين النسخ (الأصفر) ، والذي يتضمن بروتينات PCNA و UHRF1 [1]. يُقترح DNMT1 للتحرك بشكل عملي على طول الجزيء من نهاية 5 & # x02032 إلى 3 & # x02032 نهاية حبلا الابنة. لاحظ أن صبغ CpG الموجود في أقصى اليسار في الأعلى هو ثنائي الميثيل ، لأن DNMT1 لم يصل إليه بعد. الميثيل بواسطة DNMT1 ليس مثاليًا (على سبيل المثال ، يظل CpG باللون الأخضر الباهت غير ميثيل) ، لأن DNMT1 إما يفشل في إضافة مجموعات الميثيل (يُشار إليها بالحرف M) إلى ثنائيات CpG المرتبطة بها ، أو غير مرتبطة بالحمض النووي في تلك المواقع.

فيما يتعلق بخصوصية الركيزة ، تُظهر التجارب في المختبر أن DNMT1 يضيف بشكل تفضيلي مجموعات الميثيل إلى السيتوزينات في CpGs ابنة حبلا التي تقترن مع CpGs ميثيل ، بدلاً من غير الميثيل ، حبلا الوالدين (على سبيل المثال ، ثنائيات CpG ثنائية الميثيل) ، وبالتالي الحفاظ على مثيلة في مواقع CpG هذه على أجيال الخلية [6]. تم توقع مثل هذا التفضيل لثنائيات CpG ثنائية الميثيل للصيانة methyltranferases في وقت مبكر من عام 1968 [7] ، ويتم قياسه الآن بشكل شائع من حيث & # x0201chemi- نسبة التفضيل & # x0201d. تمثل هذه النسبة المعدلات النسبية التي بها ثنائيات إنزيم ميثيلات نصف ميثيل وغير ميثيل CpG. تختلف التقديرات التي تم الإبلاغ عنها لـ DNMT1 في البشر والفئران ، بشكل عام من التجارب المخبرية ، بشكل كبير من 2 إلى 200 ضعف ، اعتمادًا على سياق تسلسل الحمض النووي والظروف التجريبية وإعداد الإنزيم [6].

فيما يتعلق بالعملية ، تشير التجارب في المختبر إلى أن الفأر DNMT1 يعمل بطريقة معالجة ، ويرتبط بالحمض النووي ثم يظل نشطًا على امتداد نطاق من النيوكليوتيدات المتتالية [1] ، [6]. تم العثور على كل من أخصائيو تقويم العظام لدى الإنسان والفأر من DNMT1 مرتبطين بآلية تكرار الحمض النووي ، والتي تتضمن بروتينات PCNA و UHRF1 [8] ، [9]. وبالتالي ، فإن DNMT1s مهيأة لميثيل السيتوزينات بعد فترة وجيزة من دمجها في خيط DNA الابنة الوليدة. ومع ذلك ، تشير التجارب إلى أن كلاً من أخصائيي تقويم العظام والفئران يمكنهم أيضًا تعديل ثنائيات نصف ميثيل في الحمض النووي الاصطناعي في غياب آلية النسخ المتماثل [10] & # x02013 [14]. تشير هذه النتيجة إلى أن تفاعل أخصائي تقويم العظام البشري والفأر مع آلية النسخ المتماثل قد لا يكون ضروريًا لأنشطة الإنزيم.

يعتبر De novo methyltranferases DNMT3A و 3 B [4] مهمين أيضًا في الحفاظ على الحالات اللاجينية المناسبة في الخلايا الجسدية للإنسان والفأر [15]. يمكن أن يؤدي عدم وجود ناقلات الميثيل هذه إلى أنماط ظاهرية غير طبيعية [16] ، [17]. لقد حققت التجارب في المختبر أيضًا في خصوصية الركيزة وعملية هذه الإنزيمات. فيما يتعلق بخصوصية الركيزة ، على عكس DNMT1 ، لا يُظهر DNMT3A ولا 3B تفضيلًا لإضافة مجموعات الميثيل إلى ثنائيات CpG ثنائية الميثيل على أزواج غير ميثيل [4] ، [18]. تعد الدراسات الخاصة بإمكانية المعالجة المحتملة لـ DNMT3 أقل شمولاً من الدراسات الخاصة بـ DNMT1. أظهرت التجارب في المختبر سلوكًا غير معالج للماوس DNMT3A ولكن سلوكًا عالي التجهيز للماوس DNMT3B [19] ، وسلوكًا تصاعديًا لـ DNMT3A البشري [20].

على الرغم من توافر معطيات هامة في المختبر ، لا تزال هناك أسئلة مهمة يجب معالجتها فيما يتعلق بالخصائص في الجسم الحي لـ DNA methyltransferases. هنا ، نتحرى في تفضيلات الركيزة في الجسم الحي ومستويات المعالجة لـ DNMT1 و DNMT3s البشريين عن طريق تحليل أنماط مثيلة الحمض النووي مزدوجة الشريطة التي تم إنشاؤها في الجسم الحي ، والتي تم قياسها باستخدام PCR ثنائي كبريتات دبوس الشعر [21] ، [22]. أسفرت التحليلات السابقة لبعض هذه الأنماط المزدوجة التي تقطعت بهم السبل [2] ، [23] عن تقديرات لمعدلات CpG الخاصة بالموقع لمثيلة الصيانة ومثيلة الأم وابنتها. ومع ذلك ، فإن هذه التحليلات السابقة تهدف إلى تحديد نتيجة عملية المثيلة ، دون النظر إلى الإنزيمات المغمورة. هنا ، قمنا بتطوير نموذج ماركوف المخفي الجديد (HMM) لحساب خصائص DNMTs المسؤولة عن عملية المثيلة. يتضمن HMM الخاص بنا المعلمات التي تلتقط خصوصية الركيزة والتجهيزية لكل إنزيم ، وبالتالي يسمح باستنتاج هذه المعلمات من البيانات المرصودة. بالإضافة إلى هذه التحليلات في الجسم الحي ، نطبق أيضًا HMM (المعدل المناسب) لإعادة تحليل العديد من مجموعات البيانات المنشورة في المختبر ، والمقارنة مع نتائجنا في الجسم الحي.

