معلومة

12.2: تعديلات على طرفي 5 'و 3' من mRNA - علم الأحياء

12.2: تعديلات على طرفي 5 'و 3' من mRNA - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

كما تمت مناقشته سابقًا ، يتم توج جزيئات الرنا المرسال حقيقية النواة عند نهاية 5 بوصات وعديد الأدينيلات عند نهايتها 3. تم تطوير فحوصات مخبرية لهذه التفاعلات ، وتم تحديد العديد من الأنشطة الأنزيمية. سيتم مراجعة هذه في هذا القسم. لا يقتصر عديد الأدينيل على حقيقيات النوى. العديد من الرنا المرسال في الإشريكية القولونية هي أيضا عديد الأدينيلات. هذا مجال دراسة جديد إلى حد ما.

التعديل في الطرف الخامس: هيكل الغطاء

"الغطاء" عبارة عن مركب ميثيل 5 'GMP مرتبط من خلال 5' فوسفات إلى b ‑ فوسفوريل من النوكليوتيدات البادئة (عادةً A) ؛ انظر الشكل 3.3.6. يحدث السد بعد وقت قصير من بدء النسخ. يحدث في سلسلة من الخطوات الأنزيمية (الشكل 3.3.7):

  1. قم بإزالة g ‑ phosphoryl من النوكليوتيدات البادئة (RNA triphosphatase)
  2. اربط GMP بـ b phosphoryl للنيوكليوتيدات البادئة (mRNA guanylyl transferase). مشتق GMP من GTP ، ويرتبط بـ 5 'فوسفات بـ 5' ثنائي فوسفات من النوكليوتيدات البادئة. يتم تحرير بيروفوسفات.
  3. إن N ‑ 7 من غطاء GMP ميثيل (ميثيل ترانسفيراز) ، المانح هو S - أدينوسيل ميثيونين.
  4. تحدث الميثيلات اللاحقة على 2 'OH من النيوكليوتيدات الأولين من الرنا المرسال.

وقد ثبت أن السد له دور في كفاءة الترجمة واستقرار الرنا المرسال.

هناك حاجة إلى العديد من البروتينات للانشقاق وعديد الأدينيل في نهاية 3 ':

  1. CPSF هو عامل خصوصية رباعي ؛ يتعرف على إشارة polyadenylation AAUAAA ويرتبط بها.
  2. CFI و CFII عوامل انشقاق.
  3. PAP هو بوليميراز polyA.
  4. تشكل CFI و CFII و PAP معقدًا يرتبط بـ RNA الناشئ في موقع الانقسام ، موجهًا بواسطة عامل خصوصية CPSF.
  5. CstF هو بروتين إضافي متورط في هذه العملية في المختبر ، لكن وظيفته الدقيقة غير معروفة حاليًا.

رف الكتب

NCBI Bookshelf. خدمة للمكتبة الوطنية للطب ، المعاهد الوطنية للصحة.

ألبرتس ب ، جونسون أ ، لويس جيه ، وآخرون. البيولوجيا الجزيئية للخلية. الطبعة الرابعة. نيويورك: جارلاند ساينس 2002.

  • بالاتفاق مع الناشر ، يمكن الوصول إلى هذا الكتاب من خلال ميزة البحث ، ولكن لا يمكن تصفحه.


خطوات النسخ

يتم النسخ في ثلاث خطوات: البدء والاستطالة والإنهاء. الخطوات موضحة في الشكل 2.

الشكل 2. يحدث النسخ في ثلاث خطوات - البدء والاستطالة والإنهاء - جميعها موضحة هنا.

الخطوة 1: البدء

المبادرة هي بداية النسخ. يحدث عندما يرتبط إنزيم بوليميراز الحمض النووي الريبي بمنطقة من الجين تسمى المحفز. يشير هذا إلى تفكك الحمض النووي حتى يتمكن الإنزيم من "قراءة" القواعد في أحد خيوط الحمض النووي. أصبح الإنزيم الآن جاهزًا لصنع خيط من الرنا المرسال مع سلسلة تكميلية من القواعد.

الخطوة الثانية: الاستطالة

استطالة هي إضافة النيوكليوتيدات إلى خيط الرنا المرسال. يقرأ بوليميراز الحمض النووي الريبي خيط الحمض النووي غير الملفوف ويبني جزيء الرنا المرسال باستخدام أزواج القواعد التكميلية. هناك وقت قصير خلال هذه العملية عندما يكون الحمض النووي الريبي المتشكل حديثًا مرتبطًا بالحمض النووي غير الملتحم. خلال هذه العملية ، يرتبط الأدينين (A) في الحمض النووي بـ uracil (U) في الحمض النووي الريبي.

الخطوة 3: الإنهاء

نهاية هي نهاية النسخ ، وتحدث عندما يعبر RNA polymerase تسلسل توقف (إنهاء) في الجين. اكتمل خيط الرنا المرسال ، وينفصل عن الحمض النووي.

يقدم هذا الفيديو مراجعة لهذه الخطوات. يمكنك التوقف عن مشاهدة الفيديو في الساعة 5:35. (بعد هذه النقطة ، يناقش الترجمة ، والتي سنناقشها في النتيجة التالية.)


أسئلة مهمة لـ CBSE Class 12 Biology The DNA and RNA World

1.على مدى السنوات التي تلت مندل ، تم التحقق من طبيعة المادة الجينية ، مما أدى إلى إدراك أن الحمض النووي هو المادة الوراثية في غالبية الكائنات الحية.

2- حمض الديوكسي ريبونوكلييك (DNA) و Ribonucleic acid (RNA) هما نوعان من الأحماض النووية الموجودة في الأنظمة الحية. الأحماض النووية عبارة عن بوليمرات من النيوكليوتيدات.

3يعمل الحمض النووي كمادة جينية في معظم الكائنات الحية ، بينما يعمل الحمض النووي الريبي كمادة وراثية في بعض الفيروسات.

4.يعمل الحمض النووي الريبي في الغالب كرسول. RNA له وظائف أخرى مثل المحول ، الهيكلية أو كجزيء محفز.

5. هيكل سلسلة البولينوكليوتيد
(ط) يتكون النوكليوتيد من ثلاثة أجزاء ، أي قاعدة نيتروجينية ، وسكر بنتوز (ديوكسيريبوز في الحمض النووي الريبوزي والريبوز في الحمض النووي الريبي) ومجموعة فوسفات.
(2) القواعد النيتروجينية هي البيورينات ، أي الأدينين والجوانين والبيريميدين ، أي السيتوزين واليوراسيل والثايمين.
(3) السيتوزين شائع لكل من DNA و RNA و thymine موجود في DNA. اليوراسيل موجود في الحمض النووي الريبي في مكان الثايمين.
(4) ترتبط القاعدة النيتروجينية بسكر البنتوز من خلال ارتباط N-glycosidic لتكوين نوكليوزيد ، أي الأدينوزين والجوانوزين ، إلخ.
(5) عندما ترتبط مجموعة الفوسفات بـ 5 & # 8242 —OH للنيوكليوزيد من خلال ارتباط phosphodiester ، يتم تكوين نيوكليوتيدات مقابلة.
(6) يرتبط اثنان من النيوكليوتيدات من خلال 3 & # 8242 - & gt 5 & # 8242 phosphodiester link to تكوين ثنائي النوكليوتيد.
(7) يمكن ضم العديد من النيوكليوتيدات لتشكيل سلسلة عديد النوكليوتيدات.
(ثامنا) يتكون العمود الفقري في سلسلة عديد النوكليوتيد بسبب السكر والفوسفات.
(9) القواعد النيتروجينية المرتبطة بمشروع جزء السكر من العمود الفقري.
(x) الأزواج الأساسية مكملة لبعضها البعض.

6. في حالة الحمض النووي الريبي، كل بقايا نيوكليوتيد لها مجموعة OH إضافية موجودة في موضعين في الريبوز. أيضا ، تم العثور على اليوراسيل في مكان الثايمين (5-methyl uracil)

7- الاكتشافات المتعلقة ببنية الحمض النووي
(أنا)فريدريش ميشر في عام 1869 ، حدد الحمض النووي لأول مرة على أنه مادة حمضية موجودة في النواة وأطلق عليها اسم "نوكلين".
(ثانيا)جيمس واتسون وفرانسيس كريك، اقترح نموذج حلزون مزدوج بسيط للغاية لهيكل الحمض النووي في عام 1953 بناءً على بيانات حيود الأشعة السينية.
(ثالثا)اروين تشارجاف اقترح أنه بالنسبة للحمض النووي المزدوج الشريطة ، فإن النسب بين الأدينين والثايمين والجوانين والسيتوزين ثابتة وتساوي واحدًا.

8. السمات البارزة لهيكل الحلزون المزدوج للحمض النووي
(ط) DNA عبارة عن بوليمر طويل من deoxyribonucleotides. وهي مكونة من سلسلتين من عديد النوكليوتيدات ، حيث يتكون العمود الفقري من فوسفات السكر ومشروع القواعد بداخله.
(2) السلسلتان لهما قطبية مضادة متوازية ، أي 5 & # 8242 & # 8212- & GT 3 & # 8242 لواحد ، 3 & # 8242 & # 8211 & GT 5 & # 8242 لآخر.
(3) يتم إقران القواعد الموجودة في خيطين من خلال رابطة هيدروجينية (روابط H) لتشكيل أزواج قاعدية (bp). يشكل الأدينين رابطتين هيدروجينيتين مع الثايمين من الخيط المعاكس والعكس صحيح. روابط الجوانين مع السيتوزين بثلاثة روابط H. نتيجة لهذا ، يأتي البيورين دائمًا عكس بيريميدين. هذا يشكل مسافة موحدة بين الخيوط.
(4) يتم لف السلسلتين بطريقة اليد اليمنى. تبلغ درجة اللولب 3.4 نانومتر ويوجد ما يقرب من 10 نقاط أساس في كل منعطف. نتيجة لذلك ، تبلغ المسافة بين زوج القاعدة في اللولب حوالي 0.34 نانومتر.
(ت) تتكدس طائرة أحد الزوجين الأساسيين فوق الآخر في اللولب المزدوج. هذا يضفي الاستقرار على البنية الحلزونية بالإضافة إلى روابط H.

9.يبلغ طول الحلزون المزدوج للحمض النووي حوالي 2.2 متر
لذلك ، فإنه يحتاج إلى خاص التعبئة والتغليف في خلية.
(أنا)في الخلايا بدائية النواة (التي لا تحتوي على نواة محددة) ، مثل الإشريكية القولونية ، والحمض النووي (الذي يحمل شحنة سالبة) يتم الاحتفاظ به مع بعض البروتينات (التي لها شحنة موجبة) في منطقة تسمى نوكليويد. الحمض النووي في نووي يتم تنظيمه في حلقات كبيرة ممسكة بالبروتينات.
(2) في حقيقيات النوى ، هناك مجموعة من البروتينات موجبة الشحنة تسمى هيستونات غنية ببقايا الأحماض الأمينية الأساسية ، اللايسين والأرجينين (كلاهما موجب). يتم لف الحمض النووي سالب الشحنة حول أوكتامر هيستون موجب الشحنة لتشكيل بنية تسمى النوكليوسوم.
(3) يحتوي الجسيم النووي النموذجي على 200 نقطة أساس من لولب الحمض النووي. تشكل النيوكليوسومات الوحدة المتكررة لبنية في النواة تسمى الكروماتين (بنية ملطخة تشبه الخيط). تحت المجهر الإلكتروني ، يمكن رؤية النيوكليوسومات في الكروماتين كخرز على سلسلة. يتم حزم هذا الهيكل في الكروماتين لتشكيل ألياف الكروماتين التي تقوم بمزيد من الملفات وتتكثف لتشكيل الكروموسومات في المرحلة الطورية.
(4) يتطلب تغليف الكروماتين على مستوى أعلى مجموعة إضافية من البروتينات تسمى مجتمعة بروتينات كروموسوم غير هيستون (NHC).
(v) في النواة ، تكون بعض مناطق الكروماتين معبأة بشكل فضفاض (ضوء بقع) تسمى euchromatin (كروماتين نشط نسخًا). في بعض المناطق ، يكون الكروماتين معبأ بكثافة (بقع داكنة) تسمى هيتروكروماتين (كروماتين غير نشط).

10- مبدأ النقل
(ط) أجرى فريدريك جريفيث (1928) سلسلة من التجارب مع Streptococcus pneumoniae (البكتيريا المسببة للالتهاب الرئوي).
(2) وفقا له ، عندما تزرع البكتيريا على صفيحة استنبات ، ينتج بعضها مستعمرات لامعة ناعمة (S) ، بينما ينتج البعض الآخر مستعمرات خشنة (R).
(3) هذا لأن بكتيريا سلالة S لها طبقة مخاطية (عديد السكاريد) ، في حين أن سلالة R ليست كذلك.
(4) تموت الفئران المصابة بالسلالة S (الخبيثة) من الالتهاب الرئوي ولكن الفئران المصابة بالسلالة R لا تصاب بالتهاب رئوي.

(5) قتل جريفيث البكتيريا عن طريق التسخين ولاحظ أن بكتيريا سلالة S المقتولة بالحرارة المحقونة في الفئران لم تقتلها. عند حقن مزيج من بكتيريا S والبكتيريا الحية R المقتولة بالحرارة ، ماتت الفئران. لقد تعافى من البكتيريا الحية من الفئران الميتة.

(6) من هذه التجربة ، خلص إلى أن "بكتيريا سلالة R" قد تحولت بواسطة بكتيريا سلالة S. بعض مبدأ التحويل الذي تم نقله من سلالة S المقتولة بالحرارة ، قد مكّن سلالة R من تصنيع طبقة عديد السكاريد الملساء وتصبح شديدة الضراوة. يجب أن يكون هذا بسبب نقل المادة الوراثية.

11- الطبيعة البيوكيميائية لمبدأ التحويل
(أنا)أوزوالد أفيري وكولين ماكليود وماكلين مكارتي عمل على تحديد الطبيعة البيوكيميائية لمبدأ التحويل في تجربة جريفيث.
(2) قاموا بتنقية المواد الكيميائية الحيوية (البروتينات والحمض النووي الريبي والحمض النووي ، إلخ) من الخلايا S المقتولة بالحرارة واكتشفوا أن الحمض النووي وحده من البكتيريا S تسبب في تحول البكتيريا R.
(3) اكتشفوا أيضًا أن البروتياز (إنزيم هضم البروتين) و RNAases (إنزيمات هضم الحمض النووي الريبي) لا يؤثران على التحول.
(4) لقد منع الهضم باستخدام DNAse التحول ، مما يشير إلى أن الحمض النووي تسبب في التحول.
(5) خلصوا إلى أن الحمض النووي هو المادة الوراثية. لكن ، ما زال جميع علماء الأحياء غير مقتنعين.

12- الحمض النووي هو المادة الوراثية
(أنا)ألفريد هيرشي ومارثا تشيس (1952) قدم دليلاً لا لبس فيه على أن الحمض النووي هو المادة الجينية.
(2) في تجاربهم ، تم استخدام العاثيات (الفيروسات التي تصيب البكتيريا).
(3) قاموا بزراعة بعض الفيروسات على وسط يحتوي على الفوسفور المشع والبعض الآخر على الكبريت المحتوي على وسط مشع
(4) نمت الفيروسات في وجود الفوسفور المشع يتضمن الحمض النووي المشع ولكن ليس البروتين المشع لأن الحمض النووي يحتوي على الفوسفور ولكن البروتين لا يحتوي عليه. بالطريقة نفسها ، احتوت الفيروسات التي تنمو على الكبريت المشع على بروتين مشع ، لكن ليس الحمض النووي المشع لأن الحمض النووي لا يحتوي على الكبريت

(5) تم السماح للعاثيات المشعة بالالتصاق بالبكتيريا القولونية. مع تقدم العدوى ، تمت إزالة المعاطف الفيروسية من البكتيريا عن طريق تحريكها في الخلاط. تم فصل جزيئات الفيروس عن البكتيريا عن طريق تدويرها في جهاز طرد مركزي.
(6) كانت البكتيريا المصابة بالفيروسات التي تحتوي على دنا مشع مشعة ، مما يشير إلى أن الحمض النووي هو المادة التي تنتقل من الفيروس إلى البكتيريا.
(7) البكتيريا المصابة بالفيروسات التي تحتوي على بروتينات مشعة لم تكن مشعة. هذا يشير إلى أن البروتينات لم تدخل البكتيريا من الفيروسات. ثبت أن الحمض النووي مادة وراثية تنتقل من فيروس إلى بكتيريا.

