معلومة

ما هو cognate miRNA؟

ما هو cognate miRNA؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أفهم ما هي ميرنا ، لكني لست متأكدًا مما يعنيه المتشابه. بالنظر إلى هذا المنشور ، يبدو أن mRNA المتشابه هو ملف معروف miRNA مقابل miRNA المكتشف / المحتمل مؤخرًا. هل هذا التفكير على الطريق الصحيح؟


استخدام الكلمة مماثل في علم الأحياء الجزيئي يعكس تعريف الصفة 2 من المعجم:

2 رسمي متعلق ب؛ متصل.
"مواضيع مشابهة مثل الفيزياء والكيمياء"

يوضح المثال المعطى أنه يمكن استخدام هذا بالمعنى الأكثر عمومية ذات صلة، بحيث لا يوجد شرط لبعض السوابق المشتركة كبديل لأم بشرية أو سلف.

على وجه التحديد هناك لا الآثار المترتبة على تورط تسلسل الحمض النووي المشترك ، كما هو الحال في الإجابة منDireful ، ولا ذلك من الأصل المشترك كما تم استدعاؤه في إجابة سابقة حول هذا الموضوع.

هذا واضح تمامًا إذا أخذ المرء في الاعتبار الاستخدام المبكر لـ مماثل في البيولوجيا الجزيئية فيما يتعلق بكودون mRNA ومضادات الكودونات tRNA التي يمكنها التعرف عليه ، أو tRNA و aminoacyl tRNA synthetase الذي يمكنه aminoacylate.

بقدر الاستخدام مع ميكرو آر إن إيه تشعر بالقلق، الرنا المرسال المتشابه هو الذي يمكن أن تتفاعل معه ميرنا عن طريق الاقتران الأساسي - لا أكثر ولا أقل.


MicroRNAs

3 التنظيم الجيني ، والتباين في MicroRNAs ، والتعبير الخاص بالأنسجة من MicroRNAs

تخضع الـ MicroRNAs (miRNAs) لأحداث معالجة متعددة للوصول إلى تسلسل الحمض الريبي النووي الريبي وظيفي 21-23. يتم إنشاء miRNAs الكنسي من وحدات نسخ ترميز البروتين بينما يتم إنشاء miRNAs الأخرى (أي miRNAs غير الكنسي) من وحدات النسخ غير المشفرة للبروتين. في كلتا الحالتين ، يمكن أن توجد الجزيئات الدقيقة إما داخل مناطق intronic أو exonic. إن التمييز الميكانيكي الجدير بالملاحظة في miRNAs الكنسي مقابل noncanonical هو أن miRNAs intronic الكنسي تعتمد على Drosha وبالتالي تتم معالجتها بطريقة النسخ المتماثل باستخدام نصوص ترميز البروتين في النواة. ثم يدخل premiRNA إلى مسار miRNA ، في حين يخضع باقي النص لعملية تضفير premRNA لإنتاج mRNA ناضج والذي سيوجه بعد ذلك تخليق البروتين. يمكن أن تشتق RNAs الصغيرة غير الكنسي (وتسمى أيضًا mirtrons) من الإنترونات الصغيرة التي تشبه premiRNAs ، وتتجاوز خطوة معالجة Drosha [11]. تميل miRNAs إلى التنظيم في مجموعة ذات صلة وتميل أيضًا إلى استهداف نسخ mRNA المتعددة داخل مسارات الاستجابة الخلوية الشائعة (على سبيل المثال ، الانتشار ، موت الخلايا المبرمج). يوفر هذا الموضوع التنظيمي لمجموعات mi القدرة على تنسيق التنظيم لخطوات متعددة داخل المسار ، مما يوفر فرصة للتحكم التنظيمي المعقد والتكيفي في المسارات بأكملها. فئة مثيرة للاهتمام من miRNAs هي myomiRs - يطلق عليها لأنها مشفرة داخل جينات الميوسين الثقيلة السلسلة (MYH). يتم نسخ myomiRs في نفس السلائف mRNA مثل جين MYH الأبوي [4]. وتجدر الإشارة بشكل خاص إلى myomiR-499 ، والذي على الرغم من عدم وجود الرنا المرسال الرئيسي ، يعد واحدًا من أكثر جزيئات الحمض النووي الريبي (miRNAs) التي يتم التعبير عنها بشكل كبير في أنسجة القلب. في ظاهرة تطورية جديدة على ما يبدو ، يفصل التضفير البديل في القلب إنتاج miR-499 الناضج من التعبير عن الأم MYH7b mRNA ، مما يعني أن mRNA ربما تطور إلى مضيف غير وظيفي mRNA بسبب miR (أي miR-499).