تتمثل إحدى السمات المهمة لتحليلاتنا في أنها تستند إلى نموذج إحصائي ، والذي يحدد العملية كاحتمال ، مما يسمح بإجراء اختبار إحصائي لمعرفة ما إذا كانت العملية موجودة أم لا ، والذي يقيم عدم اليقين الإحصائي في تقدير هذا الاحتمال ، وبالتالي يسهل مقارنة ما تم استنتاجه. مستويات المعالجة بين مجموعات البيانات. يفسر HMM أيضًا بشكل صريح أخطاء القياس المحتملة في البيانات المرصودة ، حيث لم يتم حساب هذه الأخطاء بشكل عام في دراسات أخرى في الجسم الحي وفي المختبر. بالإضافة إلى ذلك ، يمكن أيضًا استخدام HMM هذا لاستنتاج مجموعة الأنشطة الأنزيمية التي أدت على الأرجح إلى ظهور كل نمط مثيلة مرصود ، وللاستنتاج ، احتماليًا ، أي الخيط في كل نمط مثيلة مزدوج تقطعت به السبل هو الشريط الأصل ، والذي هو حبلا الابنة (هذه المعلومات غير قابلة للقياس بشكل مباشر في تجربة دبوس كبريتيت الشعر) ، مما يسمح بالتحقيق في السلوك المحدد لهذه الإنزيمات (الشكل 2).

يحتوي كل نمط على زوج من خيوط الوالدين والبنت التي هي خصلة الوالدين والتي هي خصلة الابنة غير معروفة بشكل مباشر. تستنتج HMM الخاصة بنا احتمالية تعيينات حبلا لكل نمط. تظهر هذه الاحتمالات اللاحقة باللون الأخضر للمهمة المشار إليها للوالدين والابنة (يشار إليها بالحرفين P و D باللون الأخضر). هذه الأنماط من FMR1 تحتوي البيانات على مجموعات طويلة من ثنائيات CpG ثنائية الميثيل مع وجود مجموعات الميثيل الخاصة بها على نفس الشريط. التفسيران الأكثر ترجيحًا بين الجميع يتم عرض التفسيرات المحتملة لكل نمط. تشير الرموز إلى الحالات والأنشطة المحتملة لأنشطة نقل الميثيل. لا يتم استخدام جميع الرموز هنا. يظهر تأثير هذه الأنماط الأربعة على تقدير المعلمة بشكل إضافي في الشكل التكميلي 13 في المواد S1.


نتائج

نموذج ماركوف المخفي (HMM) للعملية وخصائص أخرى لـ DNMTs

قمنا بنمذجة أنماط المثيلة المزدوجة التي تقطعت بها السبل على أنها نشأت من عملية كانت فيها ناقلات الميثيل (DNMT1 و DNMT3s) إما مرتبطة أو غير مرتبطة بالحمض النووي في موقع CpG. نقوم بنمذجة حالات الارتباط / عدم الارتباط هذه كعملية ماركوف على طول الحمض النووي. نموذج البيانات المرصودة بناءً على هذه الحالات غير المرصودة ("المخفية") هو نموذج ماركوف المخفي (HMM [24]). بالنسبة للبيانات في الجسم الحي ، لا يمكننا استبعاد أن إنزيمات أخرى (ربما غير محددة) من DNMT1 و DNMT3 قد تكون قد ساهمت أيضًا في أنماط المثيلة المرصودة. للسماح بذلك ، يمكن تفسير إشاراتنا إلى DNMT1 على نطاق واسع على أنها تشير إلى الإنزيمات التي تكون أنشطتها في المقام الأول مثيلة الصيانة ، ويمكن تفسير الإشارات إلى DNMT3s على نطاق واسع على أنها إنزيمات تكون أنشطتها أساسًا مثيلة de novo.

بشكل أكثر تحديدًا ، يمكن أن تتحلل عملية ماركوف المخفية في HMM إلى ثلاث عمليات ماركوف مستقلة: أول ارتباط يمثل DNMT1 ، والذي نفترض أنه يعمل فقط على حبلا الابنة [10] ، والثاني يمثل ارتباط DNMT3s على حبلا الوالدين ، والثالث يمثل رابطة DNMT3s على حبلا الابنة. نستخدم الرموز ، ونشير إلى كل من هذه العمليات. نحن نميز كل عملية ماركوف من خلال احتمالين انتقاليين: احتمالية إعادة الاقتران لكل bp ، أن الجزيئات غير المرتبطة من ميثيل ترانسفيراز تصبح مرتبطة بالحمض النووي أكثر من 1 نقطة أساس ، واحتمال الفصل لكل بي بي ، أن الجزيئات المرتبطة بنقل الميثيل تصبح منفصلة عن الحمض النووي. 1 زوج. يمكن بعد ذلك كتابة مصفوفة احتمالية الانتقال التي تزيد عن 1 نقطة أساس لكل عملية ماركوف كما في المعادلة. (1). (1) تكون مصفوفة احتمالية الانتقال بين موقعين من مواقع CpG bp متباعدتين.

في ظل هذه المعلمة ، يسهم حدثان في احتمال بقاء ميثيل ترانسفيراز مرتبطًا في موقعين متتاليين على بعد 1 نقطة أساس (أي المدخل الأيمن السفلي في): (1) المعالجة ، حيث يبقى ناقل الميثيل مرتبطًا من الموقع 1 إلى الموقع 2 دون أي وقت مضى الانفصال عن الحمض النووي. يحدث هذا مع الاحتمالية و (2) أحداث إعادة الارتباط والتفكك ، حيث يتم ربط ميثيل ترانسفيراز في الموقع 1 ، ثم "يسقط" ، ولكن يتم إعادة ربطه بالحمض النووي في الموقع 2. وهذا يحدث مع الاحتمال. نحدد قوة العملية ، التي تتوافق مع الحدث (1) ، من خلال احتمال الفصل: تتوافق القيمة مع "عدم التجهيزية" ، حيث ينفصل ناقل الميثيل عن الحمض النووي في كل زوج أساسي وتكون حالة الارتباط مستقلة في كل موقع (أي. الصفان من متطابقين) قيم تتوافق مع السلوك التجهيزي ، وكلما كانت القيمة أصغر ، كلما كانت العملية أقوى. تُترجم هذه المعلمة إلى الطول المتوقع لكل مسار ارتباط من bp ، وهو مقياس أكثر تقليدية للعملية ويقيس الكمي مباشرةً من حيث طول المسالك. نظرًا لأنه يتعلق فقط بجزيئات الإنزيم المرتبطة بالفعل ، فإن متوسط ​​طول مسارات الترابط هذا يستبعد أحداث التفكك وإعادة الارتباط المتعددة في مواقع CpG المتتالية ، والتي يمكن الخلط بينها وبين العملية. وبالمثل ، فإن الطول المتوقع للمسارات غير المرتبطة ، وهي فجوات بين مسارات الارتباط ، يعني bp. على عكس ، يمكن أن يكون الدافع وراء احتمال إعادة الارتباط أساسًا عن طريق تركيزات جزيئات ميثيل ترانسفيراز غير المرتبطة في النواة.