13- خصائص المواد الوراثية
(ط) أصبح من المؤسس أن الحمض النووي هو المادة الجينية من تجربة هيرشي تشيس.
(2) في بعض الفيروسات ، تم الإبلاغ عن الحمض النووي الريبي أيضًا كمواد وراثية ، على سبيل المثال فيروسات فسيفساء التبغ ، جراثيم QB ، إلخ.
(3) خصائص المادة الوراثية

  • (4) يجب أن تكون قادرة على التكرار.
  • (5) يجب أن تكون مستقرة كيميائيا وهيكلية.
  • (6) يجب أن يوفر مجالًا للتغييرات البطيئة (الطفرة) المطلوبة للتطور.
  • (7) يجب أن تكون قادرة على التعبير عن نفسها في شكل "الشخصيات المندلية".

(4) وفقًا للقواعد المذكورة أعلاه ، تتمتع كل من الأحماض النووية (DNA و RNA) بالقدرة على توجيه الازدواجية ، ويمكن تفسير الاستقرار في الحمض النووي لأن الخيطين يكونان متكاملين إذا تم فصلهما عن طريق التسخين معًا في ظروف مناسبة.
(v) المجموعة 2 & # 8242 - OH الموجودة في كل نوكليوتيد في الحمض النووي الريبي هي مجموعة تفاعلية وتجعل الحمض النووي الريبي قابلاً للتحلل وقابلاً للتحلل بسهولة ، وبالتالي فهي تفاعلية.
(6) الحمض النووي أقل تفاعلًا كيميائيًا وأكثر استقرارًا من الناحية الهيكلية مقارنةً بـ RNA. يمنح الثايمين أيضًا ثباتًا إضافيًا للحمض النووي. لذلك ، من بين اثنين من الأحماض النووية ، الحمض النووي هو مادة وراثية سائدة.
(7) كل من الحمض النووي الريبي والحمض النووي قادران على التحور. تتطور الفيروسات التي تحتوي على جينوم الحمض النووي الريبي (RNA) ولها عمر أقصر وتتطور بشكل أسرع.
(8) يعتمد الحمض النووي على الحمض النووي الريبي لتخليق البروتين ، في حين أن الحمض النووي الريبي يمكن أن يرمز له مباشرة. تطورت آلية تصنيع البروتين حول الحمض النووي الريبي. خلص هذا إلى أن الحمض النووي أكثر استقرارًا هو مناسب لتخزين المعلومات الجينية ، بينما يكون RNA مناسبًا لنقل المعلومات الجينية.

14- فرانسيس كريك اقترح العقيدة المركزية في علم الأحياء الجزيئي ، الذي ينص على أن المعلومات الجينية تتدفق منها

في بعض الفيروسات ، يكون تدفق المعلومات في الاتجاه المعاكس ، أي من RNA إلى DNA.

15- التكرار مخطط تكرار الحمض النووي يطلق عليه تكرار الحمض النووي شبه المحافظ تم اقتراحه من قبل واتسون و كريك (1953). وفقا لذلك،
(ط) سينفصل الخصلان ويعملان كقالب لتركيب خيوط تكميلية جديدة. .
(2) بعد النسخ المتماثل ، سيكون لكل جزيء DNA خيط أبوي واحد وحبل مركب حديثًا.

16. يأتي الدليل التجريبي على أن الحمض النووي يتكاثر بشكل شبه متحفظ ، يأتي أولاً من الإشريكية القولونية ولاحقًا من الكائنات الحية الأعلى ، مثل النباتات والخلايا البشرية.
أجرى ماثيو ميسلسون وفرانكلين ستال التجارب التالية لإثبات ذلك في عام 1958.
(1) القولونية نمت في وسط يحتوي على 15 NH4C1 هو مصدر النيتروجين الوحيد لعدة أجيال. تم دمج 15 N في DNA المركب حديثًا (ومركبات أخرى تحتوي على النيتروجين). يمكن تمييز جزيء الحمض النووي الثقيل هذا عن الحمض النووي الطبيعي عن طريق الطرد المركزي في تدرج كثافة كلوريد السيزيوم (CsCl).
(2) ثم قاموا بنقل الخلايا إلى وسط مع 14 NH الطبيعي4C1 وأخذ عينات على فترات محددة مختلفة حيث تكاثرت الخلايا واستخرجت الحمض النووي الذي بقي على شكل حلزونات مزدوجة تقطعت بهم السبل. تم فصل عينات الحمض النووي بشكل مستقل على تدرجات CsCl لقياس كثافة الحمض النووي.
(3) الحمض النووي الذي تم استخراجه من المزرعة ، جيل واحد (بعد 20 دقيقة) بعد النقل من 15 N إلى 14 N كان له كثافة هجينة أو متوسطة. يتكون الحمض النووي المستخرج من الثقافة بعد جيل آخر (بعد 40 دقيقة) من كميات متساوية من هذا الحمض النووي الهجين والحمض النووي الخفيف.
(4) تم إجراء تجارب مماثلة جدًا بواسطة تايلور وزملائه في Vicia faba (حبوب الفاصوليا) باستخدام ثيميدين المشع وتم الحصول على نفس النتائج ، أي نسخ الحمض النووي بشكل شبه متحفظ ، كما في التجارب السابقة.

17- آلية استنساخ الحمض النووي والإنزيمات تتطلب عملية التكرار مجموعة من المحفزات (الإنزيمات).
(ط) الإنزيم الرئيسي هو بوليميراز الحمض النووي المعتمد على الحمض النووي ، لأنه يستخدم قالب DNA لتحفيز بلمرة الديوكسينوكليوتيدات. يبلغ متوسط ​​معدل البلمرة بهذه الإنزيمات حوالي 2000 نقطة أساس في الثانية.
(2) يجب أن تحفز هذه البوليمرات التفاعل بدرجة عالية من الدقة لأن أي خطأ أثناء النسخ المتماثل سيؤدي إلى طفرات.
(3) بلمرة الحمض النووي هي عملية تتطلب الطاقة ، لذا فإن ثلاثي فوسفات الديوكسي ريبونوكليوزيد يخدم أغراضًا مزدوجة ، أي يعمل كركائز ويوفر الطاقة لتفاعل البلمرة.
(4) هناك حاجة أيضًا إلى العديد من الإنزيمات الإضافية بالإضافة إلى بوليميريز الحمض النووي المعتمد على الحمض النووي.
(ت) (أ) تكرار في حبلا الحمض النووي يحدث داخل فتحة صغيرة من حلزون الحمض النووي ، والمعروفة باسم شوكة النسخ المتماثل.
(ب) تحفز بوليميرات الحمض النووي المعتمدة على الحمض النووي البلمرة في اتجاه واحد فقط ، أي 5 & # 8242 - & gt 3. تخلق مضاعفات إضافية عند شوكة النسخ المتماثل. وبالتالي ، على خيط واحد (القالب 3 & # 8242-5 & # 8242) ، يكون النسخ المتماثل مستمرًا ، بينما على الشريط الآخر (القالب 5 & # 8242-3 & # 8242) ، يكون متقطعًا. يتم ضم الأجزاء المركبة بشكل متقطع والتي تسمى شظايا Okazaki لاحقًا بواسطة DNA ligase.

18. أصل النسخ المتماثل
(ط) لا يمكن أن تبدأ بوليمرات الدنا عملية التكرار من تلقاء نفسها. أيضًا ، لا يبدأ النسخ المتماثل عشوائيًا في أي مكان في الحمض النووي. لذلك ، هناك منطقة محددة في DNA coli حيث ينشأ النسخ المتماثل. تسمى المنطقة بأصل النسخ المتماثل.
(2) بسبب هذا المطلب ، فإن قطعة من الحمض النووي ، إذا لزم الأمر ليتم نشرها أثناء إجراءات الحمض النووي المؤتلف ، تتطلب ناقلًا. توفر المتجهات أصل النسخ المتماثل.

19. عالم الحمض النووي الريبي كان الحمض النووي الريبي أول مادة وراثية. هناك أدلة تثبت أن عمليات الحياة الأساسية ، مثل التمثيل الغذائي ، والترجمة ، والربط ، وما إلى ذلك ، قد تطورت حول الحمض النووي الريبي.
(ط) هناك بعض التفاعلات الكيميائية الحيوية المهمة في الأنظمة الحية التي يتم تحفيزها بواسطة محفزات RNA وليس بواسطة إنزيمات البروتين.
(2) تطور الحمض النووي من الحمض النووي الريبي مع تعديلات كيميائية تجعله أكثر استقرارًا لأن الحمض النووي الريبي كونه محفزًا كان تفاعليًا وبالتالي غير مستقر.

20. هناك ثلاثة أنواع من الحمض النووي الريبي (RNAs):
(أنا) مرنا (messenger RNA) يوفر نموذجًا للنسخ.
(ثانيا) الحمض الريبي النووي النقال (نقل الحمض النووي الريبي) يجلب الأحماض الأمينية ويقرأ الشفرة الوراثية.
(ثالثا) الرنا الريباسي (RNA الريبوسوم) يلعب دورًا هيكليًا وحفازًا أثناء الترجمة.
جميع الـ RNAs الثلاثة مطلوبة لتكوين بروتين في الخلية.

21- الكشافة هي عملية نسخ المعلومات الجينية من أحد خيوط i إلى RNA. يحكم مبدأ التكامل عملية النسخ ، باستثناء أن الأدينوزين يشكل الآن زوجًا أساسيًا مع اليوراسيل بدلاً من الثايمين.
(ط) في النسخ ، يتم تكرار جزء فقط من الحمض النووي وفي IV يكون أحد الخيوط. نسخها إلى RNA. لا يتم نسخ كل من الجدائل لأن

  • إذا كان كل من خيوط الكود الخاص بـ RNA ، فسيتم تكوين جزيئين مختلفين من RNA وبروتينين مختلفين ، مما يؤدي إلى تعقيد آلية نقل المعلومات الجينية.
  • نظرًا لأن اثنين من RNA المنتجين سيكونان مكملين لبعضهما البعض ، فإنهما سيشكلان RNA مزدوج الشريطة بدون ترجمة ، مما يجعل عملية النسخ غير مجدية.

(2) يتم تحديد وحدة النسخ في الحمض النووي من خلال ثلاث مناطق في الحمض النووي وهي كما يلي:
(أ) المروج (ب) الجين الهيكلي (ج) فاصل
(3) إن شريطين من الحمض النووي لهما قطبية معاكسة ، كما أن بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي يحفز البلمرة في اتجاه واحد فقط وهو 5 & # 8242 - & GT 3 & # 8242.
(4) يعمل الشريط الذي يحتوي على القطبية 3 & # 8242 - & gt 5 & # 8242 كقالب ويشار إليه باسم حبلا القالب. يتم إزاحة الشريط الآخر الذي يحتوي على قطبية (5 & # 8242 - & gt 3 & # 8242) والتسلسل نفسه مثل RNA (T في مكان U) أثناء النسخ. يسمى هذا الخيط باسم حبلا الترميز.

(5) يحيط المروج والمُنهي الجين الهيكلي في وحدة النسخ.
(6) يقع المروج في نهاية 5 & # 8242 (المنبع) للجين الهيكلي.
(7) هو تسلسل الحمض النووي الذي يوفر موقع ربط لبوليميراز الحمض النووي الريبي ويحدد وجود المروج القالب وسلاسل الترميز. من خلال تبديل موضعه مع المنهي ، يمكن عكس تعريف الترميز وخيوط القالب.
(viii) يقع المنهي في اتجاه 3 f -end (في اتجاه مجرى النهر) من حبلا الترميز وعادة ما يحدد نهاية عملية النسخ.
(9) هناك تسلسلات تنظيمية إضافية قد تكون موجودة بشكل أكبر في المنبع أو في اتجاه التيار إلى المروج.
وحدة النسخ والجين
(ط) يمكن تعريف الجين على أنه الوحدة الوظيفية للوراثة.
(2) الكسترون هو جزء من ترميز الحمض النووي لعديد ببتيد.
(3) الجين الهيكلي في وحدة النسخ يمكن أن يقال على أنه أحادي (معظمه في حقيقيات النوى) أو متعدد الكريات (في الغالب في البكتيريا أو بدائيات النوى).
(4) يتم تعريف متواليات التشفير أو التسلسلات المعبر عنها على أنها exons. تظهر الإكسونات في الحمض النووي الريبي الناضج أو المعالج. تتم مقاطعة exons بواسطة introns.
(5) لا تظهر الإنترونات أو المتواليات المتداخلة في الحمض النووي الريبي الناضج أو المعالج.
(6) في بعض الأحيان ، يتم تعريف التسلسلات التنظيمية بشكل فضفاض على أنها جينات تنظيمية ، حتى
على الرغم من أن هذه التسلسلات لا ترمز لأي RNA أو بروتين.

22- يحدث النسخ في بدائيات النوى بالخطوات التالية:
(ط) واحد بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي يحفز نسخ جميع أنواع الحمض النووي الريبي في البكتيريا.
(2) يرتبط بوليميراز الحمض النووي الريبي بالمحرك ويبدأ النسخ (البدء).
(3) يستخدم نوكليوزيد ثلاثي الفوسفات كركيزة ويتبلمر في قالب يعتمد بطريقة تتبع قاعدة التكامل.
(4) كما أنه يسهل فتح اللولب ويستمر في الاستطالة.
(v) بمجرد وصول البوليميراز إلى منطقة النهاية ، يسقط الحمض النووي الريبي الناشئ ، وكذلك بوليميريز الحمض النووي الريبي. ينتج عن هذا إنهاء النسخ.
(6) إن بوليميراز الحمض النووي الريبي قادر فقط على تحفيز عملية الاستطالة.
يرتبط بشكل عابر بعامل البدء (أ) وعامل الإنهاء (ع) ، لبدء وإنهاء النسخ ، على التوالي. وبالتالي ، تحفيز جميع الخطوات الثلاث.
(7) نظرًا لأن mRNA لا يتطلب أي معالجة لتصبح نشطة وأيضًا نظرًا لحدوث النسخ والترجمة في نفس الحجرة ، يمكن أن تبدأ الترجمة عدة مرات قبل نسخ mRNA بالكامل. نتيجة لذلك ، يمكن أن يقترن النسخ والترجمة في البكتيريا.