حددت الدراسات المقارنة التي تقيم الهيكل التنظيمي لجينوم الثدييات ثروة من عمليات الإدراج والحذف الكروموسومية ، ومتغيرات رقم النسخ ، وتعدد أشكال النوكليوتيدات المفردة (SNPs) التي ، اعتمادًا على السياق البيئي ، تساهم في التباين الجيني الذي يمكن أن يقوم عليه التنوع الظاهري. هذا التنوع واضح في كل جانب من جوانب صحة الإنسان والأمراض التي تم التحقيق فيها تقريبًا. ربما ليس من المستغرب أن يوجد الآن اعتراف متزايد بأن الاختلاف في miRNAs وجيناتها المستهدفة تساهم أيضًا في هذا التباين الظاهري. يمكن ربط العديد من الأورام الخبيثة الصلبة والدمية بـ miRNAs الموجودة في مناطق الكروموسومات المتضخمة أو المحذوفة أو المنقولة في جينوم الثدييات [12]. من المحتمل أن يتأثر التباين في التعبير الجيني والتنظيم بالمتغيرات الجينية في رابطة الدول المستقلة- و عبر- فاعل النيوكلوتايد (المعروف أيضًا باسم التعبير الكمي موضع السمات) [13]. ملاحظة مثيرة للاهتمام لربط ميرنا هي قدرتها على التعرف على تعدد أشكال موقع الربط (miRSNPs) في الجينات الوظيفية المنسوخة. على سبيل المثال ، يبدو أن مير -24 قد تم تحريره في ورم القولون والمستقيم البشري من خلال تعدد الأشكال في الموقع المستهدف في جين اختزال ثنائي هيدروفولات. في مثال آخر ، تعدد الأشكال داخل جين الميوستاتين يخلق موقعًا مستهدفًا لـ miR-1 و miR-206 ، والتي يتم التعبير عنها بشكل كبير في العضلات الهيكلية. يؤدي ارتباط هذه miRs إلى تعدد الأشكال في myostatin إلى تثبيط انتقالي لنصوص الميوستاتين ويمكن أن يُظهر تضخم العضلات الملحوظ مع الضربات القاضية الجينية لجين الميوستاتين [14]. نظرًا للاختلافات الكبيرة في التعبير الجيني والتنوع الجيني عبر السكان البشريين ، من المرجح أن يوفر تحليل دور miRNAs في المساهمة في الاختلافات السكانية في التعبير الجيني رؤى جوهرية في التباينات الصحية القائمة على السكان والوظائف الجسدية [13]. في الواقع ، تشير الدراسات الجينومية المقارنة إلى أن متواليات الرنا المرسال المستهدفة لـ miRNAs: المناطق غير المترجمة (UTRs) على الرنا المرسال غالبًا ما تعرض تنوع التسلسل. قد يشير هذا إلى تطور تكيفي لـ miRNAs المتعايش معها و mRNAs المتشابه مع هذه المتغيرات UTR. اعتمادًا على ما إذا كان التخميد الناتج عن البروتين مفيدًا أم غير منطقي أم ضارًا ، يمكن الحفاظ على مواقع UTR بشكل انتقائي أو محايدة أو تجنبها أثناء التطور المشترك لـ miRNA: mRNA [1].