تحدد المعلمات معًا متوسط ​​التردد الذي يرتبط به ميثيل ترانسفيراز مع الحمض النووي في كل موقع من مواقع CpG. باستخدام للدلالة على هذا التردد ، لدينا (2)

بالإضافة إلى هذه المعلمات المتعلقة بالعملية ، يحتوي نموذجنا أيضًا على معلمات لأنشطة المثيلة الخاصة بنقل الميثيل عندما تكون مرتبطة بالحمض النووي ، ومعلمات لأخطاء القياس التي يمكن أن تنتج عن تحويل ثنائي كبريتيت (انظر المواد والطرق للحصول على التفاصيل). تصف هذه المعلمات معًا ، "احتمالات الانبعاث" لـ HMM ، كيف تؤدي حالات الارتباط أو عدم الارتباط الخاصة بنقل الميثيل إلى حالات مثيلة ملحوظة على أزواج السلاسل الأم والابنة ، والتي تخضع لأخطاء القياس (انظر المواد والطرق للحصول على التفاصيل) . نحن نسمح لـ methyltransferases بميثيل ابنتها CpGs في مواقع ميثيل نصفي مرتبطة باحتمالية لـ DNMT1 (أو لـ DNMT3s) وفي المواقع غير الميثيل المرتبطة باحتمالية DNMT1 (أو لـ DNMT3s). وتسمى النسب "نسب تفضيل نصفي" لـ DNMT1 و DNMT3 ، على التوالي. بالنسبة للحبل الأصلي ، فإننا نفترض أبسط افتراض أن DNMT3s تضيف دائمًا مجموعة ميثيل إلى CpG المرتبطة.

النموذج أعلاه عام للغاية ، مما يسمح بمجموعة معقدة من سلوكيات ميثيل ترانسفيراز. في التطبيقات ، قد يكون من المفيد تقييد هذا النموذج بطرق مختلفة ، إما للتعامل مع البيانات التي تم جمعها من ظروف تجريبية معينة ، أو لجعل المعلمات أكثر تحديدًا. على سبيل المثال ، ينتج عن فرض القيد نموذجًا أكثر شحًا حيث تقوم DNMT3 دائمًا بميثيل CpG المرتبط بها. هذا هو النموذج الذي نستخدمه لمعظم التحليلات المقدمة هنا. ومع ذلك ، لمحاولة تقدير نسبة تفضيل نصفي لـ DNMT3s ، فإننا نفرض قيدًا مختلفًا وعلى النموذج العام. يعكس هذا القيد الإعداد حيث يكون DNMT1 هو إنزيم الصيانة الأساسي ، ويساعد على التمييز بين عملية DNMT1 وعملية الابنة لـ DNMT3s ، والتي كان من الممكن تمييزها بطريقة أخرى (انظر المواد والطرق للحصول على التفاصيل). لتحليل البيانات في المختبر على DNMT1 في إطار نفس النموذج ، فإننا نقدر المعلمات المرتبطة فقط بعملية DNMT1 ، ونصلح احتمالات إعادة الاقتران وتكون 0 واحتمالات الفصل ، ولكي تكون 1 ، تعكس هذه القيود الإعداد في المختبر حيث DNMT3s غائبون.

نلائم HMM مع البيانات الموجودة في إطار عمل الاستدلال Bayesian [25] ، باستخدام سلسلة Markov Monte Carlo (MCMC) لإنتاج عينات من التوزيع الخلفي المشترك لجميع المعلمات في النموذج بالنظر إلى البيانات (انظر المواد S1 للحصول على التفاصيل ، بما في ذلك المواصفات التوزيعات السابقة ذات الصلة). في صميم تنفيذنا ، توجد خوارزمية الكلمات الخلفية القياسية في كل تكرار MCMC لحساب الاحتمال المشترك للمعلمات المعطاة لأنماط المثيلة المرصودة. التعقيد الحسابي للخوارزمية الأمامية والخلفية لجميع الأنماط عبر مواقع CpG في كل تكرار MCMC هو ، حيث 8 () هو عدد الحالات المخفية في كل موقع ، مع 2 يمثلان الحالتين (المرتبطين وغير المرتبطين) لكل عملية ماركوف . نلخص التوزيعات الخلفية للمعلمات من الاستدلال البايزي بالمتوسط ​​الخلفي وفترات 80٪ الموثوقة (80٪ CIs 10- و 90-٪) تم استخدام فترات 80٪ ، بدلاً من فترات 95٪ التقليدية ، لتقليل التأثير من ذيول ثقيلة لبعض التوزيعات. يراعي إجراء الاستدلال عدم اليقين في البيانات المتعلقة بالأنشطة الأنزيمية التي أنتجت كل نمط مزدوج الشريطة مرصود باستخدام خوارزمية برمجة ديناميكية لتلخيص كل الاحتمالات ، مع ترجيح كل احتمال من خلال احتماله (الشكل 2 انظر أيضًا المواد S1).


الانتماءات

قسم علم الأحياء ، ETH زيورخ ، زيورخ ، سويسرا

تشارلز دي يه & جاكوب إي كورن

قسم البيولوجيا الجزيئية والخلوية والنمائية ، جامعة كاليفورنيا ، سانتا باربرا ، سانتا باربرا ، كاليفورنيا ، الولايات المتحدة الأمريكية

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

المؤلف المراسل


اختيار البلازميدات المؤتلفة

عند إنشاء البلازميدات المؤتلفة وتحويل البكتيريا معها ، قد ينتهي بنا المطاف بالبكتيريا مع كل من النسخة الأصلية المؤتلفة من البلازميد. ومع ذلك ، قد نرغب في اختيار البلازميد المؤتلف فقط. في بعض الحالات ، يكون هذا أمرًا طبيعيًا ، ويمكننا القيام بذلك بمجرد اختيار الخاصية التي يعطينا إياها البلازميد المؤتلف.