23. النسخ في حقيقيات النوى لها تعقيدات إضافية من بدائيات النوى.
(ط) يوجد ما لا يقل عن ثلاثة بوليميرات RNA في النواة بخلاف بوليميراز RNA في العضيات. بوليميراز الحمض النووي الريبي I نسخ الرنا الريباسي (28S ، 18S و 5.8S). RNA polymerase III مسؤول عن نسخ fRNA و 5srRNA و SnRNAs (الحمض النووي الريبي الصغير). RNA polymerase II ينسخ سلائف mRNA ، الحمض النووي الريبي غير المتجانسة (hnRNA).
(2) التعقيد الآخر هو أن النصوص الأولية تحتوي على كل من exons و & # 8216 introns وهي غير وظيفية. وبالتالي ، تخضع لعملية تسمى الربط. في هذه العملية ، تتم إزالة الإنترونات ويتم ضم الإكسونات بترتيب محدد.
(3) يخضع hnRNA لمعالجة إضافية تسمى السد والخلف. في وضع السد ، يضاف نيوكليوتيد غير عادي إلى 5 & # 8242-end of hnRNA. في المخلفات ، تتم إضافة بقايا الأدينيلات (200-300) في نهاية 3 & # 8217 في قالب. إنه hnRNA المعالج بالكامل ، والذي يسمى الآن mRNA ، والذي يتم نقله خارج النواة لعملية الترجمة

أهمية هذه التعقيدات هي:
(ط) تمثل ترتيبات الجينات المنقسمة سمة قديمة للجينوم.
(2) وجود الإنترونات يذكرنا بالعصور القديمة.
(3) تمثل عملية الربط هيمنة عالم الحمض النووي الريبي.

أسئلة امتحانات السنة السابقة

1 ضع علامة على الأسئلة

1- ماذا سيحدث إذا كان تكرار الحمض النووي ساخنًا متبوعًا بانقسام الخلية في خلية حقيقية النواة؟ [All India 2014 c]
الجوابإذا لم يتم اتباع انقسام الخلايا بعد تكرار الحمض النووي ، فلن يتم توزيع الكروموسومات المضاعفة (DNA) على نوى الابنة. ينتج عن تكرار تكرار الحمض النووي دون أي انقسام خلوي تراكم الحمض النووي داخل الخلية.
سيؤدي ذلك إلى زيادة حجم نواة الخلية ، مما يؤدي إلى توسع الخلية ،

2- قم بتسمية المكونات المحددة والارتباط بينها التي تشكل الديوكسيادينوسين. [دلهي 2013 ج]
الجوابالأدينين (N- glycosidic Linkage) + Deoxyribose - & gt Deoxyadenosine.

3. أي واحد من عامل rho وعامل سيجما يعمل كعامل بدء أثناء النسخ في بدائيات النوى؟ [دلهي 2013 ج]
الجوابيعمل عامل سيجما كعامل بدء أثناء النسخ في بدائيات النوى

4- قم بتسمية الإنزيم المتضمن في النسخ المتماثل المستمر لشريط الحمض النووي. اذكر قطبية حبلا القالب. [كل الهند 2012]
الجوابالإنزيم المتورط في النسخ المتماثل المستمر لشريط الحمض النووي هو بوليميراز الحمض النووي. يحتوي قالب حبلا على 3 & # 8242- & GT5 & # 8242 قطبية

5- قم بتسمية البروتين موجب الشحنة الذي يلتف حوله الحمض النووي سالب الشحنة.[جميع الهند 2012 C]
الجواب.الهيستونات هي بروتينات موجبة الشحنة يلتف حولها الحمض النووي سالب الشحنة.

6- يحتوي الجين الهيكلي على شريطين من الحمض النووي X و Y كما هو موضح أدناه. تحديد حبلا القالب.
[HOTS All India 2010 C]

الجواب& # 8217X & # 8217 قالب ستراند. ذلك لأن حبلا القالب له قطبية في اتجاه 3 & # 8242 - & GT 5 & # 8242.

7- لماذا يلزم hnRNA للخضوع لعملية الربط؟ [HOTS دلهي 2009]
الجواب.hnRNA مطلوب للخضوع لعملية الربط بسبب الإنترونات (التسلسلات غير المشفرة). يجب إزالتها ويجب ضم الإكسونات (تسلسلات التشفير) في تسلسل محدد.

8- اذكر العمليتين الإضافيتين اللتين تحتاج hnRNA للخضوع لهما بعد التضفير حتى تصبح وظيفية. [دلهي 2009]
الجوابالعمليات الإضافية التي يحتاجها bnRNA للخضوع بعد التضفير هي السد والخلف.

9. متى وفي أي نهاية يحدث تفتيت hnRNA؟ [All India 2009]
الجوابعندما تتم معالجة hnRNA لصنع mRNA ، تتم عملية التكسير في الطرف 3 & # 8242.

10- في أي غايات تحدث التغطية والتخلف للـ hnRNA على التوالي؟ [الخارجية 2009]
الجوابالسد & # 8211 في 5 & # 8242-نهاية المخلفات-في 3 & # 8242-نهاية

11. كيف يتم حساب طول الحمض النووي عادة؟ [كل الهند 2009 C]
الجوابيمكن حساب طول الحمض النووي ببساطة عن طريق ضرب العدد الإجمالي للزوج الأساسي مع المسافة بين نقطتين متتاليتين ،
أي 6.6x 10 9 bpx 0.34x 10 _9 m / bp.
يأتي حوالي 2.2 م. (0.34 × 10 _9 م هي المسافة بين زوجي قاعدتين متتاليتين)

12- قم بتسمية الجزأين A و B من unvit النسخ الموضح أدناه.

الجواب.A- المروج ، 8-حبلا الترميز.

13- قم بتسمية المكونين A و B في النيوكليوتيدات باستخدام البيورين ، كما هو موضح أدناه.

الجواب.A & # 8211 الفوسفات ب- أي قاعدة نيتروجينية (مثل الأدينين ، الجوانين ، السيتوزين أو الثايمين).

14- قم بتسمية نوع التوليف A و B الذي يحدث في شوكة النسخ المتماثل للحمض النووي كما هو موضح أدناه. [دلهي 2008]

الجوابA & # 8211 توليف مستمر (حبلا رئيسيا) B & # 8211 توليف غير مستمر (حبلا متخلفة)

15- اذكر قطبية خيوط DNA A-B و C & # 8211 D الموضحة في شوكة النسخ الموضح أدناه.
[Ail India 2008]

الجواب. A & # 8211 B = 3 & # 8242 - & gt 5 & # 8242 C & # 8211 D = 5 & # 8242 - & gt 3 & # 8242

16- اذكر مواضع الكربون التي ترتبط بها القاعدة النيتروجينية وجزيء الفوسفات على التوالي في النيوكليوتيد الوارد أدناه. [كل الهند 2008]

الجوابالقاعدة النيتروجينية في جزيء الفوسفات C الأول عند 5 درجة مئوية

17. ما هي A و B في وحدة النسخ الممثلة أدناه؟ [الخارجية 2008]

الجواب.A & # 8211 المروج B & # 8211 المنهي

2 أسئلة علامات

18- اشرح العاملين المسئولين عن منح الاستقرار لبنية الحلزون المزدوج للحمض النووي. [كل الهند 2014]
الجوابهناك عاملان مسؤولان عن منح الاستقرار لبنية الحلزون المزدوج للحمض النووي هما
(ط) تكديس زوج أساسي واحد على الآخر.
(2) رابطة H بين القاعدة النيتروجينية

19. حدد الفرق بين الجينات الهيكلية في وحدة نسخ بدائيات النوى وحقيقيات النوى. [كل الهند 2014]
الجواب.تم العثور على الجينات الهيكلية بدائية النواة بشكل مستمر مع أي منطقة غير مشفرة ، بينما تنقسم الجينات الهيكلية حقيقية النواة إلى exons (ترميز DNA) و introns (DNA غير مشفر).

20. إظهار تكرار الحمض النووي بمساعدة رسم تخطيطي فقط. [All India 2014 C Delhi 2012]
الجوابتشكلت شوكة النسخ المتماثل للحمض النووي أثناء تكاثر الحمض النووي.

21- قالب حبلا مذكور أدناه. اكتب خيط الترميز المقابل وحبلا m-RNA التي يمكن تشكيلها ، جنبًا إلى جنب مع قطبيتها.
3 & # 8242 ATGCATGCATGCATGCATGCATGC 5 & # 8242 [خارجي 2014]
الجوابلقالب معين حبلا
3 & # 8217ATGCATGCATGCATGCATGC A T G C 5 & # 8242
حبلا الترميز
5 & ​​# 8217TACGTACGTACGTACGTACG T A C G 3 & # 8242
و mRNA حبلا
5 & ​​# 8217UACGUACGUACGUACGUA C G UA C G 3 & # 8242

22- ارسم مخططًا معنونًا لجسيم نووي. أين يوجد في الخلية؟ [الخارجية 2014 ، عموم الهند 2012]
أو
كيف تكتسب الهيستونات شحنة موجبة؟ [دلهي 2011]
الجواب.بنية النوكليوسوم

تم العثور على نيوكليوسوم في نواة الخلية. يحتوي على بروتينات هيستون تكتسب شحنة موجبة اعتمادًا على وفرة بقايا الأحماض الأمينية ، أي ليسين وأرجينين ، مع سلاسل جانبية مشحونة. كل من هذه الأحماض الأمينية تحمل شحنات موجبة في سلاسلها الجانبية.

23- ارسم مخططًا تخطيطيًا لجزء من سلسلة DNA ثنائية النوكليوتيد المزدوجة التي تقطعت بها السبل والتي تحتوي على جميع القواعد النيتروجينية الأربعة التي توضح القطبية الصحيحة. [دلهي 2012]
الجواب.رسم تخطيطي لسلسلة DNA ثنائية النوكليوتيد مزدوجة الجديلة بها جميع القواعد النيتروجينية الأربعة (A ، T ، G ، C) ذات القطبية

24- اذكر الدور المزدوج لثلاثي فوسفات الديوكسي ريبونوكليوزيد أثناء تكرار الحمض النووي. [دلهي 2011]

الجواب. (ط) إن ثلاثي فوسفات الديوكسي ريبونوكليوزيد هو اللبنات الأساسية لخيط الحمض النووي (سلسلة البولي نيوكليوتيد) أي أنها تعمل كركائز.

(2) تعمل هذه أيضًا كمصدر للطاقة في شكل ATP و GTP.
25- أجب عن الأسئلة بناءً على ثنائي النوكليوتيد الموضح أدناه

(ط) اسم نوع قاعدة غوانين السكر المرفقة به.

(2) اسم الارتباط الذي يربط بين النيوكليوتيدات.

(3) تحديد 3 & # 8242 نهاية ثنائي النوكليوتيد. أعط سببا لإجابتك. [كل الهند 2010 ج]

الجواب.(ط) سكر البنتوز أو سكر الديوكسيريبوز.
(2) يرتبط اثنان من النيوكليوتيدات من خلال ارتباط 3 & # 8242-5 & # 8242 phosphodiester لتشكيل ثنائي النوكليوتيد.

(iii) يحتوي ريبوز البوليمر على مجموعة 3 & # 8242 - OH مجانية والتي يشار إليها باسم 3 & # 8242 & # 8211 نهاية سلسلة البولي نيوكليوتيد.

26- قم بعمل رسم تخطيطي مُصنَّف لثنائي نيوكليوتيد الحمض النووي الريبي يُظهر قطبية 3 & # 8242 - & GT5 & # 8242. [كل الهند 2010 ج]
الجوابثنائي النوكليوتيد الحمض النووي الريبي.

27- ادرس بعناية الجزء المحدد من سلسلة عديد النوكليوتيد المزدوجة المجدولة. حدد A و B و C و 5 & # 8242 نهاية السلسلة. [عموم الهند 2009]

الجوابA & # 8211 روابط هيدروجينية ، قاعدة البيورين B & # 8211 ،
ج & # 8211 سكر بنتوز (ديوكسيريبوز) ، D & # 8211 5 & # 8242 نهاية.

28. التفرق بين خيط القالب وخيط ترميز الحمض النووي. [الخارجية 2009]
الجوابالاختلافات بين حبلا القالب وخيط ترميز الحمض النووي هي:

29. أعط وظيفة واحدة لكل من بروتين هيستون وبروتين كروموسومي غير هيستون في نواة حقيقية النواة ، [All India 2009 C]
الجواب.(أنا)بروتينات هيستون تساعد في تغليف الحمض النووي. يتم تنظيم هذه لتشكيل وحدة من ثمانية جزيئات تسمى هيستون أوكتامر. يتم لف الحمض النووي المشحون سالبًا حول أوكتامر هيستون موجب الشحنة إلى من بنية تسمى nucleosome.
(ثانيا) بروتينات كروموسومية غير هيستون يساعد في تغليف الكروماتين بمستويات أعلى.

30.

انظر إلى التسلسل أعلاه واذكر الأحداث A و B و C
(2) ما هي حالة العقيدة المركزية في البيولوجيا الجزيئية؟ كيف تختلف في بعض الفيروسات؟ [دلهي 2009 ج]
الجواب(ط) A & # 8211 تكرار الحمض النووي B & # 8211 النسخ C & # 8211 الترجمة
(2) تنص العقيدة المركزية على أن المعلومات الجينية تتدفق من DNA إلى RNA إلى البروتينات. في بعض الفيروسات يكون تدفق المعلومات عكسيًا في الاتجاه ، أي RNA إلى DNA.

31. قارن بين أدوار إنزيمات بوليميريز DNA و DNA ligase في شوكة النسخ المتماثل للحمض النووي. [All India 2008 C]
الجواب.الاختلافات بين أدوار بوليميراز DNA و DNA ligase هي:

3 أسئلة للعلامات

32. بمساعدة رسم تخطيطي ، اشرح مكان ودور ما يلي في وحدة النسخ.
الجواب. هيكل وحدة النسخ

يحيط المروج والمنهي الجين الهيكلي في وحدة النسخ. يقع المروج نحو الطرف 5 & # 8242 (المنبع) للجين الهيكلي. يقع الفاصل في اتجاه الطرف 3 & # 8242 (المصب) من حبلا الترميز وعادة ما يحدد نهاية عملية النسخ

33. (ط) ما هي نواتج النسخ لـ RNA polymerase III؟
(2) ميّز بين & # 8217capping & # 8217 و & # 8216tailing & # 8217.
(3) قم بتوسيع ZmRNA. [جميع الهند 2014C]
الجواب. (1) RNA polymerase III مسؤول عن نسخ الحمض النووي الريبي (tRNA) و 55 rRNA و snRNAs (الحمض النووي الريبي النووي الصغير). (2) في عملية السد ، تتم إضافة نيوكليوتيد غير عادي (ميثيل غوانوزين ثلاثي الفوسفات) إلى 5 & # 8242-endbnRNA. عملية التكسير ، تتم إضافة 200-300 من بقايا الأدينيلات في نهاية 3 & # 8242 بطريقة مستقلة عن القالب. يطلق عليه الآن مرنا
(ثالثا)حن RNA هو RNA نووي غير متجانس.

34- ثبت أن الحمض النووي الريبي هو أول مادة وراثية. اشرح مع إعطاء ثلاثة أسباب
[دلهي 2012،2008 ج]
الجواب.RNA هو أول مادة جينية في الخلايا بسبب
(ط) RNA قادر على تخزين المعلومات الجينية وتحفيز التفاعلات الكيميائية.
(2) تطورت عمليات الحياة الأساسية (مثل التمثيل الغذائي والترجمة والربط وما إلى ذلك) حول الحمض النووي الريبي.
(3) يظهر قوة التكرار الذاتي.

35. (ط) إنشاء وحدة نسخ كاملة مع المروج والنهاية على أساس حبلا القالب الافتراضي الوارد أدناه ،

(2) اكتب حبلا الحمض النووي الريبي المنسوخ من وحدة النسخ أعلاه مع قطبيتها. [دلهي 2012]
الجواب.