توضح الدراسات التي تقيم التعبير الخاص بالأنسجة عن الجزيئات الدقيقة ميزة "التنظيم المتقاطع" للـ miRNAs التي تساهم في تحديد مصير الخلية عن طريق قمع مصائر الخلايا البديلة لتسهيل الالتزام بمصير خلية واحدة وللحفاظ على استقرار النمط الظاهري المتمايز [15]. على سبيل المثال ، يتم إثراء myomiRs miR-1 و miR-133 و miR-206 و miR-208 و miR-486 و miR-499 في العضلات الهيكلية وتلعب أدوارًا مهمة في تطوير العضلات الهيكلية ونموها وصيانتها. ]. والجدير بالذكر أن miR-133 يمنع تمايز سلالة الخلايا العظمية عن طريق قمع Runx2 ، وهو عامل أساسي لتكوين العظام [15]. يتم التعبير عن MiR-7 و miR-24 و miR-128 و miR-134 و miR-219 وغيرها بشكل كبير في دماغ الثدييات وتنظيم نمو العصبونات والتمايز العصبي وحجم العمود الفقري المتشقق [17]. يمكن أن تؤدي miRNAs المخصبة إقليمياً في أنسجة معينة وظيفة متخصصة. على سبيل المثال ، يتم التعبير عن miR-7 و miR-24 بشكل كبير في منطقة ما تحت المهاد وضبط التعبير الدقيق عن Fos والأوكسيتوسين اللذان يلعبان أدوارًا حيوية في التحكم في الماء والرضاعة والولادة [18].


التكوين الحيوي المعتمد على الهدف للرنا الميكروي المتشابه في الخلايا البشرية

أثبتت الأبحاث المكثفة كيف تنظم miRNAs mRNAs المستهدفة عن طريق قمع الترجمة و / أو تدهور حال النواة في metazoans. ومع ذلك ، فإن المعلومات المتعلقة بتأثير mRNA الهدف على التولد الحيوي واستقرار miRNAs المقابلة في الحيوانات محدودة. نحن هنا نبلغ عن التكوين الحيوي المنظم للـ miRNAs المتعارف عليه بواسطة mRNAs المستهدفة. تساهم المعالجة المحسّنة قبل ميرنا بواسطة DICER1 المرتبط بـ AGO في زيادة تشكيل miRNP. يتم تحميل miRNAs المعالج على AGO2 لتشكيل miRISCs ذات كفاءة وظيفية في كل من الجسم الحي وأيضًا في نظام في المختبر خالٍ من الخلايا. وبالتالي ، نحدد طبقة إضافية من التنظيم بعد النسخ التي تساعد الخلية على الحفاظ على المستويات المطلوبة من الأشكال الناضجة من الجزيئات الدقيقة ذات الصلة عن طريق تعديل معالجتها بطريقة تعتمد على الهدف ، وهي عملية تحدث لـ miR-122 أثناء انعكاس الإجهاد في الخلايا الكبدية البشرية.

بيان تضارب المصالح

الكتاب تعلن أي تضارب في المصالح.

الأرقام

الشكل 1. عكس الإجهاد الناجم عن تجويع الأحماض الأمينية ...

الشكل 1. عكس الإجهاد الناجم عن تجويع الأحماض الأمينية يزيد من التكوين الحيوي miR-122 في خلايا Huh7.

الشكل 2. الزيادة المستهدفة المعتمدة على الرنا المرسال للنضج ...

الشكل 2. الهدف زيادة تعتمد على mRNA من ناضجة miR-122 في الخلايا البشرية.

الشكل 3. تأثير تركيز الرنا المرسال المستهدف ...

الشكل 3. تأثير تركيز مرنا الهدف على زيادة ميرنا التي تعتمد على الركيزة في الخلايا البشرية.

الشكل 4. محركات mRNA المستهدفة تؤدي إلى زيادة التولد الحيوي ...

الشكل 4 الشكل 4. محركات مرنا المستهدفة زيادة التولد الحيوي لميرنا ناضجة من قبل ميرنا.

الشكل 5. زيادة نشاط DICER1 المرتبط بـ AGO2 ...