ومع ذلك ، سنحتاج في كثير من الأحيان إلى استخدام تقنيات أكثر تقدمًا لاختيار البلازميد المؤتلف. من أجل القيام بذلك ، يمكننا إضافة جين ثانٍ مهم ، والذي يمكننا استخدامه بعد ذلك لاختيار البلازميد الخاص بنا. على سبيل المثال ، يمكننا إضافة جين لمقاومة محددة للمضادات الحيوية بعد ذلك ، يمكننا زراعة البكتيريا المحولة على هذا المضاد الحيوي. ستموت البكتيريا التي تحتوي على البلازميد الأصلي ، بينما سيتم اختيار الخلايا البكتيرية المحولة (التي تحتوي على هذا الجين الإضافي).

يمكننا أيضًا القيام بأشياء مماثلة مع الجينات الأخرى. على سبيل المثال ، يمكننا إدخال جين الفلورسنت مثل GFP. بمجرد أن تنمو المستعمرات ، يمكننا فحصها بصريًا واختيار المستعمرات التي تظهر التألق الذي نريده. بهذه الطريقة ، يمكننا فقط اختيار المستعمرات التي تحتوي على البلازميد الخاص بنا.


عدم تطابق الحمض النووي

عدم تطابق الحمض النووي غير الصحيح الذي قد يحدث إعادة التركيب أثناء الإدخال وعدم تطابق نظام التعرف الخاطئ مع الحمض النووي ، وتكرار الحمض النووي ، والإدخال ، ويصحح إصلاح شكل معين من تلف الحمض النووي.

إصلاح عدم التطابق هو طريقة خاصة بالخيوط. أثناء تخليق الحمض النووي ، عادةً ما يتم تضمين الخيوط التي تم تصنيعها حديثًا. للقيام بآلة إصلاح عدم التطابق هذه ، فهي مجهزة بسلسلة تم تصنيعها من النموذج (الأصل). أنا أميز (وليس الابنة والميثلة للوالد) عابرة hemimethylation ، حبلا في البكتيريا سالبة الجرام. في حقيقيات النوى وبدائيات النوى الأخرى ، الآلية الدقيقة غير واضحة. هذا ، في حقيقيات النوى ، (قبل أن يتم ختمه بواسطة DNA ligase) قد يتضمن Nick مؤقتًا إشارة تشير إلى وجود نظام تصحيح عدم تطابق في كل سلسلة يشتبه في أن الخيط المتأخر يتم تصنيعه من DNA. هاك هذه يعني أن الدليل الموجود في السلسلة العليا لابد أنه تم اكتشافه مؤخرًا. في دراسة حديثة ، فإن الاسم المستعار الخاص بالاتجاه ، والموقع ، مثل الشكل الدائري لملامس البروتين الطرفي 3 & # 8242-OH Nick ، ​​هو أنه على جانب واحد ، تم عرض الحمل المعتمد على RFC للنسخ المتماثل لـ PCNA. يوجه PCNA الموجه عمل نوكلياز MutLalpha من خيط واحد في وجود MutSbeta أو MutSalpha وغير متوافق.

إن انتهاك البنية الحلزونية الفائقة للحمض النووي ، كل حدث طفرة ، يحمل القدرة الجينية لتهديد استقرار الخلية. إن نظام إصلاح الحقيقة واكتشاف الضرر هو أنه من المعقد تكرار تطور الآلة ، مما يسلط الضوء على الأهمية التي تعلق على الحمض النووي بأمانة. أمثلة على القواعد غير المتطابقة ، وما شابه ذلك (انظر إصلاح الحمض النووي) أو الاقتران G / T in / C. يرجع التناقض إلى التماسك في تركيب القواعد في كثير من الأحيان. يتم التلف عن طريق ضبط الشريط غير القالب والقالب ، للتعرف على التشوه الناجم عن عدم التطابق ، لتشغيله عن طريق الخطأ ، واستبداله بالنيوكليوتيدات الصحيحة. عملية الإزالة ، والتي تشمل قاعدة غير متطابقة أكثر بكثير من مجرد. من الممكن إزالة الآلاف إلى عدة أزواج من خيوط الحمض النووي التي تم تصنيعها حديثًا.

إصلاح عدم تطابق الحمض النووي (MMR) هي عملية يتم الحفاظ عليها تطوريًا لتصحيح عدم التطابق الناتج أثناء تحرير الهروب وتكرار الحمض النووي. مزيد من بروتينات MMR ، من الممكن أن يكون لها تأثيرات بيولوجية واسعة قد تعطل MMR ضارة أو مفيدة ، للمشاركة في الحمض النووي للعديد من العمليات الأخرى. وصفنا بإيجاز تأثير الضعف والعديد من سمات بروتين MMR ، لبدء هذه المراجعة. بعد ذلك ، سأركز على الآلية البيوكيميائية لأخطاء النسخ المتماثل MMR. في الدراسات الوظيفية & # 8211 بنية البروتين MMR كيفية التعرف على عملية الصراع لتحديد اتجاه جديد لخفض خطأ المفتاح المكرر.

من خلال تصحيح التناقضات التي تم إنشاؤها أثناء تكرار الحمض النووي ، إصلاح عدم تطابق الحمض النووي (MMR) ، مما يوفر دقة النسخ المتماثل. كيف تحدث في الجسم الحي ، يتم إعادة تكوين MMR في المختبر ولكن MMR البشري غير واضح. هنا ، نظهر أن علامة هيستون H3K36me3 epigenetic ، لتجنيد التعرف على عدم تطابق البروتين hMutSα (من-hMSH6 hMSH2) ، ومطلوب في الكروماتين الحي عبر تفاعل مباشر مع مجال hMSH6 PWWP ذلك. يتم ضمان وفرة S H3K36me3 قبل إدخال أزواج كروماتين hMutSα الخاطئة بين تكرار الحمض النووي المخصب مبكرًا و G1. في الخلايا التي تفتقر إلى H3K36 ثلاثي ميثيل ترانسفيراز SETD2 يعرض عدم استقرار الأقمار الصناعية الصغيرة (MSI) ، قمت بزيادة وتيرة الطفرة التلقائية المميزة للخلايا التي تعاني من نقص MMR و. يوضح هذا العمل أن وصف الخلايا السرطانية الإيجابية لـ MSI هيستون لضبط MMR في الخلايا البشرية ، ليس لديها طفرة يمكن اكتشافها في الجين المعروف بـ MMR ، وهو لغز لسنوات عديدة.