36. سرد السمات البارزة لهيكل الحلزون المزدوج للحمض النووي. [All India 2012]
الجوابالسمات البارزة للحلزون المزدوج للحمض النووي
(ط) يتكون من سلسلتين من عديد النوكليوتيد تحتوي على العمود الفقري لسكر فوسفات ومشروع القواعد في الداخل.
(2) السلسلتان لهما قطبية متوازية ، أحدهما 5 & # 8242- »3 & # 8242 ، والآخر به 3 & # 8242- * 5 & # 8242 قطبية.
(3) يتم إقران القواعد الموجودة في خيطين من خلال رابطة هيدروجينية (روابط H) لتشكيل أزواج قاعدية (bp). أزواج الأدينين من خلال رابطتين هيدروجينيتين مع الثايمين من الخيط المعاكس والعكس صحيح. بالطريقة نفسها ، يرتبط الجوانين بالسيتوزين من خلال ثلاث روابط H. بسبب ذلك ، يأتي البيورين دائمًا عكس بيريميدين.
(4) يتم لف السلسلتين بطريقة اليد اليمنى. تبلغ درجة اللولب 3.4 نانومتر ويوجد ما يقرب من 10 نقاط أساس في كل منعطف. وبالتالي ، تبلغ المسافة بين زوج القاعدة في اللولب حوالي 0.34 نانومتر.
(ت) تتكدس طائرة أحد الزوجين الأساسيين فوق الآخر في اللولب المزدوج. هذا يضفي الاستقرار على الهيكل الحلزوني

37- كيف يتم ضرب الحمض النووي الريبي (RNA) لتكوين الرنا المرسال؟ [الخارجية 2012،2008]
الجوابيُطلق على سلف الرنا المرسال المنسوخ بواسطة بوليميراز الحمض النووي الريبي الثاني RNA النووي غير المتجانس (hnRNA). يخضع للتغييرات التالية:
(ط) الربط في هذه العملية ، يتم إزالة الإنترونات غير المشفرة ويتم ضم متواليات التشفير التي تسمى exons بترتيب محدد. هذا مطلوب لأن النسخة الأولية تحتوي على إنترونات وإكسونات. (2) تغطية RNA polymerase III مسؤول عن نسخ الحمض النووي الريبي ، 55 rRNA و snRNAs (الحمض النووي الريبي النووي الصغير).
(أ) في عملية السد ، تتم إضافة نيوكليوتيد غير عادي (ميثيل غوانوزين ثلاثي الفوسفات) إلى 5 & # 8242-end ofbnRNA. في عملية المخلفات ، تتم إضافة 200-300 من بقايا الأدينيلات في نهاية 3 & # 8242 بطريقة مستقلة عن القالب. يطلق عليه الآن مرنا
(ب)حن RNA هو RNA نووي غير متجانس.
(3) Tailing RNA polymerase III هو المسؤول عن نسخ الحمض النووي الريبي ، و 55 rRNA و snRNAs (الحمض النووي الريبي الصغير).
(أ) في عملية السد ، تتم إضافة نيوكليوتيد غير عادي (ميثيل غوانوزين ثلاثي الفوسفات) إلى 5 & # 8242-end ofbnRNA. في عملية المخلفات ، تتم إضافة 200-300 من بقايا الأدينيلات في نهاية 3 & # 8242 بطريقة مستقلة عن القالب. يطلق عليه الآن مرنا
(ب) hn RNA هو RNA نووي غير متجانس.
(4) يتم تحرير mRNA المعالج بالكامل من النواة إلى السيتوبلازم للترجمة.

38. لماذا يعتبر الحمض النووي مادة وراثية أفضل من الحمض النووي الريبي؟ [Foreign 2012]
الجوابيعتبر الحمض النووي مادة وراثية أفضل لأنه مستقر ولا يتغير مع تقدم العمر أو يتغير في علم وظائف الأعضاء بسبب طبيعته المزدوجة ووجود الثايمين ، ولا يعتبر الحمض النووي الريبي مادة وراثية أفضل لأنه
(ط) 2 - مجموعة OH من نوكليوتيد الحمض النووي الريبي هي مجموعة تفاعلية تجعل الحمض النووي الريبي قابلاً للتغير وقابل للتحلل بسهولة.
(2) الحمض النووي الريبي (23S r-RNA) محفز ، أي أنه تفاعلي.

39- التسلسل الأساسي في أحد خيوط الدنا هو TAGCATGAT.
(ط) أعط التسلسل الأساسي للحبلا التكميلي.
(2) كيف يتم تجميع أزواج القواعد هذه معًا في جزيء DNA؟
(3) اشرح قاعدة التكامل الأساسية. اسم العالم الذي صاغ هذه القاعدة [HotsDelhi 2011]
الجواب(ط) ATCGTACTA
(2) يتم تثبيت أزواج القاعدة معًا بواسطة روابط هيدروجينية ضعيفة ، وأزواج الأدينين مع الثايمين بواسطة روابط H- وأزواج جوانين مع السيتوزين لتشكيل ثلاث روابط H-.
(3) قاعدة التكامل الأساسية للحمض النووي المزدوج الشريطة ، تكون النسب بين الأدينين والثايمين والجوانين والسيتوزين ثابتة وتساوي واحدًا. صاغ إروين تشارجاف هذه القاعدة.

40- لماذا ترى نوعين مختلفين من السلاسل المتماثلة في شوكة النسخ المتماثل المعطى للحمض النووي؟ اشرح. قم بتسمية هذه الخيوط ، [hots Delhi 2011]

الجوابهناك نوعان مختلفان من السلاسل الأصلية يعملان كخيوط قالب.
على حبلا القالب مع قطبية 3 & # 8242 - & gt5 & # 8242 ، يتم تصنيع الخيط الجديد كخيط مستمر. يمكن أن يقوم إنزيم بوليميراز الحمض النووي بتنفيذ بلمرة النيوكليوتيدات فقط في اتجاه 5 & # 8242 - »3 & # 8242. وهذا ما يسمى بالتوليف المستمر ويسمى الخيط الخيط الرئيسي.
على حبلا القالب الآخر مع قطبية 5 & # 8242 - & GT 3 & # 8242 ، يتم تصنيع الخيط الجديد من نقطة شوكة النسخ المتماثل ، أيضًا في اتجاه 5 & # 8242 - & GT 3 & # 8242. ولكن ، في فترات زمنية قصيرة ، يتم ربطها لاحقًا بواسطة روابط DNA لتشكيل حبلا ، يسمى lagging strand.

41. (ط) قم بتسمية الإنزيم الذي يحفز نسخ hnRNA.
(2) لماذا يحتاج hnRNA للخضوع للتغييرات؟ قائمة التغييرات التي تخضع لها hnRNA و 1 حيث تحدث هذه التغييرات في الخلية. [HOTS All India 2011]
الجواب(1) RNA polymerase II يحفز نسخ hnRNA.
(2) يخضع hnRNA للتغييرات لأنه يحتوي على introns و exons وهو غير وظيفي. التغييرات في hnRNA هي:
يُطلق على سلف الرنا المرسال المنسوخ بواسطة بوليميراز الحمض النووي الريبي الثاني RNA النووي غير المتجانس (hnRNA). يخضع للتغييرات التالية:
(ط) الربط في هذه العملية ، يتم إزالة الإنترونات غير المشفرة ويتم ضم متواليات التشفير التي تسمى exons بترتيب محدد. هذا مطلوب لأن النسخة الأولية تحتوي على إنترونات وإكسونات. (2) تغطية RNA polymerase III مسؤول عن نسخ الحمض النووي الريبي ، 55 rRNA و snRNAs (الحمض النووي الريبي النووي الصغير).
(أ) في عملية السد ، تتم إضافة نيوكليوتيد غير عادي (ميثيل غوانوزين ثلاثي الفوسفات) إلى 5 & # 8242-end ofbnRNA. في عملية المخلفات ، تتم إضافة 200-300 من بقايا الأدينيلات في نهاية 3 & # 8242 بطريقة مستقلة عن القالب. يطلق عليه الآن مرنا
(ب)حن RNA هو RNA نووي غير متجانس.
(3) Tailing RNA polymerase III هو المسؤول عن نسخ الحمض النووي الريبي ، و 55 rRNA و snRNAs (الحمض النووي الريبي الصغير).
(أ) في عملية السد ، تتم إضافة نيوكليوتيد غير عادي (ميثيل غوانوزين ثلاثي الفوسفات) إلى 5 & # 8242-end ofbnRNA. في عملية المخلفات ، تتم إضافة 200-300 من بقايا الأدينيلات في نهاية 3 & # 8242 بطريقة مستقلة عن القالب. يطلق عليه الآن مرنا
(ب) hn RNA هو RNA نووي غير متجانس.
(4) يتم تحرير mRNA المعالج بالكامل من النواة إلى السيتوبلازم للترجمة.

42- أجب عن الأسئلة التالية بناءً على تجربة Meselson و Stahl & # 8217s.
(ط) اكتب اسم المادة الكيميائية المستخدمة كمصدر للنيتروجين في التجربة بواسطتهم.
(2) لماذا قام العلماء بتجميع الضوء وجزيئات الحمض النووي الثقيلة في الكائن الحي المستخدم في التجربة؟
(3) كيف تمكن العلماء من تمييز جزيء الحمض النووي الثقيل عن جزيء الحمض النووي الخفيف؟ يشرح.
(4) اكتب النتيجة التي توصل إليها العلماء بعد الانتهاء من التجربة. [عموم الهند 2011]
الجواب(ط) NH4CI (كلوريد الأمونيوم).
(2) هو إظهار ذلك بعد جيل واحد بكتريا قولونية مع 15 N-DNA في وسط 14 N ، يحتوي على DNA متوسط ​​الكثافة بين الحمض النووي الخفيف والثقيل. يُظهر أنه من بين الخيوط ، يتم تصنيع خيط واحد فقط حديثًا ، باستخدام مصدر 14 N-nitrogen في الوسط.
(3) يمكن تمييز جزيئات DMA الثقيلة والخفيفة بالطرد المركزي في تدرج كثافة كلوريد السيزيوم (CsCI). كان 15 N-DNA أثقل من 14 N -DNA وكان الهجين 15 N & # 8211 14 N -DNA وسيطًا بين الاثنين.
(4) خلص العلماء إلى أن تكرار الحمض النووي هو شبه محافظ ، أي من خيطي الحمض النووي ، أحدهما هو الشريط الأبوي بينما الآخر تم تصنيعه حديثًا.

43. وصف بدء عملية النسخ في البكتيريا. [دلهي 2010]
الجوابتصبح عملية بدء النسخ في البكتيريا RNA polymerase مرتبطة بشكل عابر بعامل بدء (o). و يرتبط بتسلسل محدد على الحمض النووي مسمى المروج لبدء النسخ (بدء).

44. وصف عملية الاستطالة للنسخ في البكتيريا. [دلهي 2010]
الجوابتسهل عملية استطالة النسخ في البكتيريا RNA polymerase فتح حلزون الحمض النووي بعد الارتباط بالمحفز ، حيث يستخدم نوكليوزيد ثلاثي الفوسفات كركيزة ويبلمر النيوكليوتيدات بطريقة تعتمد على القالب بعد التكامل.
تستمر العملية حتى يصل بوليميراز الحمض النووي الريبي إلى منطقة النهاية على خيط الحمض النووي.

45- وصف عملية إنهاء النسخ في البكتيريا. [دلهي 2010]
الجوابيحدث الإنهاء عندما يصل RNA polymerase إلى منطقة النهاية ويسقط RN A الوليد. يصبح بوليميراز الحمض النووي الريبي مرتبطًا بشكل عابر بعامل الإنهاء (ع) ويسقط من وحدة النسخ

46- في سلسلة من التجارب على Streptococcus والفئران ، خلص F Griffith إلى أن بكتيريا R-strain قد تحولت. شرح. [All India 2010]
تجربة F Griffith & # 8217s
(ط) تم أخذ سلالتين من بكتيريا Streptococcus pneumoniae (المسببة للالتهاب الرئوي) واحدة تشكل مستعمرات ملساء مع كبسولة (نوع S) والأخرى تشكل مستعمرات خشنة بدون كبسولة (نوع R) للتجربة.
(2) كانت الخلايا من النوع S خبيثة وأنواع R لم تكن خبيثة.
(3) عندما تم حقن الخلايا الحية من النوع S في الفئران ، ماتوا.
(4) عندما تم حقن الخلايا الحية من النوع R في الفئران ، لم تظهر عليهم الالتهاب الرئوي.
S-strain & # 8212 & # 8211 & gt Injected in mice & # 8212 & # 8212 & # 8212- & gtMice ماتت
R-strain & # 8212 & # 8211 & gt Injected in mice & # 8212 & # 8212 & # 8212- & gtMice عاش
(5) عندما تم قتل بكتيريا S-strain عن طريق التسخين وحقنها في الفئران ، لم يصابوا بالمرض.
S-strain & # 8212 & # 8211 & gt (قتل الحرارة) & # 8212 & # 8211 & gt حقن في الفئران & # 8212- & gt الفئران تعيش
(6) عندما تم حقن مزيج من الخلايا من النوع S المقتولة بالحرارة وخلايا R الحية في الفئران ، ماتت الفئران بسبب الالتهاب الرئوي.
(7) استعاد جريفيث خلايا سلالة حية من الفئران الميتة.
(viii) وفقًا له ، تم تحويل بكتيريا سلالة R بطريقة ما بواسطة بكتيريا سلالة S. قد يكون هذا بسبب بعض المبادئ التحويلية. يمكن نقل عامل من سلالة S المقتولة بالحرارة ، مما مكّن سلالة R من تصنيع كبسولة ملساء وتصبح شديدة الضراوة.
(9) يجب أن يكون مبدأ التحويل هذا هو المادة الجينية.

47- ارسم تمثيل تخطيطي لثنائي النوكليوتيد. قم بتسمية ما يلي.
(ط) مكون النوكليوتيدات
(2) 5 & # 8242 نهاية
(3) ارتباط N- جليكوسيد
'4` ربط الفوسفوديستر [أجنبي 2010]
الجواب. تمثيل تخطيطي لثنائي النوكليوتيد.

48. (ط) ارسم تمثيل تخطيطي لوحدة النسخ يظهر قطبية كلا الجدولين. قم بتسمية جين المروج وخيط القالب.
(2) اذكر الحالة عندما يصبح حبلا القالب حبلا ترميزًا.
(3) أعط وظيفة الجين المروج. [كل الهند 2009 C]
الجواب. (ط) هيكل وحدة النسخ

يحيط المروج والمنهي الجين الهيكلي في وحدة النسخ. يقع المروج نحو الطرف 5 & # 8242 (المنبع) للجين الهيكلي. يقع الفاصل في اتجاه الطرف 3 & # 8242 (المصب) من حبلا الترميز وعادة ما يحدد نهاية عملية النسخ
(2) السلكان الموجودان في الحمض النووي لهما قطبية معاكسة ويحفز بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي البلمرة في اتجاه واحد فقط ، أي 5 & # 8242- & GT 3 & # 8242. الشريط الذي يحتوي على القطبية 3 & # 8242- & gt 5 & # 8242 يعمل كقالب ، يُطلق عليه اسم حبلا القالب. الشريط الآخر الذي له قطبية (5 & # 8242- »3 & # 8242) والتسلسل نفسه مثل RNA I (باستثناء الثايمين بدلاً من اليوراسيل) ، يتم إزاحته أثناء النسخ. هذا الخيط الذي لا يرمز لأي شيء) هو. يسمى حبلا الترميز.
(3) يحدد جين المروج القالب وخيوط الترميز. من خلال تبديل موضعه مع المنهي ، يمكن عكس تعريف الترميز وخيوط القالب

49. (ط) لماذا يحدث تكرار الحمض النووي في شوكة نسخ صغيرة وليس بطولها بالكامل؟
(2) لماذا يكون تكرار الحمض النووي مستمرًا ومتقطعًا في شوكة النسخ المتماثل؟
(3) شرح أهمية أصل النسخ المتماثل في شوكة النسخ المتماثل. [HOTS All India 2009 C]
الجواب(ط) نظرًا لأن جزيء الحمض النووي طويل جدًا ، فلا يمكن فصل خيطين بطولهما بالكامل ، حيث يتطلبان طاقة عالية جدًا. يحدث التكرار داخل فتحة صغيرة من I اللولب يسمى شوكة النسخ المتماثل.
(2) يمكن لبوليميراز الحمض النووي أن يحفز بلمرة النيوكليوتيدات فقط في اتجاه 5 & # 8242 - & GT 3 & # 8242. لذلك ، في قالب مع قطبية 3 & # 8242 - & GT5 & # 8242 ، يكون تكرار الحمض النووي مستمرًا. على خيط القالب مع قطبية 5 & # 8242- & GT 3 & # 8242 ، يحدث تخليق الحمض النووي في امتدادات قصيرة مع استمرار فتح النسخ المتماثل لـ . في وقت لاحق ، يتم ربط هذه الامتدادات القصيرة بفعل ligases DNA
(3) لا يبدأ تكرار الحمض النووي بشكل عشوائي ، ولا يمكن لبوليميرات الحمض النووي بمفردها بدء النسخ المتماثل ؛ لذلك ، هناك حاجة إلى تسلسل معين يمكن أن يبدأ الحمض النووي ، يسمى أصل النسخ المتماثل. يرتبط به بوليميريز الحمض النووي ويستمر في العملية.