الشكل 5. زيادة نشاط DICER1 المرتبط بـ AGO2 يساهم في إنتاج ميرنا المستهدف الذي يحركه mRNA.

الشكل 6. زيادة إنتاجية DICER1 المرتبط بـ AGO2 ...

الشكل 6. زيادة إنتاجية DICER1 المرتبطة بـ AGO2 في وجود مرنا الهدف.


الاتجاهات في تطوير أدوات المعلوماتية الحيوية ميرنا

MicroRNAs (miRNAs) عبارة عن جزيئات RNA صغيرة غير مشفرة تنظم التعبير الجيني عن طريق التعرف على التسلسلات المتشابهة والتدخل في العمليات النسخية أو الانتقالية أو اللاجينية. تتضمن أدوات المعلوماتية الحيوية التي تم تطويرها لدراسة miRNA تلك الخاصة بالتنبؤ واكتشاف الحمض الريبي النووي النقال ، والهيكل ، والتحليل ، والتنبؤ بالهدف. قمنا يدويًا برعاية 95 ورقة مراجعة و 1000 من أدوات المعلوماتية الحيوية miRNA المنشورة منذ عام 2003. قمنا بتصنيفها وتصنيفها بناءً على رقم الاقتباس أو درجة PageRank ، ثم أجرينا تحليل الشبكة واستخراج النص (TM) لدراسة اتجاهات تطوير أدوات miRNA. لوحظت خمسة اتجاهات رئيسية: (1) كان تحديد ميرنا والتنبؤ بالهدف من النقاط الساخنة في العقد الماضي (2) المعالجة اليدوية و TM هي الطرق الرئيسية لجمع معرفة ميرنا من الأدبيات (3) يتم صيانة معظم الأدوات المبكرة بشكل جيد وعلى نطاق واسع تستخدم (4) أساليب التعلم الآلي الكلاسيكية التي تحتفظ بفائدتها ، ومع ذلك ، فقد بدأت أساليب جديدة في الظهور (5) تظهر أدوات ميرنا المرتبطة بالأمراض. ينتج عن تحليلنا رؤية ثاقبة للتطورات السابقة والتوجهات المستقبلية لأدوات miRNA.

الكلمات الدالة: أدوات المعلوماتية الحيوية الببليومترية تعدين نص ترتيب ميرنا.

© المؤلف (المؤلفون) 2018. تم النشر بواسطة مطبعة جامعة أكسفورد.

الأرقام

التكاثر الحيوي ميرنا للحيوان / النبات و ...

التكاثر الحيوي ميرنا للأدوات الحيوانية / النباتية والمعلوماتية الحيوية المرتبطة بكل عملية. الكنسي ...

الخط الزمني التاريخي لميرنا ...

الخط الزمني التاريخي لبحوث ميرنا. تطوير الجوانب التجريبية والحاسوبية ...

سير عمل تحليل ميرنا القياسي و ...

سير عمل تحليل ميرنا المعياري وأمثلة على الأدوات المرتبطة. اللوحة اليمنى مع ...

رسم دائري لتعريف ميرنا ...

رسم دائري لتعريف ميرنا وتوقع هدف ميرنا المذكور في المراجعات منذ ...

إحصائية أدوات ميرنا. خط…

إحصائية أدوات ميرنا. مخطط خطي: ​​عدد منشورات المعلوماتية الحيوية المتعلقة بـ ncRNA ...

العلامات الإحصائية لأدوات ميرنا ...

إحصائيات العلامات لأدوات miRNA استنادًا إلى miRToolsGallery. الخريطة الحرارية لأهم العلامات ...

سحابة الكلمات على أساس الأدب ...

سحابة الكلمات على أساس الأدب في كل عام. تم إنشاء سحابة الكلمات ...

شبكة تفاعل أدوات ncRNA. ال…

شبكة تفاعل أدوات ncRNA. الشبكة اليسرى تعتمد على نشر الأداة ...