تمت دراسة الإشريكية القولونية في نظام MMR الموجه بالميثيل على نطاق واسع ، وأعيد تكوين المسار بأكمله باستخدام البروتين النقي في المختبر في Modri ​​ch. يبدأ MMR في بدائيات النوى عندما يتعرف عليه MutS في MMR ، أو البروتينات التي هي انحرافات محفوظة بشكل كبير. من خلال تنشيط البروتينات ، يتم حفظ بروتينات MMR والثاني من MutS ، Mutl ، الثالث ، انشقاق نوكلياز داخلي لـ Muth ، وتعمل بالتنسيق لترخيص مسار إصلاح الاستئصال. سأوجه أنشطتها إلى طعنة سلسلة غير ميثيلية عند النسخ المتماثل بعد موقع hemi CATC العابر قريبًا Azimut. MMR في E. coli ، تأكد من أنك تشير إلى خيط DNA الذي تم تصنيعه حديثًا والذي يحتوي على الخطأ هو ثقب Azimut بقيادة الميثيل. ساعدت دراسة المختبر على إنشاء اتصال ثنائي الاتجاه مع عملية القطع MMR. بمعنى آخر ، يمكن استخدام ألقاب MMR على جانبي الفجوة. يمكنني أن أعمل كبوابة لتوليد هليكاز II و Mutl ، وهي عملية يتم تسهيلها من خلال سلسلة ناشئة ببروتين ربط أحادي السلسلة هي هذه المشاركة الناشئة. RecJ ExoI أو ExoVII أو ExoX: يتم وضع هذا في اتجاه أحد عملية الهضم مع نوكلياز خارجي رباعي الجديلة به قطبي 5 & # 8242-3 & # 8216or 3 & # 8242-5 & # 8217. الحمض النووي ، سيعمل على إصلاح الاختلاف في التفاعل الذي يتضمن استعادة الليغاز و Pol III ، حيث إنه ضعف النمط الوراثي للوالد.


الخصائص

خصوصية تجاه الحمض النووي المزدوج تقطعت بهم السبل
تم اختبار خصوصية الحمض النووي تجاه أليغنوكليوتيدات الحمض النووي الريبوزي مزدوج أو أحادي الجديلة.

تم قياس خصوصية dsDNase تجاه الركيزة باستخدام أليغنوكليوتيدات 15 مير مع FAM عند 5 & Prime و DarkQuencher & reg 3 & prime (Eurogentec). يتناسب التألق مع نشاط الإنزيم.

شروط الفحص: 25 مم تريس درجة الحموضة 7.5 ، 5 ملي MgCl2، و 2 & أليغنوكليوتيد ميكرومتر.

الأنشطة النسبية
المادة المتفاعلة النشاط النسبي
dsDNA 100%
ssDNA & اللفتنانت 0.03٪
دسرنا & lt 0.01٪
سرنا & lt 0.01٪

من البيانات أعلاه يمكننا أن نستنتج أن dsDNase خاص بشريط مزدوج.

DsDNase

تعطيل الحرارة
يمكن تعطيل حرارة dsDNase بالمعالجة الحرارية عند 15 دقيقة عند 65 درجة مئوية ، أو 20 دقيقة عند 60 درجة مئوية. يتطلب الإنزيم 1 ملي مولار من DTT و pH & ge 8 لإبطال النشاط الكامل.

تحديد

  • تعريف الوحدة
    تُعرَّف الوحدة الواحدة على أنها زيادة في الامتصاص عند 260 نانومتر من 0.001 في الدقيقة ، باستخدام 50 ميكروغرام / مل من الحمض النووي MW في 100 ملي مولار من أسيتات الصوديوم pH 5.0 و 5 ملي مولار MgCl2.
  • نشاط معين
    كاليفورنيا. 400000 وحدة كونيتز / مجم.
  • نشاط
    إن dsDNase نشط للغاية في نطاق درجة حرارة 20-40 درجة مئوية. يحتاج إلى 2.5 ملي ميغاغرام على الأقل للنشاط ولديه درجة حموضة مثالية عند 7.5.
  • المخزن المؤقت للتخزين
    20 مم Tris-HCl الأس الهيدروجيني 7.5 ، 2 ملي MgCl2 ، 10 ملي كلوريد الصوديوم ، 0.01٪ (حجم / حجم) Triton X-100 ، 50٪ (حجم / حجم) جلسرين.
  • نقاء
    يتم تنقية dsDNase إلى التجانس الظاهري.
  • متطلبات العينة
    تنقية الأحماض النووية قبل علاج dsDNase.
  • تخزين
    الحد الأدنى لعمر التخزين هو 3 سنوات عند درجة حرارة -20 درجة مئوية. يمكن التخزين في 4 درجة مئوية لمدة 6 أشهر على الأقل. يتحمل الإنزيم أيضًا دورات متعددة من ذوبان التجميد.

HL-dsDNase

تعطيل الحرارة
يمكن تعطيل HL-dsDNase بالحرارة عن طريق المعالجة الحرارية عند 5 دقائق عند 58 درجة مئوية. يتطلب الإنزيم 1 ملي مولار من DTT و pH & ge 8 لإبطال النشاط الكامل.

تحديد

  • تعريف الوحدة
    تُعرَّف وحدة واحدة على أنها زيادة في الامتصاص عند 260 نانومتر من 0.001 في الدقيقة ، باستخدام 50 ميكروغرام / مل من الحمض النووي عالي MW في 100 ملي مولار أسيتات الصوديوم pH 5.0 و 5 ملي MgCl2.
  • نشاط معين
    كاليفورنيا. 200 000 Kunitz Units/mg.
  • نشاط
    The HL-dsDNase is highly active in a temperature range of 20-40°C. It needs at least 2.5 mM Mg for activity and has an optimal pH at 7.5.
  • Storage buffer
    20 mM Tris-HCl pH 7.5, 2 mM MgCl2, 10 mM NaCl, 0.01% (v/v) Triton X-100, 50% (v/v) glycerol.
  • نقاء
    HL-dsDNase is purified to apparent homogeneity.
  • Sample requirement
    Purification of nucleic acids prior HL-dsDNase treatment.
  • تخزين
    Minimum shelf life is 2 years at -20°C. The enzyme also tolerates multiple freeze-thaw cycles.