50- يُحسب طول جزيء الحمض النووي في خلية الثدييات النموذجية بحوالي 2.2 متر. كيف يتم تغليف هذا الجزيء الطويل لاستيعابها داخل نواة الخلية؟ [دلهي 2009،2008]
الجوابتحتوي الخلايا حقيقية النواة على مجموعة من البروتينات الأساسية موجبة الشحنة تسمى الهستونات. فهي غنية بالليسين والأرجينين. يتم تنظيم الهستونات لتشكيل وحدة من ثمانية جزيئات تسمى هيستون أوكتامر. يتم لف الحمض النووي المشحون سالب الشحنة حول أوكتامر هيستون ذو الشحنة الموجبة لتكوين جسيم نووي. يحتوي النوكليوسوم على 200 نقطة أساس من لولب الحمض النووي ، وتشكل النوكليوسومات الوحدات المتكررة لبنية النواة ، تسمى الكروماتين.

5 أسئلة للعلامات

51. & # 8217DNA النسخ المتماثل شبه محافظ & # 8217. قم بتسمية العلماء الذين اقترحوا ذلك والذين أثبتوا ذلك. كيف تم إثباته تجريبيًا؟ [All India 2014C Delhi 2008 Foreign 2008]
أو
من الذي اقترح أن تكرار الحمض النووي هو شبه محافظ؟ كيف أثبت ميسلسون وستال ذلك.
[دلهي 2008 ج]
أو
صف تجربة Meselson و Stahl & # 8217s واكتب النتيجة التي توصلوا إليها. [الخارجية 2014 دلهي 2012]
الجواب.اقترح واتسون وكريك أن تكرار الحمض النووي هو شبه محافظ. في وقت لاحق من عام 1958 ، أثبت ميزلسون وستال ذلك. تشير الطبيعة شبه المحافظة للحمض النووي إلى أنه بعد الانتهاء من النسخ المتماثل ، سيكون لكل جزيء من جزيئات الحمض النووي خيط أبوي واحد وحبل واحد مركب حديثًا.
دليل تجريبي
(ط) نمت الإشريكية القولونية في وسط يحتوي على 15 NH4CI (15 N هو النظير الثقيل للنيتروجين) كمصدر وحيد للنيتروجين لعدة أجيال. نتيجة لذلك ، تم دمج 15 نيوتن في الحمض النووي المركب حديثًا. يمكن تمييز هذا الحمض النووي الثقيل بالطرد المركزي في تدرج كثافة CsSI.
(2) بعد ذلك ، تم نقل خلايا الإشريكية القولونية هذه إلى وسط مع 14 NH الطبيعي4تم استخراج CI والحمض النووي على شكل حلزون مزدوج تقطعت بهم السبل. تم فصل العينات المختلفة على تدرجات CsCI لقياس كثافة الحمض النووي (بعد 20 دقيقة).
كان للهجين كثافة متوسطة.

(3) بعد 40 دقيقة ، تم استخراج الحمض النووي للجيل الثاني من 14 NH4وسط CI ووجد أنه يحتوي على كميات متساوية من الحمض النووي الهجين والخفيف.
(4) هذا يثبت أنه بعد النسخ المتماثل ، يحتوي كل جزيء DNA على حبلا أبوي واحد وحبلا مركب حديثًا.

52. (1) وصف الخطوات المختلفة لتجربة Griffith & # 8217s التي أدت إلى استنتاج & # 8216 مبدأ التحويل & # 8217.
(2) كيف نشأت الطبيعة الكيميائية لمبدأ التحويل & # 8216 & # 8217؟ [كل الهند 2014]
أو
(ط) اكتب الاستنتاج الذي توصل إليه جريفيث في نهاية تجربته مع Streptococcus pneumoniae.
(2) كيف أثبت O Avery و C MacLeod و M McCarty أن الحمض النووي هو المادة الجينية؟ يشرح.
[عموم الهند 2013،2009]
أو
وصف تجربة فريدريك جريفيث & # 8217s على العقدية الرئوية. ناقش الاستنتاج الذي توصل إليه. [كل الهند 2012]
أو
(ط) اكتب الاسم العلمي للبكتيريا التي استخدمها فريدريك جريفيث في تجربته.
(2) كيف أثبت أن بعض المبادئ التحويلية هي المسؤولة عن تحويل سلالات البكتيريا غير الخبيثة إلى الشكل الخبيث؟
(3) اذكر الطبيعة البيوكيميائية لمبدأ التحويل.
(4) تسمية العلماء الذين أثبتوا ذلك [أجنبي 2011،2009،2008Delhi 2009 C، 2008 C]
الجواب(ط) ثنائي النوكليوتيد RNA.

(ثانيا)الطبيعة البيوكيميائية لمبدأ تحويل تجربة جريفيث & # 8217s.

  • عمل Oswald Avery و Colin MacLeod و Maclyn McCarty (1933-44) على تحديد الطبيعة البيوكيميائية لمبدأ التحويل في تجربة Griffith & # 8217s.
  • قاموا بتنقية المواد الكيميائية الحيوية (البروتينات ، الحمض النووي ، الحمض النووي الريبي ، إلخ) من S-cel Is المقتول بالحرارة لمعرفة أي منها يمكن أن يحول الخلايا R الحية إلى S-cel Is.
  • اكتشفوا أن الحمض النووي وحده من بكتيريا S تسبب في تحول البكتيريا R.
  • اكتشفوا أيضًا أن إنزيمات هضم البروتين (البروتياز) وإنزيم هضم الحمض النووي الريبي (RNAse) لا يؤثران على التحول.
  • الهضم مع DNAase منع التحول. واقترح أن الحمض النووي يسبب التحول.
  • وهكذا توصلوا أخيرًا إلى أن الحمض النووي هو المادة الجينية

53- صِف تجربة Hershey and Chase & # 8217s. اكتب النتيجة التي توصل إليها العلماء بعد تجربتهم. [كل الهند 2014]
أو
قم بتسمية العلماء الذين أثبتوا تجريبياً أن الحمض النووي هو المادة الجينية. صف تجربتهم.
أو
(ط) وصف تجربة Hershey و Chase & # 8217s.
(2) اكتب الهدف من التجربة. [دلهي 2010 ج عموم الهند 2010،2008 ج]
الجوابتجربة Hershey and Chase & # 8217s كانت تجربتهم هي إثبات بشكل لا لبس فيه أن الحمض النووي هو المادة الوراثية وليس البروتين.2 العاثيات ، التي تهاجم بكتيريا الإشريكية القولونية. لقد قاموا بزراعة بعض الفيروسات على وسط يحتوي على الفوسفور المشع (32 ف) والبعض الآخر على وسط يحتوي على الكبريت المشع (32 5).
(ط) تم السماح للعاثيات المشعة بمهاجمة بكتيريا الإشريكية القولونية. استمرت العدوى ، تمت إزالة الطبقات الفيروسية من البكتيريا عن طريق تحريكها في الخلاط. تم فصل جزيئات الفيروس عن البكتيريا عن طريق تدويرها في جهاز طرد مركزي.
(2) كانت البكتيريا المصابة بالفيروسات التي تحتوي على دنا مشع مشعة ، مما يشير إلى أن الحمض النووي هو المادة التي تنتقل من الفيروس إلى البكتيريا.
(3) البكتيريا المصابة بالفيروسات التي تحتوي على بروتينات مشعة لم تكن مشعة. يشير هذا إلى أن البروتينات لم تدخل البكتيريا من الفيروسات. ومن ثم ، فإن الحمض النووي هو مادة وراثية تنتقل من فيروس إلى بكتيريا.

54. (ط) اشرح عملية تكرار الحمض النووي بمساعدة رسم تخطيطي.
(2) في أي مرحلة من دورة الخلية يحدث التكرار في حقيقيات النوى؟ ماذا سيحدث إذا لم يتم اتباع انقسام الخلايا بعد تكرار الحمض النووي. [دلهي 2014]
الجواب(ط) شوكة النسخ المتماثل للحمض النووي التي تشكلت أثناء تكرار الحمض النووي.

(2) يحدث تكرار الحمض النووي في المرحلة S من دورة الخلية في حقيقيات النوى. الرجوع إلى الجواب.

55- قم بتسمية الأنواع الرئيسية من الحمض النووي الريبي واشرح دورها في عملية تخليق البروتين في بدائيات النوى. [الخارجية 2014]
الجوابهناك ثلاثة أنواع رئيسية من الحمض النووي الريبي في بدائيات النوى والتي تساعد في تخليق البروتين على النحو التالي:
(أنا) رسول RNA (مرنا) يتم تشكيله كجدول مكمل على أحد خيطي الحمض النووي داخل النواة. بعد فترة وجيزة من تكوينه ، يخرج mRNA في السيتوبلازم. يسمى تكوين الرنا المرسال من الحمض النووي بالنسخ. تتمثل وظيفة mRNA في نقل المعلومات الجينية الموجودة في الحمض النووي (داخل النواة) إلى السيتوبلازم لتخليق البروتين.
(2) RNA الريبوسوم (rRNA) يتكون في النواة ويشكل 80 ٪ من إجمالي الحمض النووي الريبي الموجود داخل الخلية. وهو أيضًا أكثر أنواع الحمض النووي الريبي استقرارًا. يرتبط الرنا الريباسي بالتنظيم الهيكلي للريبوسومات (يشكل الرنا الريباسي حوالي 60٪ من وزن الريبوسومات) ، وهي مقاعد لتخليق البروتين.
(iii) نقل RNA (tRNA) ويسمى أيضًا RNA القابل للذوبان (sRNA) أو محول RNA أو RNA التكيفي. يشكل الحمض الريبي النووي النقال 10-15٪ من إجمالي الحمض النووي الريبي الموجود في الخلية. يعمل كجزيء محول يحمل الأحماض الأمينية إلى موقع تخليق البروتين الأول (أي الريبوسومات).

56- وصف عملية النسخ في البكتيريا. [All India 2014 C]
الجوابتصبح عملية بدء النسخ في البكتيريا RNA polymerase مرتبطة بشكل عابر بعامل بدء (o). و يرتبط بتسلسل محدد على الحمض النووي مسمى المروج لبدء النسخ (بدء).

تسهل عملية الاستطالة للنسخ في البكتيريا RNA polymerase فتح حلزون الحمض النووي بعد الارتباط بالمحفز ، حيث يستخدم نوكليوزيد ثلاثي الفوسفات كركيزة ويبلمر النيوكليوتيدات بطريقة تعتمد على القالب بعد التكامل.
تستمر العملية حتى يصل بوليميراز الحمض النووي الريبي إلى منطقة النهاية على حبلا الحمض النووي.

يحدث الإنهاء عندما يصل RNA polymerase إلى منطقة النهاية ويسقط RN A الوليد. يصبح بوليميراز الحمض النووي الريبي مرتبطًا بشكل عابر بعامل الإنهاء (ع) ويسقط من وحدة النسخ

57. (ط) اشرح دور بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي الريبي في البدء والاستطالة والإنهاء أثناء النسخ في الخلية البكتيرية.
(2) كيف يكون النسخ عملية أكثر تعقيدًا في الخلايا حقيقية النواة؟ يشرح. [الخارجية 2011]
الجواب(ط) دور بوليميراز الحمض النووي الريبي المعتمد على الحمض النووي.
(أ) يصبح بوليميراز الحمض النووي الريبي مرتبطًا بشكل عابر بعامل البدء ويرتبط بموقع المروج على الحمض النووي ويبدأ النسخ.
(ب) يستخدم النوكليوزيد ثلاثي الفوسفات كركائز ويبلمرها بطريقة تعتمد على القالب باتباع قاعدة التكامل الأساسية في الاتجاه 5 & # 8242- & gt 3 & # 8217.
(ج) يسهل أيضًا فتح حلزون الحمض النووي ويواصل عملية الاستطالة.
(د) عندما يسقط البوليميراز من منطقة فاصلة على الحمض النووي ، ينفصل الحمض النووي الريبي الناشئ. هذا يؤدي إلى الإنهاء.
(2) الأسباب التي تجعل النسخ أكثر تعقيدًا في حقيقيات النوى هي:
(أ) الأنواع الثلاثة من بوليميرات الحمض النووي الريبي في النواة تظهر تقسيم العمل

  • بوليميريز الحمض النووي الريبي I نسخ الرنا الريباسي (28S ، 18S و 5.8S).
  • RNA polymerase II ينسخ سلائف الرنا المسمى hnRNA
  • RNA polymerase III ينسخ الحمض الريبي النووي النقال ، 5 srRNA و snRNAse.

(ب) تحتوي hnRNA على متواليات تشفير تسمى exons وتسلسلات غير مشفرة تسمى introns. لذلك ، يخضع لعملية تسمى التضفير ، حيث يتم إزالة التسلسلات غير المشفرة (الإنترونات) ويتم ضم متواليات التشفير (exons) معًا بترتيب محدد.
(ج) في السد ، تضاف بقايا نيوكليوتيدات غير عادية وميثيل غوانوزين ثلاثي الفوسفات في الطرف الخامس من hnRNA.
(د) في المخلفات ، تتم إضافة 200-300 من مخلفات الأدينيلات في الطرف الثالث من hnRNA.

58- ادرس مخطط التدفق الموضح أدناه وأجب عن الأسئلة التالية:

(أ) قم بتسمية الكائن الحي والتمييز بين سلالتهما R و S على التوالي.
(ب) اكتب النتيجة A و B التي تم الحصول عليها في الخطوة (3) و (4) على التوالي.
(ج) اسم العالم الذي نفذ الخطوات (1) و (2) و (3)
(د) اكتب النتيجة المحددة المستمدة من الخطوة (4). [Ail India 2010 C]
الجواب(أ) الكائن الحي هو بكتيريا Streptococcus pneumoniae. الاختلافات بين الخلايا من النوع S.
الخلايا من النوع R هي:

(ب) A & # 8211 الفئران ماتت B & # 8211 الفئران على قيد الحياة.
(ج) أجرى فريدريك جريفيث هذه الخطوات.
(د) يشير هذا إلى أن الحمض النووي هو مبدأ التحول. عند إضافة DNase إلى الوسيط ، يتم تغيير طبيعة الحمض النووي للخلايا المقتولة بالحرارة ولا يكون قادرًا على إجراء التحول.