مناقشة

RIP و mRNPs

استخدمنا RIP بالاقتران مع NanoString أو التسلسل عالي الإنتاجية لفحص mRNPs الذاتية. تتمثل إحدى مزايا هذا النهج في أنه يسمح بالتحقيق في mRNAs والبروتينات المرتبطة بـ RNA التي يتم التعبير عنها من مواقعها الداخلية ، وبذلك يتجنب الإفراط في التعبير عن إما mRNA أو مكونات البروتين في mRNPs. يمكن أن يؤدي الإفراط في التعبير إلى ارتباط زائف ، وبالتالي ، تعريف غير صحيح كمي ونوعي لمكونات mRNP بالنسبة للحالة الذاتية في الخلايا [75].

على الرغم من هذه المزايا ، يشتمل بروتوكول RIP على حضانة وغسيل في المختبر قد يزعج الإشغال الأصلي لبعض بروتينات ربط الحمض النووي الريبي. على الرغم من أننا قمنا بتعديل البروتوكول لتقليل مدة الحضانة في المختبر ، لأننا لم نتمكن من القضاء عليها تمامًا ، فإن النتائج التي أبلغنا عنها هي للتفاعلات التي كانت مستقرة بدرجة كافية للبقاء على قيد الحياة هذه الخطوات. وبالتالي ، فإن أي تغييرات في استقرار التفاعلات داخل mRNP قد تكون قد ساهمت ، على الأقل جزئيًا ، في تغييراتنا الملحوظة في الإشغال الظاهري. على سبيل المثال ، يمكن تضخيم الإشغال الظاهري إذا تمت إعادة تشكيل تفاعلات mRNP المضافة التي قللت من معدل التفكك في المختبر للبروتين المناعي. ومع ذلك ، فإن زيادة استقرار التفاعل غالبًا ما تسير جنبًا إلى جنب مع زيادة إشغاله ، وفي كلتا الحالتين ، ستعكس النتيجة تغييرًا في mRNP الأصلي. بشكل عام ، أكدت المراسلات بين نتائجنا وتلك الخاصة بالنهج السابقة لدراسة التنظيم بوساطة miRNA فائدة نهجنا ، ووسعت بعض تلك النتائج السابقة إلى mRNAs الذاتية ، وقدمت رؤية جديدة لكل من القمع بوساطة miRNA وتنظيم mRNP بشكل عام. .

MRNPs في القمع بوساطة ميرنا

يعد الارتباط بـ eIF4E و eIF4G و PABP سمة مميزة لـ mRNPs السيتوبلازمية المستقرة والكفاءة متعدية ، ومجموعة متنوعة من الدراسات المستندة إلى المراسلين تشير إلى القمع بوساطة miRNA في تغيير الارتباط مع هذه العوامل الرئيسية [38 ، 47 ، 50 ، 51]. مع وضع هذه النتائج في الاعتبار ، تم استخدام الاستنفاد المعتمد على ميرنا لـ PABP المرتبط بـ PABP ، والذي تم قياسه باستخدام PABP RIP-seq ، لتحديد أهداف ميرنا في الخلايا البشرية ، على الرغم من أن هذا تم القيام به دون التمييز بين النضوب الناجم عن انخفاض شغل PABP من النضوب الناجم عن زعزعة mRNA [55]. وسعت دراستنا هذه النتائج لتشمل mRNPs الذاتية على نطاق واسع النسخ ، مما يدل على أنه حتى بعد مراعاة التغييرات في وفرة الحمض النووي الريبي ، فإن فقدان PABP و eIF4G منتشر على نطاق واسع أثناء القمع بوساطة miRNA ، على الرغم من الطبيعة الديناميكية والمتنوعة بطبيعتها لـ mRNPs . من المفترض أن mRNPs المعاد تشكيلها التي فقدت PABP و eIF4G غير قادرة على دعم بدء الترجمة ، بما يتوافق مع التقارير حول أهمية مجمع eIF4F في القمع الترجمي بوساطة miRNA [49 ، 51].