Types of DNA polymerase.

Basically, the types of DNA polymerase are also divided depending on the organism that possess themi.e. eukaryotic and prokaryotic DNA polymerases. These types of DNA polymerase are classified based on their characteristics including structural sequences, and functions.

Prokaryotic DNA Polymerases

Prokaryotes contain five different types of DNA polymerase. هذه موضحة أدناه.

بوليميريز الحمض النووي أنا

Polymerase I is a DNA repair enzyme from the family A polymerases that has a 5’ to 3’ and 3’ to 5’ activity. Pol I account for more than 95% of polymerase activity in E. coli, although cells that lack this polymerase have been found and its activity can be replaced by the other four types of polymerase. This DNA polymerase has a poor processivity rate, adding around 15 to 20 nucleotides per second. Pol I begin the process of DNA elongation at a point called the “origin of replication” and about 400 base pairs downstream of this point, Pol III takes over replication, which it performs at a much higher speed.

بوليميريز DNA II

Polymerase II is a DNA repair enzyme with a 3’ to 5’ exonuclease activity. Pol II is a family B polymerase and provides support to Pol III. When DNA acquires damage in the form of short gaps, which block Pol III activity, Pol II helps to remedy this problem by restarting DNA synthesis downstream of these gaps.

DNA Polymerase III

This holoenzyme is the main polymerase in E.coli DNA replication and is one of the family C polymerases. Polymerase III is made up of the clamp-loading complex, the beta sliding clamp processivity factor and the Pol III core. The core comprises three subunits – the α subunit which is the polymerase activity hub, the δ subunit which is the exonucleolytic proofreader, and the θ subunit which may stabilize δ. The core and the beta sliding clamp are present in duplicate, to allow for processing of both the leading and lagging DNA strands.

DNA Polymerase IV

This enzyme belongs to the Y family of DNA polymerases. Pol IV is an error-prone polymerase that has no 3’ to 5’ proofreading activity and is involved in mutagenesis or the altering of DNA to give rise to a mutation. The enzyme is expressed by a gene (dinB) that is switched on when polymerases stall at the replication fork. This interferes with the processivity of Pol III which acts as a checkpoint, stopping replication and allowing time for DNA to be repaired. Cells that lack dinB are at an increased risk of developing mutations caused by agents that damage DNA.

DNA Polymerase V

It belongs to Family Y, with high regulatory activity. It is produced only when DNA is damaged and it requires translesion synthesis. It also lacks exonuclease functions and hence it can’t proofread the synthesis of DNA replicas making it less efficient.

Eukaryotic DNA Polymerase

DNA Polymerase γ

Polymerase γ is a Type A polymerase, whose main function is to replicate and repair mitochondrial DNA.

It also functions by proofreading 3′ to 5′ exonuclease activity. Mutations on Poly γ significantly affect the mitochondrial DNA causing autosomal mitochondrial disorders.

DNA Polymerase α, δ, and ε

These are the type B Polymerase enzymes and they are the main polymerases applied in DNA replication.

Pol α works by binding to the primase enzyme, forming a complex, where they both play a role in initiating replication. Primase enzyme creates and places a short RNA primer which allows Pol α to start the replication process.

Pol δ starts the synthesis of the lagging strand from Pol α, while Pol ε is believed to synthesize the leading strand during replication. Studies indicate that Pol δ replicates both the lagging and leading strand. Pol δ and ε also have a 3′ to 5′ exonuclease activity.

DNA Polymerase β, μ, and λ

These are type 3 or Family X of polymerase enzymes. Pol β has a short-patch base excision repair mechanism where it repairs alkylated or oxidized bases.

Pol λ and Pol μ are important for rejoining DNA double-strand breaks due to hydrogen peroxide and ionizing radiation, respectively.

DNA Polymerases η, ι, and κ

They are type 4 or family Y polymerases majorly used in repairing of DNA by a mechanism known as translesion synthesis.

They are prone to errors during DNA synthesis. Pol η functions by accurately ensuring the translesion synthesis of DNA damages that is caused by ultraviolet radiation.

Pol κ is still understudies but one of its known functions is to extend or insert specific bases at certain DNA lesions. Translesion synthesis polymerases are activated by stalled replicative DNA polymerase.

Terminal deoxynucleotidyl transferase (TdT)

TdT functions by catalyzing the polymerization of deoxynucleoside triphosphate to the 3′-hydroxyl group of a preformed polynucleotide chain. TdT is a non-template directed DNA polymerase. It was first detected in the thymus gland.


Is it possible to remove one strand of double stranded DNA in vivo? - مادة الاحياء

The usefulness of DNA extends beyond carrying the hereditary material for living organisms. In the 1980s, researchers began to manipulate genetic strands&mdashwhich are composed of four nucleobases (A, C, T, G) that form base pair bonds&mdashto fold DNA (and, later, RNA) into predetermined structures. This includes scaffold-based DNA origami and DNA bricks. Such prototypes could eventually lead to nanoscale devices with real-world applications such as nanofabrication of molecular robots that deliver drugs upon contact with a target molecule molecular instruments that precisely position molecules or trigger interactions and molecular breadboards that organize hundreds of molecular components into specific arrangements with nanometer precision.

Until recently, DNA- and RNA-based structures have largely been limited to those built from multiple strands rather than single strands. To create such structures, researchers first synthesize a single-stranded DNA molecule called the scaffold and then add hundreds or thousands of individually synthesized shorter components. These bind to multiple locations on the scaffold, tying the molecule together and inducing folding. This complex assembly process makes the structures vulnerable to defects or missing strands, however, and necessitates time-consuming checks to ensure all pieces are correctly in place.

Now, as reported in a recent issue of علم, researchers have bypassed those limitations by creating stable, self-folding single-strand DNA and RNA origami that is both simpler and less prone to defects than earlier multi-strand products. “This is really a new way of making complex nanostructures with user prescribed geometries,” says Peng Yin, a professor of Systems Biology at Harvard Medical School and the Wyss Institute at Harvard University, and a co-author on the work. “We demonstrated that uni-molecular folding of a single strand without other components can be a general platform to produce complex structures.”