59. (ط) ماذا لاحظ ميسلسون وستال؟ متي
(أ) قاموا بزراعة القولونية في وسط يحتوي على 15 NH4 Cl لبضعة أجيال وطرد المحتوى؟
(ب) قاموا بنقل إحدى هذه البكتيريا إلى الوسط الطبيعي لـ NH4 Cl والمثقف على مدى جيلين.
(2) ماذا استنتج ميسلسون وستال من تجربته؟ اشرح بمساعدة الرسوم البيانية.
(3) ما هي المادة الجينية الأولى؟ أعط أسبابا لدعم إجابتك.
[مجلة دلهي الخارجية 2009 دلهي 2009 2008 ج]
الجواب(1) (أ) لاحظ ميسلسون وستال أن 15 N قد تم دمجه في خيط DNA المركب حديثًا وكذلك المركبات الأخرى المحتوية على النيتروجين. يمكن تمييز هذا الحمض النووي الثقيل عن الحمض النووي الطبيعي عن طريق الطرد المركزي في تدرج كثافة كلوريد السيزيوم (CsCI).
(ب) الحمض النووي من هذه البكتيريا له كثافة هجينة أو متوسطة ، جيل واحد بعد النقل من 15 N إلى 14 N. بعد جيل آخر ، يتكون من كمية متساوية من هذا الحمض النووي الهجين والحمض النووي الخفيف
(2) خلص ميسلسون وستال إلى أن تكرار الحمض النووي هو شبه محافظ.
اقترح واتسون وكريك أن تكرار الحمض النووي هو شبه محافظ. في وقت لاحق من عام 1958 ، أثبت ميزلسون وستال ذلك. تشير الطبيعة شبه المحافظة للحمض النووي إلى أنه بعد الانتهاء من النسخ المتماثل ، سيكون لكل جزيء من جزيئات الحمض النووي خيط أبوي واحد وحبل واحد مركب حديثًا.
دليل تجريبي
(ط) نمت الإشريكية القولونية في وسط يحتوي على 15 NH4CI (15 N هو النظير الثقيل للنيتروجين) كمصدر وحيد للنيتروجين لعدة أجيال. نتيجة لذلك ، تم دمج 15 نيوتن في الحمض النووي المركب حديثًا. يمكن تمييز هذا الحمض النووي الثقيل بالطرد المركزي في تدرج كثافة CsSI.
(2) بعد ذلك ، تم نقل خلايا الإشريكية القولونية هذه إلى وسط مع 14 NH الطبيعي4تم استخراج CI والحمض النووي على شكل حلزون مزدوج تقطعت بهم السبل. تم فصل العينات المختلفة على تدرجات CsCI لقياس كثافة الحمض النووي (بعد 20 دقيقة).
كان للهجين كثافة متوسطة.

(3) بعد 40 دقيقة ، تم استخراج الحمض النووي للجيل الثاني من 14 NH4وسط CI ووجد أنه يحتوي على كميات متساوية من الحمض النووي الهجين والخفيف.
(4) هذا يثبت أنه بعد النسخ المتماثل ، يحتوي كل جزيء DNA على حبلا أبوي واحد وحبلا مركب حديثًا.
(3) الحمض النووي الريبي هو أول مادة وراثية في الخلايا بسبب
(أ) RNA قادر على تخزين المعلومات الجينية وتحفيز التفاعلات الكيميائية.
(ب) تطورت عمليات الحياة الأساسية (مثل التمثيل الغذائي والترجمة والربط وما إلى ذلك) حول الحمض النووي الريبي.
(ج) يظهر قوة التكرار الذاتي.

60- لماذا يعتبر جزيء الحمض النووي مادة وراثية أكثر استقرارًا من الحمض النووي الريبي؟ يشرح. [كل الهند 2008]
الجواب. الحمض النووي هو مادة وراثية أكثر استقرارًا لأن
(1) مجموعة 2 & # 8217— OH في نيوكليوتيدات الحمض النووي الريبي هي مجموعة تفاعلية وتجعل الحمض النووي الريبي قابلاً للتغير وقابل للتحلل بسهولة. لكن الحمض النووي أقل تفاعلًا كيميائيًا وأكثر استقرارًا من الناحية الهيكلية.
(2) إن وجود الثايمين بدلاً من اليوراسيل يمنح أيضًا مزيدًا من الاستقرار للحمض النووي.
(3) إن شريطين من الحمض النووي مكملان لبعضهما البعض وحتى إذا تم فصلهما بالحرارة ، يجتمعان معًا ، عندما يتم إنشاء ظروف مناسبة من ناحية أخرى ، عادةً ما يكون الحمض النووي الريبي واحدًا تقطعت به السبل

61- ارسم الهيكل التخطيطي المسمى لوحدة النسخ. اشرح وظيفة كل مكون من مكونات الوحدة في عملية النسخ. [كل الهند 2008]
الجواب. هيكل وحدة النسخ

يحيط المروج والمنهي الجين الهيكلي في وحدة النسخ. يقع المروج نحو الطرف 5 & # 8242 (المنبع) للجين الهيكلي. يقع الفاصل في اتجاه الطرف 3 & # 8242 (المصب) من حبلا الترميز وعادة ما يحدد نهاية عملية النسخ
وظائف مكونات وحدة النسخ
(أنا) المروجين (تسلسل الحمض النووي) يوفر موقع ربط لبوليميراز الحمض النووي الريبي.
(ثانيا) الجينات الهيكلية رمز للإنزيمات / البروتينات ونسخ mRNA لنفسه.
(ثالثا)المنهي (تسلسل القواعد) يحدد نهاية عملية النسخ
(4) حبلا DNA مع 3 & # 8242 & # 8211 5 & # 8242 قطبية & # 8211 يعمل كقالب لنسخ مرنا.
(v) حبلا DNA مع 5 & # 8242 & # 8211 3 & # 8242 قطبية & # 8211 شريط ترميز لا يرمز لـ RNA ، ولكن جميع النقاط المرجعية المتعلقة بالنسخ مصنوعة باستخدام هذا الشريط

62. (ط) اذكر العقيدة المركزية في البيولوجيا الجزيئية. من اقترح ذلك؟ هل هي قابلة للتطبيق عالميا؟ يشرح.
(2) ضع قائمة بأربع خصائص للجزيء لتكون قادرة على العمل كمواد وراثية. [All India 2008 C]
الجواب.(ط) اقترح فرانسيس كريك العقيدة المركزية في البيولوجيا الجزيئية ، والتي تنص على أن المعلومات الجينية تتدفق منها


انها ليست قابلة للتطبيق عالميا. في بعض الفيروسات ، يكون تدفق المعلومات في الاتجاه المعاكس ، أي من RNA إلى DNA.
(2) خصائص الجزيء ليكون بمثابة مادة وراثية

  • يجب أن يكون قادرًا على إنشاء نسخته المتماثلة.
  • يجب أن يكون مستقرًا كيميائيًا وبنيويًا.
  • يجب أن يوفر مجالًا للتغييرات البطيئة (الطفرة) المطلوبة للتطور.
  • يجب أن تكون قادرة على التعبير عن نفسها في شكل شخصيات مندل إيان

63. يمثل رسم بياني جزءًا من تسلسل سلسلة متعدد النوكليوتيد مزدوج تقطعت بهم السبل في جزيء DNA يتضمن جميع القواعد النيتروجينية الأربعة. [All India 2008 C]
الجواب.يتم تمثيل تسلسل سلسلة متعدد النوكليوتيد مزدوج الجديلة في جزيء DNA يتضمن جميع القواعد النيتروجينية الأربعة ، أي A ، T ، G ، C أدناه


أنواع الحمض النووي الريبي: 3 أنواع رئيسية من الحمض النووي الريبي (مع رسم بياني)

يسلم الأحماض الأمينية إلى الريبوسوم ويفك تشفير معلومات الرنا المرسال. يمثل كل كودون ثلاثي نيوكليوتيد على mRNA حمض أميني. يلعب الحمض الريبي النووي النقال دور المحول ويطابق كل كودون مع الأحماض الأمينية الخاصة به في التجمع الخلوي.

يحتوي الحمض الريبي النووي النقال (tRNA) على خاصيتين:

(أ) يمثل حمض أميني واحد يرتبط به تساهميًا.

(ب) لها موقعان. الأول هو تسلسل ثلاثي النوكليوتيدات يسمى أنتيكودون ، وهو مكمل لكودون الرنا المرسال. يشكل الكودون والمضاد الكودون أزواجًا أساسية مع بعضها البعض. والآخر هو موقع ارتباط الأحماض الأمينية.

توجد أنواع مختلفة من جزيئات الحمض الريبي النووي النقال في الخلية. يتم تسمية كل حمض tRNA على اسم الحمض الأميني الذي يحمله. على سبيل المثال ، إذا كان الحمض الريبي النووي النقال يحمل الحمض الأميني التيروزين ، يتم كتابته كـ tRNA Tyr. في بعض الأحيان يكون هناك أكثر من tRNA واحد للحمض الأميني ، ثم يتم الإشارة إليه على أنه tRNA1 جرب و tRNA2 محاولة . مطلوب ما لا يقل عن 32 tRNAs لترجمة جميع الكودونات البالغ عددها 61.

يسمى الحمض الريبي النووي النقال المشحون بحمض أميني amino acyl tRNA.

هيكل أوراق البرسيم من الحمض الريبي النووي النقال:

الهيكل الأساسي لجميع جزيئات الحمض النووي الريبي هو حمض نووي صغير وخطي واحد تقطعت به السبل يتراوح حجمه من 73 إلى 93 نيوكليوتيد. تشكل الحمض الريبي النووي النقال (tRNA) ، نظرًا لخصائصها المتمثلة في وجود امتدادات من أزواج القواعد التكميلية ، بنية ثانوية ، والتي تكون في شكل ورقة البرسيم.

تشكل عدة مناطق من الجزيء المنفرد الذي تقطعت به السبل سيقانًا أو أذرعًا مزدوجة مجدولة وحلقات مجدولة مفردة بسبب طي مناطق مختلفة من الجزيء. هذه السيقان المزدوجة لها أزواج قاعدة مكملة. يحتوي الحمض الريبي النووي النقال النموذجي على قواعد ترقيم من 1-76 ، باستخدام اصطلاح الترقيم القياسي حيث يكون الموضع 1 هو نهاية 5 & # 8242 و 76 هو نهاية 3 & # 8242.

المناطق المختلفة لنموذج أوراق البرسيم من الحمض الريبي النووي النقال هي كما يلي:

له سبعة أزواج أساسية مكونة من الاقتران الأساسي بين 5 & # 8242 و 3 & # 8242 نهايات tRNA. في النهاية 3 & # 8242 ، تتم إضافة تسلسل من 5 & # 8242-CCA-3 & # 8242. وهذا ما يسمى بذراع CCA أو ذراع متقبل الأحماض الأمينية. يرتبط الأحماض الأمينية بهذه الذراع أثناء تخليق البروتين.

انطلاقًا من الاتجاه 5 & # 8242 إلى 3 & # 8242 أو عكس اتجاه عقارب الساعة ، يكون الذراع التالي هو D-arm. يحتوي على جذع من 3 إلى 4 أزواج أساسية وحلقة تسمى D-loop أو DHU-loop. يحتوي على ثنائي هيدرووراسيل قاعدة معدلة.

التالي هو الذراع الذي يقع مقابل الذراع المستقبلة. لها جذع من خمسة أزواج أساسية وحلقة بها ثلاثة نيوكليوتيدات متجاورة تسمى anticodon وهي مكملة لكودون mRNA.

بعد ذلك يكمن ذراع إضافي يتكون من 3-21 قاعدة. اعتمادًا على الطول ، تكون الأذرع الإضافية من نوعين ، ذراع إضافي صغير به 3-5 قواعد والآخر ذراع كبير به 13-21 قاعدة.

لها قاعدة معدلة pseudouridine ψ. لها ساق من خمسة أزواج أساسية بحلقة.

يوجد حوالي 50 نوعًا مختلفًا من القواعد المعدلة في مختلف الحمض النووي الريبي ، ولكن هناك أربع قواعد أكثر شيوعًا. واحد هو الريبوثيميدين الذي يحتوي على الثايمين الذي لا يوجد في الحمض النووي الريبي. القواعد المعدلة الأخرى هي pseudouridine ψ و dihyrouridine و inosine.

هيكل ثلاثي الأبعاد للـ tRNA:

يُظهر التحليل البلوري بالأشعة السينية لـ tRNA بنية ثلاثية الأبعاد تسمى الهيكل الثالث. يتم طي الجزيء وله فرعين حلزونيين تقطعت بهم السبل. فرع واحد يتكون من الذراع المستقبلة والذراع T-C. يتكون الذراع الآخر من حلقة DHU وذراع anticodon بحلقة.

جزيء الحمض الريبي النووي النقال على شكل L. تخلق البنية الثلاثية حلزونتين مزدوجتين في الزاوية اليمنى لبعضهما البعض. موقع ارتباط الأحماض الأمينية هو عكس ذراع anticodon. هذا يسهل تخليق البروتين.

يشكل الحمض الريبي النووي النقال حوالي 10٪ من إجمالي الحمض النووي الريبي الخلوي.

نوع الحمض النووي الريبي # 2. رسول RNA (مرنا):

رسول RNA هو جزيء خطي منسوخ من خيط واحد من الحمض النووي. إنه يحمل التسلسل الأساسي المكمّل لقالب قالب الحمض النووي. يكون التسلسل الأساسي لـ mRNA في شكل أكواد ثلاثية متتالية. تقوم الريبوسومات بترجمة هذه الكودونات الثلاثية إلى تسلسل الأحماض الأمينية لسلسلة البولي ببتيد.

طول مرنا:

يعتمد طول mRNA على طول سلسلة البولي ببتيد التي ترمز لها. يختلف طول البولي ببتيد من سلسلة من بضعة أحماض أمينية إلى آلاف الأحماض الأمينية. على سبيل المثال ، سوف يرمز تسلسل من 600 نيوكليوتيد لبولي ببتيد يحتوي على سلسلة من 200 حمض أميني. تتم قراءة الرسالة في مجموعات من ثلاث قواعد متتالية من نقطة بداية ثابتة.

مدى الحياة من mRNA:

في البكتيريا ، يتم نسخ mRNA وترجمته في حجرة خلوية واحدة وترتبط العمليتان ارتباطًا وثيقًا بحيث تحدثان في وقت واحد. يبدأ النسخ عندما يرتبط إنزيم بوليميراز الحمض النووي الريبي بالحمض النووي ثم ينتقل على طول لينتج نسخة من خيط واحد. بمجرد بدء النسخ ، ترتبط الريبوسومات بالنهاية 5 & # 8242 (النهاية الحرة) من الرنا المرسال وتبدأ الترجمة بينما لا يزال الطرف الآخر من الرنا المرسال قيد التوليف.

يُعرف هذا بالنسخ المزدوج والترجمة في بدائيات النوى. بعد اكتمال ترجمة mRNA بالكامل ، يتدهور mRNA في اتجاه 5 & # 8242 → 3 & # 8242. يتم تصنيع mRAN وترجمته وتدهوره في تتابع سريع وكل ذلك في اتجاه 5 & # 8242 → 3 & # 8242. يبقى جزيء mRNA الفردي لمدة دقيقة فقط أو أقل.

في حقيقيات النوى ، يحدث النسخ في النواة بينما تحدث الترجمة في السيتوبلازم. mRNA حقيقية النواة مستقرة تمامًا وتعيش من بضع دقائق إلى أكثر من يوم. في خلايا الدم الحمراء في الثدييات ، من خلال فقدان النواة ، يستمر الرنا المرسال في إنتاج الهيموجلوبين لعدة أيام.

يشكل mRNA حقيقيات النوى نسبة صغيرة فقط من إجمالي الحمض النووي الريبي الخلوي. إنه يمثل حوالي 3 ٪ فقط من إجمالي الحمض النووي الريبي.

مناطق الترميز وغير المشفرة:

جميع mRNAs لها نوعان من المناطق. تتكون منطقة الترميز من سلسلة من الكودونات. لكن mRNA أطول من مناطق التشفير. طول mRNA المركب حديثًا أكبر بكثير من طول mRNA المستخدم للترجمة. تسمى مناطق الترميز exons. بين مناطق الترميز توجد مناطق مختلفة غير مشفرة تسمى الإنترونات. تسمى الجينات التي تحتوي على هذه التسلسلات المتداخلة الجينات المنقسمة أو الجينات المتقطعة.

نوع الحمض النووي الريبي # 3. الحمض النووي الريبوزي (الرنا الريباسي):

معظم RNA للخلية في شكل RNA الريبوسوم الذي يشكل حوالي 85 ٪ من إجمالي RNA. تتكون الريبوسومات من أنواع عديدة من الرنا الريباسي. يحتوي الريبوسوم 70S من بدائيات النوى ، في وحدته الأصغر من 30S ، على 16S rRNA. تتكون الوحدة الفرعية الأكبر 50S من 23S و 5S rRNA. وبالمثل ، يحتوي الريبوسوم 80S على 18S rRNA في وحدته الفرعية الأصغر من 40S. تحتوي الوحدة الفرعية الأكبر 60S على 28S و 5.8S و 5S rRNA.

تشكل جزيئات الرنا الريباسي بنية ثانوية للسيقان المزدوجة والحلقات المفردة المجدولة من خلال أزواج قاعدية مكملة واسعة النطاق. يلعب الرنا الريباسي دورًا رئيسيًا في تخليق البروتين. يتفاعلون مع mRNA و tRNA في كل خطوة من خطوات الترجمة أو تخليق البروتين.

تتفاعل المحطة 3 & # 8242 من الرنا الريباسي لـ 16S rRNA مع موقع البدء على mRNA الذي يسمى تسلسل Shine-Dalgarno ويقع قبل كودون البدء AUG.

يلعب الرنا الريباسي 23S دورًا نشطًا في نشاط الببتيدل ترانسفيراز. يتم مساعدة حركة الحمض الريبي النووي النقال بين موقع A و P على الريبوسوم بواسطة 23 S rRNA.

تشكل جزيئات الرنا الريباسي معقدات تحتوي على بروتينات محددة في الريبوسومات. تسمى مجمعات بروتين الحمض النووي الريبي (RNA) بالبروتينات الريبية (RNP).

بعض الـ RNA هي إنزيمات:

تم اكتشاف مؤخرًا أن بعض RNAs تلعب دور الإنزيمات ، وتسمى الريبوزيمات ribozymes. مثل الإنزيمات النموذجية ، يحتوي الريبوزيم على موقع نشط ، وموقع ارتباط للركيزة وموقع ارتباط لعامل مساعد. تشارك الريبوزيمات بشكل رئيسي في تضفير الإنترونات الموجودة على جزيئات الحمض النووي الريبي.

رنا نووي صغير:

يقوم إنزيم RNA polymerase بنسخ العديد من RNAs الصغيرة في نواة حقيقيات النوى. هذه تسمى RNAs النووية الصغيرة (snRNA). هذه تشكل معقدًا مع بروتينات معينة وتسمى بروتينات النوى النووية الصغيرة (snRNP) والمعروفة أيضًا باسم snurps. تسمى البروتينات المرتبطة بـ snRNAs ببروتينات S.

هذه الـ sn RNAs غنية بـ اليوراسيل وهي من عدة أنواع مثل U1 و U2 و U4 و U5 و U6. يتراوح طول كل من هذه الحمض النووي الريبي بين 200-300 نيوكليوتيد. يشاركون في تضفير إنترونات المجموعة الثانية. أنها تشكل معقدا مع intron. يسمى هذا المركب spliceosome الذي يشارك في تضفير الإنترون.

تحتوي جزيئات snRNP هذه على تسلسلات RNA صغيرة مكملة لإنترونات mRNA وتشكل أزواج قاعدة RNA-RNA في مواقع لصق 5 & # 8242 و 3 & # 8242 حيث يحدث تفاعل لصق فعلي.

الحمض النووي الريبي النووي الصغير (sno RNA):

مطلوب هذا الرنا sno لمعالجة جزيئات الرنا الريباسي حقيقية النواة. ترتبط snoRNAs بالبروتينات. توجد هذه snoRNAs في النواة حيث تتم معالجة الرنا الريباسي. يتم تجميع الريبوسوم أيضًا في النواة.

تلعب العديد من الرناوات الصغيرة مثل الرنا الميكروي (ميرنا) والحمض النووي الريبي الصغير المتداخل دورها في إسكات الجينات. يتصرفون على mRNA مما يؤدي إلى تعطيل الترجمة.


يتم إنتاج الرنا المرسال عن طريق تخليق خيط من الحمض النووي الريبي (RNA) من اللبنات الأساسية للنيوكليوتيدات وفقًا لقالب الحمض النووي الريبي منقوص الأكسجين (DNA) ، وهي عملية تسمى النسخ. [2] عندما تشتمل اللبنات الأساسية المقدمة لبوليميراز الحمض النووي الريبي على نيوكليوسيدات غير قياسية مثل بسودوريدين - بدلاً من نيوكليوسيدات الأدينوزين والسيتيدين والجوانوزين واليوريدين القياسي - يوصف الرنا المرسال الناتج على أنه معدل نيوكليوسيد. [3]

يبدأ إنتاج البروتين بتجميع الريبوسومات على الرنا المرسال ، ثم يعمل هذا الأخير كمخطط لتخليق البروتينات عن طريق تحديد تسلسل الأحماض الأمينية بناءً على الكود الجيني في عملية التخليق الحيوي للبروتين المسماة الترجمة. [4]

لحث الخلايا على صنع بروتينات لا تنتجها عادة ، من الممكن إدخال mRNA غير المتجانسة في سيتوبلازم الخلية ، متجاوزًا الحاجة إلى النسخ. بعبارة أخرى ، يتم "تهريب" مخطط البروتينات الأجنبية إلى الخلايا. ومع ذلك ، لتحقيق هذا الهدف ، يجب على المرء تجاوز الأنظمة الخلوية التي تمنع اختراق وترجمة الرنا المرسال الأجنبي. هناك إنزيمات منتشرة في كل مكان تقريبًا تسمى ribonucleases (وتسمى أيضًا RNAses) تعمل على تكسير mRNA غير المحمي. [5] هناك أيضًا حواجز داخل الخلايا ضد الرنا المرسال الأجنبي ، مثل مستقبلات الجهاز المناعي الفطرية (TLR) 7 والمستقبلات TLR8 الموجودة في الأغشية الباطنية. يمكن لمستشعرات الحمض النووي الريبي مثل TLR7 و TLR8 أن تقلل بشكل كبير من تخليق البروتين في الخلية ، وتحفز إطلاق السيتوكينات مثل الإنترفيرون و TNF-alpha ، وعندما تؤدي بشكل مكثف إلى موت الخلية المبرمج. [6]

يمكن إخفاء الطبيعة الالتهابية للحمض النووي الريبي الخارجي عن طريق تعديل النيوكليوسيدات في الرنا المرسال. [7] على سبيل المثال ، يمكن استبدال اليوريدين بنكليوسيد مشابه مثل بسودوريدين (Ψ) أو N1-ميثيل-سودوريدين (m1Ψ) ، [8] ويمكن استبدال السيتوزين بـ 5-ميثيل سيتوزين. [9] بعض هذه العناصر ، مثل pseudouridine و 5-methylcytosine ، تحدث بشكل طبيعي في حقيقيات النوى. [10] تضمين هذه النيوكليوسيدات المعدلة يغير البنية الثانوية للـ mRNA ، والتي يمكن أن تقلل من التعرف على الجهاز المناعي الفطري مع السماح بالترجمة الفعالة. [9]

يبدأ مرنا العادي وينتهي بأقسام لا ترمز للأحماض الأمينية للبروتين الفعلي. تسمى هذه التسلسلات عند طرفي 5 و 3 من خيط الرنا المرسال بالمناطق غير المترجمة (UTRs). تعد UTRs الموجودة في نهاياتها ضرورية لاستقرار mRNA وأيضًا لـ modRNA وكذلك لكفاءة الترجمة ، أي لكمية البروتين المنتجة. عن طريق اختيار UTRs المناسبة أثناء تخليق modRNA ، يمكن تحسين إنتاج البروتين المستهدف في الخلايا المستهدفة. [5] [11]

يتم تضمين صعوبات مختلفة في إدخال modRNA في خلايا مستهدفة معينة. أولاً ، يجب حماية الـ modRNA من الريبونوكليازات. [5] يمكن تحقيق ذلك ، على سبيل المثال ، عن طريق لفه في الجسيمات الشحمية. يمكن أن يساعد هذا "التغليف" أيضًا في ضمان امتصاص الحمض النووي الريبي في الخلايا المستهدفة. هذا مفيد ، على سبيل المثال ، عند استخدامه في اللقاحات ، حيث يتم امتصاص الجسيمات النانوية بواسطة الخلايا المتغصنة والضامة ، وكلاهما يلعب دورًا مهمًا في تنشيط جهاز المناعة. [12]

علاوة على ذلك ، قد يكون من المرغوب فيه أن يتم إدخال الحمض النووي الريبي المطبق في خلايا الجسم المحددة. هذا هو الحال ، على سبيل المثال ، إذا تم تحفيز خلايا عضلة القلب على التكاثر. في هذه الحالة ، يمكن حقن الـ modRNA المعبأ مباشرةً في الشريان مثل الشريان التاجي. [13]

تعد لقاحات mRNA أحد المجالات المهمة للتطبيق ، والتي كان أول من أذن باستخدامها في البشر لقاحات COVID-19 لمعالجة SARS-CoV-2. [14] [15] [16] [17] [18] [19] [20] تتضمن أمثلة لقاحات COVID-19 باستخدام modRNA تلك التي طورتها BioNTech / Pfizer / Fosun International (BNT162b2) ، و Moderna ( مرنا -1273). [21] [22] [23] إن زوريسيميران لقاح طوره Curevac ، ومع ذلك ، يستخدم RNA غير معدل. [24]

تشمل الاستخدامات المحتملة الأخرى للـ modRNA تجديد نسيج عضلة القلب التالف [25] [26] وعلاج السرطان. [27] [28]


يكشف تسلسل NMD المتحلل عن وسيطة مرتبطة بالريبوسوم مع نيوكليوتيدات غير مقولبة 3'-end

يتحكم اضمحلال الحمض النووي الريبي المرسال (NMD) غير المعقول (NMD) في جودة الرنا المرسال ويحلل mRNA الفسيولوجي لضبط التعبير الجيني في تغيير البيئة التنموية أو البيئية. تتطلب NMD إزالة أهدافها من مجموعة ترجمة mRNAs. نظرًا لأن خطوات الاضمحلال للثدييات NMD لا تزال غير معروفة ، فقد طورنا فحوصات لعزل وتسلسل وسيطة تسوس NMD المباشر على نطاق واسع استنادًا إلى التكاثر المناعي المشترك مع UPF1 الفسفوري ، وهو الشكل النشط لعامل NMD الأساسي هذا. نوضح أنه ، على عكس الحالة المستقرة UPF1 ، فإن UPF1 الفسفوري يربط في الغالب تسوس mRNA المميت وينشط NMD بشكل تعاوني من 5'- و 3'- نهايات.نحن نستفيد من تعديلات الطريقة لوصف النهايات الثلاثية لوسائط اضمحلال NMD ، ونوضح أنها مرتبطة بالريبوسوم ، ونكشف أن بعضها يخضع لإضافة نيوكليوتيدات غير مقولبة. تتم إضافة اليوريدينات بواسطة TUT4 و TUT7 ترانسزيمات uridylyl الطرفي وإزالتها بواسطة نوكلياز خارجي مرتبط بمتلازمة بيرلمان DIS3L2. يبدو أن إضافة النيوكليوتيدات الأخرى غير النموذجية تمنع التحلل.


علم الأحياء 171

بنهاية هذا القسم ، ستكون قادرًا على القيام بما يلي:

  • وصف الخطوات المختلفة في معالجة الحمض النووي الريبي
  • افهم أهمية exons و introns و splicing لـ mRNAs
  • اشرح كيف تتم معالجة الحمض الريبي النووي النقال والـ rRNAs

بعد النسخ ، يجب أن تخضع جزيئات الرنا المرسال الأولية حقيقية النواة لعدة خطوات معالجة قبل أن تتم ترجمتها. تخضع أيضًا جزيئات الحمض النووي الريبي حقيقية النواة (وبدائية النواة) والـ rRNAs للمعالجة قبل أن تتمكن من العمل كمكونات في آلية تخليق البروتين.

معالجة مرنا

يخضع حقيقيات النوى pre-mRNA لمعالجة مكثفة قبل أن يصبح جاهزًا للترجمة. تسلسلات ترميز البروتين حقيقية النواة ليست مستمرة ، كما هو الحال في بدائيات النوى. يتم مقاطعة تسلسلات الترميز (exons) بواسطة إنترونات غير مشفرة ، والتي يجب إزالتها لإنشاء مرنا قابل للترجمة. الخطوات الإضافية التي ينطوي عليها نضج mRNA حقيقية النواة تخلق أيضًا جزيءًا له نصف عمر أطول بكثير من mRNA بدائية النواة. تستمر mRNAs حقيقية النواة لعدة ساعات ، في حين أن النموذج المعتاد بكتريا قولونية لا تدوم mRNA أكثر من خمس ثوان.

يتم طلاء Pre-mRNAs أولاً ببروتينات RNA التي تعمل على تثبيت الحمض النووي الريبي ، وهي تحمي ما قبل mRNA من التدهور أثناء معالجتها وتصديرها من النواة. أهم ثلاث خطوات للمعالجة السابقة للـ mRNA هي إضافة عوامل التثبيت والإشارة في طرفي الجزيء 5 & # 8242 و 3 & # 8242 ، وإزالة الإنترونات ((الشكل)). في حالات نادرة ، يمكن "تحرير" نسخة mRNA بعد نسخها.


المثقبيات هي مجموعة من البروتوزوا التي تشمل العامل الممرض المثقبية البروسية، الذي يسبب مرض الناغانا في الماشية ومرض النوم لدى البشر في جميع أنحاء مناطق شاسعة من أفريقيا ((الشكل)). ينتقل المثقبيات عن طريق الذباب القضم في الجنس جلوسينا (تسمى عادة ذباب تسي تسي). تحتوي المثقبيات ، وجميع حقيقيات النوى تقريبًا ، على عضيات تسمى الميتوكوندريا تزود الخلية بالطاقة الكيميائية. الميتوكوندريا هي عضيات تعبر عن الحمض النووي الخاص بها ويعتقد أنها بقايا علاقة تكافلية بين حقيقيات النوى وبدائيات النوى المبتلعة. يُظهر الحمض النووي للميتوكوندريا في المثقبيات استثناءً مثيرًا للاهتمام للعقيدة المركزية: لا تمتلك ما قبل mRNAs المعلومات الصحيحة لتحديد بروتين وظيفي. عادة ، هذا لأن mRNA يفتقد العديد من نيوكليوتيدات U. تنفذ الخلية خطوة معالجة إضافية لـ RNA تسمى تحرير RNA لعلاج ذلك.


تقوم الجينات الأخرى في جينوم الميتوكوندريا بترميز 40- إلى 80 نيوكليوتيد دليل RNAs. يتفاعل واحد أو أكثر من هذه الجزيئات عن طريق الاقتران الأساسي التكميلي مع بعض النيوكليوتيدات في نسخة ما قبل الرنا المرسال. ومع ذلك ، فإن دليل RNA يحتوي على نيوكليوتيدات A أكثر من pre-mRNA يحتوي على نيوكليوتيدات U يمكن الارتباط بها. في هذه المناطق ، ينطلق دليل الحمض النووي الريبي (RNA). النهايات 3 & # 8242 من RNAs الدليل لها ذيل طويل poly-U ، ويتم إدخال قواعد U هذه في مناطق نسخة ما قبل mRNA حيث يتم حلقة دليل RNAs. تتم هذه العملية بالكامل بواسطة جزيئات الحمض النووي الريبي. وهذا يعني أن RNAs التوجيهية - وليس البروتينات - تعمل كمحفزات في تحرير RNA.