The concept of one long DNA or RNA strand whose sequence dictates its own folding first emerged in 2014, when researchers created A-form helices&mdashone of the three biologically active double helical structures that DNA and RNA can adopt&mdashfrom single-stranded RNA. The molecular design process was fairly complex, however, and sizes were limited to just 660 nucleotides.

Yin and his colleagues expanded on that earlier work by first identifying molecular structures that would allow their single-stranded structure to self-assemble in a precise order, preventing tangles and knots from forming. A web-based automated software they created based on those findings provides researchers with a general platform for producing complex structures from a single long strand.

“This is a very important paper, because it is one of the few that addresses the folding of nucleic acid strands while being aware not merely of energetics, but the topology itself, so as to avoid knotting,” says Ned Seeman, the Margaret and Herman Sokol Professor of Chemistry at New York University, a pioneer in the field of structural DNA nanotechnology, who was not involved in the research. “The algorithm is a major advance.”

Unlike multi-stranded DNA and RNA origami that require في المختبر synthesis, the researchers verified in the laboratory that the single-strand folded into user-defined structures في المختبر can be replicated in vivo by introducing the DNA sequences into bacteria, including بكتريا قولونية. Producing molecules in this way would lower costs and chances of mistakes, the research team believes, as nanostructures could be cloned at high volume by replicating bacteria. Polymerase chain reaction amplification&mdasha common technique used to amplify copies of a segment of DNA&mdashwas also demonstrated to reproduce the molecules.

In this first proof-of-concept study, the researchers were able to program protruding DNA loops that acted as handles for adding protein functional groups onto self-assembling large and single-strand DNA origami molecules of up to 10,000 nucleotides. They also created single-strand RNA nanostructures of up to 6,000 nucleotides&mdash10 times the size and complexity of what was previously possible.

Erik Winfree, a professor of computer science, computation, and neural systems, and of bioengineering, at the California Institute of Technology, who was not involved in the work, describes it as “an incredibly elegant design approach for making single-stranded DNA and RNA origami, solving the problem of intrinsic ‘knotting’ of the strands that plagued previous thinking and coming up with a straightforward method for molecular design.”

Yin and his colleagues imagine that future work will include creating single-stranded DNA and RNA nanostructures that could be filled with or attached to enzymes, fluorescent probes, metal particles, or pharmaceuticals, paving the way for a diversity of potential applications, from single-molecule tracking and drug delivery devices to components for nano-electronics.

As Yin says, “Essentially, once you have the ability to precisely control the structure and shape of a nanoscale particle and that particle can be added to other functional elements, there are endless possibilities.”


المواد والأساليب

Assay for RNA-primed DNA synthesis on a circular, single-stranded DNA template

gp59 was examined for its ability to stimulate the de novo synthesis of DNA on a single-stranded, circular M13 DNA template in the presence of seven core T4 replication proteins and the T4 strand-exchange protein UvsX. In these assays the synthesis of RNA pentameric primers by the gp61 DNA primase (the 61-protein component of the primosome) is completely dependent on the presence of the gp41 DNA helicase (the 41-protein component of the primosome). All reaction mixtures were prepared on ice and contained assay buffer (66 mM potassium acetate, 33 mM Tris acetate, pH 7.8, 10 mM magnesium acetate, and 0.5 mM dithiothreitol), 100 µg/ml (or 50 µg/ml where indicated) HSA, ribo- and deoxyribonucleoside triphosphates (1 mM ATP, 1 mM GTP, and 0.2 mM each of CTP and UTP 0.4 mM each of dATP and dGTP, 0.2 mM dCTP, and 0.2 mM [3H]dTTP at a specific activity of 1560 Ci/mol), M13 DNA template (3.3 µg/ml or 9.8 µM), an ATP regenerating system (10 mM creatine phosphate and 10 µg/ml creatine phosphate kinase, required to compensate for the high level of ATPase activity associated with UvsX protein), and T4 replication proteins (2.5 µg/ml gp43, 30 µg/ml gp44/gp62 protein complex, and 10 µg/ml gp45—constituting the DNA polymerase holoenzyme 1 µg/ml gp61 and 21 µg/ml gp41—constituting the primosome). Present only when indicated were 62 µg/ml gp32, 100 µg/ml UvsX protein, and 0.6 µg/ml gp59. The assays were carried out at 37°C. Aliquots were taken at various times, synthesis was stopped by the addition of Na3EDTA, pH 9.0, to a final concentration of 25 mM on ice, and the [3H]dTTP label incorporated into acid-insoluble DNA products was then determined (Formosa and Alberts, 1986). Results are expressed as nmol of total deoxyribonucleotide incorporated into DNA per ml of assay mixture.

Assay for recombination-dependent DNA synthesis

To examine the ability of gp59 to allow primosome function and Okazaki fragment synthesis (lagging strand synthesis) in a replication system initiated by genetic recombination, reaction mixtures were prepared on ice containing assay buffer (33 mM Tris acetate, pH 7.8, 66 mM potassium acetate, 10 mM magnesium acetate, and 0.5 mM dithiothreitol), 50 µg/ml HSA, ribo- and deoxyribonucleoside triphosphates (2 mM each of ATP and GTP, 0.2 mM each of CTP and UTP, 0.4 mM each of dGTP and dATP, 0.2 mM dCTP, and 0.15 mM [α- 32 P]dTTP [at the specific activity given in the figure legends]), and the ATP regenerating system described previously. To reduce synthesis from nicks present in a minor fraction of template molecules, all reactions contained 2 units/ml T4 DNA ligase as well as 0.25 mM spermine and 0.15 mM spermidine. The following proteins were present in all reactions: 2.5 µg/ml gp43, 30 µg/ml gp44/gp62 protein complex, 10 µg/ml gp45, and 68 µg/ml gp32. The following proteins were present when indicated: 21 µg/ml gp41, 1 µg/ml gp61, 1 µg/ml gp59, 2 µg/ml dda protein, 21 µg/ml UvsX protein, 5 µg/ml UvsY protein, and 2 µg/ml of T4 type II DNA topoisomerase (gp39/gp52/gp60 complex Liu وآخرون., 1979). The T4 UvsY protein nucleates UvsX protein assembly on single-stranded DNA, thus allowing a fivefold lower concentration of UvsX protein to be used (Morrical and Alberts, 1990).