تحرير الحمض النووي الريبي ليس مجرد ظاهرة من المثقبيات. في الميتوكوندريا لبعض النباتات ، يتم تحرير جميع ما قبل mRNAs تقريبًا. تم تحديد تعديل الحمض النووي الريبي أيضًا في الثدييات مثل الجرذان والأرانب وحتى البشر. ماذا يمكن أن يكون السبب التطوري لهذه الخطوة الإضافية في معالجة ما قبل الرنا المرسال؟ أحد الاحتمالات هو أن الميتوكوندريا ، كونها بقايا بدائيات النوى القديمة ، لديها طريقة قديمة قائمة على الحمض النووي الريبي لتنظيم التعبير الجيني. لدعم هذه الفرضية ، تختلف التعديلات التي تم إجراؤها على ما قبل الرنا المرسال اعتمادًا على الظروف الخلوية. على الرغم من التخمين ، فإن عملية تحرير الحمض النووي الريبي (RNA) قد تكون معلقة من وقت بدائي عندما كانت جزيئات الحمض النووي الريبي ، بدلاً من البروتينات ، مسؤولة عن تحفيز التفاعلات.

5 & ​​# 8242 السد

بينما لا يزال يتم تصنيع ما قبل mRNA ، تتم إضافة غطاء 7-methylguanosine إلى 5 & # 8242 نهاية النسخة المتزايدة من خلال ارتباط الفوسفات. هذه المجموعة الوظيفية تحمي mRNA الوليدة من التدهور. بالإضافة إلى ذلك ، تتعرف العوامل المشاركة في تخليق البروتين على الغطاء للمساعدة في بدء الترجمة بواسطة الريبوسومات.

3 & # 8242 Poly-A Tail

بمجرد اكتمال الاستطالة ، يتم شق ما قبل الرنا المرسال بواسطة نوكلياز داخلي بين تسلسل إجماع AAUAAA وتسلسل غني بـ GU ، تاركًا تسلسل AAUAAA على pre-mRNA. ثم يضيف إنزيم يسمى بوليميراز بولي- A سلسلة من حوالي 200 بقايا أ ، تسمى ذيل بولي- أ. يحمي هذا التعديل أيضًا pre-mRNA من التدهور وهو أيضًا موقع الارتباط لبروتين ضروري لتصدير mRNA المعالج إلى السيتوبلازم.

الربط قبل mRNA

تتكون جينات حقيقيات النوى من exons ، والتي تتوافق مع تسلسلات ترميز البروتين (السابق-على يدل على أنهم كذلك السابقضغط) و intمتواليات ervening تسمى introns (int-ron يدل على intدور ervening) ، والذي قد يكون متورطًا في تنظيم الجينات ولكن يتم إزالته من pre-mRNA أثناء المعالجة. لا تقوم تسلسلات Intron في mRNA بتشفير البروتينات الوظيفية.

جاء اكتشاف الإنترونات بمثابة مفاجأة للباحثين في السبعينيات الذين توقعوا أن تحدد ما قبل الرنا المرسال تسلسلات البروتين دون مزيد من المعالجة ، كما لاحظوا في بدائيات النوى. غالبًا ما تحتوي جينات حقيقيات النوى الأعلى على واحد أو أكثر من الإنترونات. قد تتوافق هذه المناطق مع التسلسلات التنظيمية ، ومع ذلك ، فإن الأهمية البيولوجية لوجود العديد من الإنترونات أو وجود إنترونات طويلة جدًا في الجين غير واضح. من الممكن أن تبطئ الإنترونات التعبير الجيني لأنها تستغرق وقتًا أطول لنسخ ما قبل الرنا المرسال مع الكثير من الإنترونات. بدلاً من ذلك ، قد تكون الإنترونات عبارة عن بقايا متوالية غير وظيفية متبقية من اندماج الجينات القديمة طوال مسار التطور. هذا مدعوم بحقيقة أن exons المنفصلة غالبًا ما تشفر وحدات فرعية أو مجالات بروتينية منفصلة. بالنسبة للجزء الأكبر ، يمكن أن تتغير تسلسلات الإنترونات دون التأثير في النهاية على منتج البروتين.

يجب إزالة جميع إنترونات ما قبل الرنا المرسال بشكل كامل ودقيق قبل تخليق البروتين. إذا أخطأت العملية حتى بواسطة نيوكليوتيد واحد ، فإن إطار القراءة للإكسونات الملتصقة سوف يتحول ، والبروتين الناتج سيكون غير فعال. تسمى عملية إزالة الإنترونات وإعادة توصيل الإكسونات بالربط ((الشكل)). تتم إزالة الإنترونات وتتحلل بينما لا يزال الحمض النووي الريبي pre-mRNA في النواة. يحدث التضفير بواسطة آلية خاصة بالتسلسل تضمن إزالة الإنترونات وإعادة ربط الإكسونات بدقة ودقة نوكليوتيد واحد. على الرغم من أن intron نفسه غير مشفر ، فإن بداية ونهاية كل intron يتم تمييزهما بنوكليوتيدات محددة: GU في نهاية 5 & # 8242 و AG في نهاية الإنترون 3 & # 8242. يتم إجراء تضفير ما قبل mRNAs بواسطة مجمعات من البروتينات وجزيئات RNA تسمى spliceosomes.


الأخطاء في التضفير متورطة في السرطانات والأمراض البشرية الأخرى. ما أنواع الطفرات التي قد تؤدي إلى أخطاء التضفير؟ فكر في النتائج المحتملة المختلفة في حالة حدوث أخطاء الربط.

لاحظ أن أكثر من 70 من الإنترونات الفردية يمكن أن تكون موجودة ، ويجب أن يخضع كل منها لعملية التضفير - بالإضافة إلى السد رقم 5 & # 8242 وإضافة ذيل poly-A - فقط لتوليد جزيء mRNA واحد قابل للترجمة.

اعرض RNA Splicing (فيديو) لترى كيف تتم إزالة الإنترونات أثناء الربط RNA.

معالجة الرنا الريباسي و الرنا الريباسي

إن الحمض النووي الريبي (tRNA) والـ rRNA عبارة عن جزيئات هيكلية لها دور في تخليق البروتين ، ومع ذلك ، فإن هذه الحمض النووي الريبي لا تتم ترجمتها بنفسها. يتم نسخ ما قبل الرنا الريباسي ومعالجته وتجميعه في ريبوسومات في النواة. يتم نسخ ما قبل الحمض النووي الريبي ومعالجتها في النواة ثم يتم إطلاقها في السيتوبلازم حيث يتم ربطها بالأحماض الأمينية الحرة لتخليق البروتين.

يتم نسخ معظم الحمض النووي الريبي (tRNAs) والـ rRNAs في حقيقيات النوى وبدائيات النوى أولاً كجزيء سلائف طويل يمتد على العديد من الرناوات أو الرناوات. ثم تشق الإنزيمات السلائف في وحدات فرعية تتوافق مع كل RNA هيكلي. بعض قواعد ما قبل الرنا الريباسي هي مميثل وهذا هو ، –CH3 تمت إضافة مجموعة الميثيل الوظيفية من أجل الاستقرار. تخضع جزيئات ما قبل الحمض النووي الريبي أيضًا لميثلة. كما هو الحال مع ما قبل mRNAs ، يحدث استئصال الوحدة الفرعية في حقيقيات النوى ما قبل الحمض النووي الريبي المقدر أن تصبح tRNAs أو rRNAs.

تشكل الرنا الريباسي الناضج حوالي 50 بالمائة من كل ريبوسوم. بعض جزيئات الحمض النووي الريبي للريبوسوم هيكلية بحتة ، في حين أن البعض الآخر له أنشطة تحفيزية أو ربط. تأخذ الحمض النووي الريبي الناضج بنية ثلاثية الأبعاد من خلال مناطق محلية من الاقتران الأساسي المستقر بواسطة رابطة هيدروجين داخل الجزيئية. يتم طي الحمض النووي الريبي (tRNA) لوضع موقع ارتباط الأحماض الأمينية في أحد طرفيه والمضاد في الطرف الآخر ((الشكل)). المضاد هو تسلسل ثلاثي النوكليوتيدات في الحمض الريبي النووي النقال الذي يتفاعل مع كودون الرنا المرسال من خلال الاقتران الأساسي التكميلي.


ملخص القسم

يتم تعديل حقيقيات النوى pre-mRNAs بغطاء 5 & # 8242 methylguanosine وذيل poly-A. تحمي هذه الهياكل الرنا المرسال الناضج من التدهور وتساعد على تصديره من النواة. تخضع أيضًا جزيئات الرنا المرسال السابقة لعملية التضفير ، حيث تتم إزالة الإنترونات وإعادة توصيل الإكسونات بدقة أحادية النوكليوتيدات. يتم تصدير mRNAs النهائية فقط التي خضعت لسد 5 & # 8242 ، و 3 & # 8242 polyadenylation ، و intron splicing من النواة إلى السيتوبلازم. يمكن معالجة ما قبل الرنا الريباسي وما قبل الرنا الريباسي عن طريق الانقسام الجزيئي ، والتضفير ، والمثيلة ، والتحويل الكيميائي للنيوكليوتيدات. نادرًا ما يتم إجراء تحرير RNA لإدراج القواعد المفقودة بعد تصنيع mRNA.

اتصالات فنية

(الشكل) الأخطاء في التضفير متورطة في السرطانات والأمراض البشرية الأخرى. ما أنواع الطفرات التي قد تؤدي إلى أخطاء التضفير؟ فكر في النتائج المحتملة المختلفة في حالة حدوث أخطاء الربط.

(الشكل) الطفرات في تسلسل التعرف على الجسيمات في نهاية كل من الإنترون ، أو في البروتينات والحمض النووي الريبي التي تشكل الجسيم الوريدي ، قد تضعف التضفير. قد تضيف الطفرات أيضًا مواقع جديدة للتعرف على الجسيمات. يمكن أن تؤدي أخطاء الربط إلى الإبقاء على الإنترونات في RNA المقسم ، أو استئصال exons ، أو تغييرات في موقع موقع لصق.

إستجابة مجانية

غالبًا ما يؤوي مرضى سرطان الدم الليمفاوي المزمن طفرات غير منطقية في آلية التضفير. صف كيف ستغير هذه الطفرة في الجسيم لصق الموقع النهائي وتسلسل ما قبل الرنا المرسال.

من شأن الطفرات الجبرية غير المنطقية أن تقضي على خطوة التضفير في معالجة الرنا المرسال ، لذا فإن الرنا المرسال الناضج سيحتفظ بإنتروناته ويكون مكملاً تمامًا لتسلسل قالب الحمض النووي بأكمله. ومع ذلك ، فإن الرنا المرسال ستظل تخضع لإضافة غطاء 5 'وذيل بولي أ ، وبالتالي فإن كل منها لديه القدرة على تصديرها إلى السيتوبلازم للترجمة.

قائمة المصطلحات


12.2: تعديلات على طرفي 5 'و 3' من mRNA - علم الأحياء

تم تحديد أكثر من 100 نوع من التعديلات الكيميائية في الحمض النووي الريبي الخلوي. في حين أن تعديل 5-cap وذيل poly (A) من mRNA حقيقي النواة يلعبان أدوارًا رئيسية في التنظيم ، فإن التعديلات الداخلية تكتسب الانتباه لأدوارها في استقلاب mRNA. تعديل mRNA الداخلي الأكثر وفرة هو ن 6-ميثيلادينوزين (م 6 أ) ، وتحديد البروتينات التي تثبِّت هذه العلامات ، وتتعرف عليها ، وتزيلها ، قد كشفت عن أدوار لتعديل الرنا المرسال في كل جانب تقريبًا من جوانب دورة حياة الرنا المرسال ، وكذلك في مختلف الخلوية والنمائية ، و عمليات المرض. يتم أيضًا تعديل كميات وفيرة من الحمض النووي الريبي غير المشفر مثل الحمض النووي الريبي ، والـ rRNAs ، والـ RNAs المتصلبة بشكل كبير وتعتمد على التعديلات لتكوينها الحيوي ووظيفتها. بدأ فهمنا للمساهمات البيولوجية لهذه التعديلات الكيميائية المختلفة في التبلور ، ولكن من الواضح أنه في كل من RNAs المشفرة وغير المشفرة ، تمثل التعديلات الديناميكية طبقة جديدة من التحكم في المعلومات الجينية.


الإنزيم المعقد لفك الرنا المرسال: إنزيمات من أربع فئات تشق روابط بيروفوسفات

يتم تعديل الأطراف الخمسة لمعظم RNAs كيميائيًا لتمكين الحماية من نوكليازات. في البكتيريا ، يتم تحقيق ذلك غالبًا عن طريق الحفاظ على نهاية ثلاثي الفوسفات الذي نشأ من بدء النسخ ، في حين أن معظم mRNAs حقيقية النواة و RNAs النووية الصغيرة لها غطاء 5 '→ 5' مرتبط بـ N 7 -methyl guanosine (m 7 G) مضاف. تم وصف العديد من التعديلات الكيميائية الأخرى في نهايات RNA 5. من الشائع لجميع التعديلات وجود رابطة بيروفوسفات واحدة على الأقل. لتمكين دوران الحمض النووي الريبي ، يجب أن تكون هذه التعديلات الكيميائية في نهاية RNA 5 قابلة للعكس. اعتمادًا على اتجاه مسار اضمحلال الحمض النووي الريبي (5 '→ 3' أو 3 '→ 5') ، تشق بعض الإنزيمات رابط الغطاء 5 '→ 5' من RNAs السليمة لبدء التحلل ، بينما يعمل البعض الآخر كزاحلين ويحلل الغطاء بالماء عنصر من بقايا مسار الانحلال 3 '→ 5'. في حقيقيات النوى ، هناك أيضًا مسار لمراقبة جودة الغطاء. معظم الإنزيمات المشاركة في انشقاق نهايات RNA 5 هي بيروفوسفوهيدرولازات ، مع وجود عدد قليل منها (إضافي) 5 أنشطة هيدروليز ثلاثي الفوسفونوكليوتيد. على الرغم من هوية أنشطتها الإنزيمية ، تنتمي الإنزيمات إلى أربع فئات مختلفة من الإنزيمات. تقوم Nudix hydrolase بفصل الحمض النووي الريبي السليم كجزء من مسار الانحلال 5 '→ 3' ، وأفراد عائلة DXO يتحللون بشكل أساسي من الحمض النووي الريبي المعيب ، وأعضاء عائلة الهيستيدين (HIT) عبارة عن بروتينات كاسحة ، في حين أن الفوسفاتاز الشبيه بـ ApaH هو إنزيم تحلل الرنا المرسال الرئيسي من المثقبيات ، التي تمتلك الحمض النووي الريبي (RNAs) الخاصة بها بنية غطاء فريدة. تم اكتشاف العديد من الهياكل الجديدة للغطاء والإنزيمات المقطوعة مؤخرًا فقط ، مما يشير إلى أننا بدأنا للتو في فهم آليات فصل الحمض النووي الريبي. تم تصنيف هذه المقالة تحت: RNA Turnover and Surveillance & GT Turnover / Surveillance آليات دوران الحمض النووي الريبي (RNA) والمراقبة وتنظيم gt لاستقرار الحمض النووي الريبي (RNA) وتغطية gt و 5 تعديلات نهائية.

الكلمات الدالة: بروتينات ApaH HIT تقطع عقدة المثقبيات.


شاهد الفيديو: تضاعف DNA ونسخ وترجمة RNA. الأحياء. الجزيئات الضخمة (ديسمبر 2022).