When present, the double-stranded template was 20 µM (nucleotides) of the 7250 base pair M13MP19 DNA (1.38 nM as supercoiled circles or the BglII linearized form as indicated see below). The single-stranded DNA primer was 2 µM (nucleotides) of the 1623 nucleotide, linear fragment (1.23 nM as fragments) cut from M13 single-stranded DNA circles with HaeIII (see below). All components except for the DNA primer, the four deoxyribonucleoside triphosphates, the CTP and UTP, and 75% of the GTP and ATP were preincubated for 4 min at 37°C. Finally, the DNA primer and all of the missing nucleotides were added to start DNA synthesis. Portions of the reaction mixture were subsequently taken at various times and brought to 25 mM Na3EDTA (using a pH 9.0 stock on ice) to stop DNA synthesis. The incorporation of the labeled dTTP into acid-insoluble DNA product is expressed as nmol (nucleotide)/ml reaction. DNA products were also analyzed for size and shape as described below.

DNA product analysis by agarose gel electrophoresis

In all cases, equal volumes of reaction mixture were compared on these gels. The analysis of DNA products by agarose gel electrophoresis under alkaline denaturing conditions (30 mM NaOH) is described in Barry and Alberts (1994). For the analysis of DNA products by neutral gel electrophoresis, samples were first made 0.4% in SDS and heated for 5 min at 65°C to denature DNA binding proteins. Samples were then adjusted to 10% sucrose, 0.03% bromophenol blue, and an additional 20 mM Na3EDTA (pH 8) and loaded onto horizontal 0.8% agarose gels formed in neutral gel running buffer (50 mM Tris-Cl, pH 7.9, 40 mM sodium acetate, and 1 mM Na3EDTA). The gels were run nonsubmerged at 20 V for 40 h, with the running buffer at both anode and cathode changed every 8–10 h. Upon completion, the gels were stained with ethidium bromide and the UV illuminated bands photographed to record the relative positions of standards—including forms I and II of plasmid M13MP19 DNA, the 40 kbp T7 DNA, and the linear double-stranded BstEII and هينdIII restriction fragments of bacteriophage lambda DNA. The gels are then acidified, dried, and autoradiographed as in Barry and Alberts (1994).

DNA product analysis by electron microscopy

Recombination-dependent DNA synthesis reactions were carried out as described above with HSA present at 50 µg/ml. Aliquots from reactions stopped with EDTA (see above) were diluted 20-fold to create a solution containing 0.5–1.0 µg/ml DNA, 40% formamide by volume, and 0.1 mg/ml cytochrome ج and were spread onto double-distilled water. The resulting cytochrome ج–DNA-mixed film was picked up on grids covered with films prepared from 0.5% Formvar (Koller and Delius, 1984). The DNA-containing grids were stained by dipping them for 30 s in a 0.1 mg/ml uranyl acetate solution in 90% ethanol and, after drying, shadowed with platinum. DNA molecules were photographed with a Phillips EM 300 electron microscope using a 50-IA objective aperture and 60 kV accelerating voltage. A reasonably long stretch of a DNA molecule can usually be classified with confidence as either single- or double-stranded, inasmuch as the threadlike double-stranded DNA appears more rigid, smoother, and wider than the single-stranded DNA. However, due to this method's limited resolution, the position where the structure transitions from double- to single-stranded cannot be precisely determined.

DNase I nicking of the DNA products to remove superhelical tension

After 7 min of synthesis, the reaction was stopped with EDTA as described previously. The products of the minus-topoisomerase reaction (reaction 2, in Figure 6) were heated to 65°C for 10 min to denature the T4 replication and recombination proteins, and the DNA was separated from nucleotides and denatured protein on a BioSpin 30 column (BioRad), according to manufacturer's instructions. The DNA was recovered from this column in 40 mM Tris-Cl, pH 7.4, 10 mM MgCl2, 20 µg/ml HSA. Bovine pancreatic DNase I (20 ng/ml) was added for a 5-min incubation at 37°C. The reaction was stopped with excess Na3EDTA and the nicked DNA was prepared for electron microscopy as described above (see Supplemental Figure S4).

Reagents and enzymes

All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed. Nucleoside triphosphates were obtained from Pharmacia, creatine phosphate, creatine phosphate kinase, and DNase I were from Sigma, and human serum albumin (HSA) was from Worthington Biochemical Corporation. Radiolabeled compounds were obtained from Amersham. Other chemicals and biochemicals were obtained from Sigma unless specified otherwise. The T4 DNA topoisomerase was a generous gift from Ken Kreuzer (Duke University). The T4 bacteriophage UvsX and UvsY proteins were purified from overproducing strains as described in Morrical and Alberts (1990). The purified protein products of the cloned T4 genes 44/62 and 45 were prepared according to Morris وآخرون. (1979) and the products of cloned T4 genes 32, 41, 43, 59 and 61 were purified as described in Barry and Alberts (1994).

All protein stocks used were free of contaminating nucleases, as judged by sensitive testing (Bittner وآخرون., 1979). Nuclease testing of UvsX protein and gp32 was done at concentrations that left ∼40% of the single-stranded DNA protein-free (see Figure 1 legend for stoichiometries). Protein concentrations were determined by Bradford assay, using bovine serum albumin (BSA) as the standard. The gp32 concentration was determined by absorption using A280 = 1.07/mg/ml. For the enzyme assays described below, small amounts of each protein were diluted using assay buffer (see below) supplemented with 100 µg/ml human serum albumin (HSA).

Nucleic acids

Circular single-stranded DNA from bacteriophage M13 was isolated as described for bacteriophage fd DNA in Burke وآخرون. (1985). The 1623 nucleotide linear (HaeIII) fragment of M13 single-stranded DNA was prepared and labeled with 32 P at the 5′-end using the alkaline phosphatase/T4 polynucleotide kinase method (Morrical and Alberts, 1990). Supercoiled (form I) DNA from bacteriophage M13MP19 was isolated as described in Morrical and Alberts (1990). M13MP19 DNA was linearized by restriction endonuclease cutting at the unique BglII site.


شاهد الفيديو: الحمض النووى - التركيب و الخصائص - DNA structure (ديسمبر 2022).