على الرغم من التفكك الذي يمكن اكتشافه بسهولة بوساطة miRNA لـ PABP و eIF4G ، لم نتمكن من اكتشاف التفكك بوساطة miRNA لـ eIF4E ، والذي يمكن أن يكون نتيجة mRNAs المستهدفة لـ miRNA والتي فقدت eIF4E تخضع لفك التقسيم والتدهور بسرعة كبيرة جدًا بحيث لا يمكن اكتشافها من قبلنا. أساليب. تم تحدي هذا التفسير من خلال نتائج تحليلنا على مستوى النسخ لربط eIF4E ، والذي كشف عن مجموعة من وظائف eIF4E التي امتدت إلى 100 ضعف (الشكل 5 أ) ، مما يعني أن العديد من mRNAs التي تفتقر إلى eIF4E المقيدة لا يتم قطعها وتدهورها على الفور. نقترح أن الحل لهذه المفارقة الواضحة يعتمد بشكل مباشر على سياق mRNP - قد يكون لتفكك eIF4E عواقب مختلفة تمامًا على بعض الرنا المرسال مقارنة بالآخرين. في هذا النموذج ، يعد تفكك eIF4E ضروريًا لفك التشابك [17] ولكنه ليس كافيًا ، وتعديلات mRNP الإضافية المرتبطة باستهداف miRNA ستفضل كلا من التقشير والتدهور. قد تشمل هذه التعديلات تفكك PABP ، أو تقصير ذيل بولي (A) ، أو توظيف عوامل الانحلال [4] ، وقد لوحظ كل منها أثناء القمع بوساطة ميرنا في الدراسة الحالية (الشكلان 1 و 2) أيضًا مثل التقارير السابقة [30 ، 38 ، 47].

فيما يتعلق بعوامل الاضمحلال التي تؤهب mRNAs للفك ، فإن المرشح الأعلى هو DDX6. يتفاعل هذا البروتين مع مركب فك القشرة من خلال بروتينات المحول [39 ، 45] وهو متورط في القمع بوساطة ميرنا للصحفيين [41 ، 43 ، 44]. علاوة على ذلك ، وجدنا أن DDX6 يتم تجنيده للعديد من mRNAs الذاتية حيث أصبحت مستهدفة من قبل miRNAs وأن DDX6 مرتبط بالعديد من mRNAs الإضافية التي تخضع للاضمحلال ، والتي من المفترض أنها لا تستهدفها miRNAs. تحتوي النصوص المرتبطة بـ DDX6 على ذيول بولي (A) والتي تكون في المتوسط ​​أقصر بكثير من تلك الخاصة بالسكان في الحالة المستقرة ، مما يشير إلى أن تجنيد DDX6 يتزامن مع التثبيط. تتوافق هذه النتيجة مع توظيف DDX6 بواسطة مركب CCR4 – NOT deadenylase عبر تفاعل مباشر مع CNOT1 [41 ، 43 ، 44]. ومع ذلك ، يشير تحليلنا لأطوال ذيل بولي (A) على mRNAs المحتوية على موقع ميرنا إلى أن التوظيف النهائي لـ DDX6 متشابه إلى حد كبير في وجود وغياب ميرنا المتشابه. تدعم نتائجنا معًا نموذجًا يؤدي فيه القمع بوساطة miRNA إلى تجنيد مركب CCR4 – NOT deadenylase عبر التفاعلات المباشرة مع TNRC6 [31 ، 37] ، وبمجرد تجنيد القاعدة الميتة ، فإن الشبكة الكثيفة من التفاعلات بين الرنا المرسال تؤدي عوامل الانحلال بعد ذلك إلى التدمير النهائي للنسخة من خلال آليات تعمل أيضًا على العديد من الرنا المرسال الأخرى ، وبالتالي لا يتم تنظيمها بشكل مباشر بواسطة آلية ميرنا [42 ، 61].

تنظيم mRNPs: PABP وذيل بولي (A)

لطالما تم التعرف على PABP كعامل حاسم لتنظيم ما بعد النسخ وهو ضروري لقدرة ذيل بولي (A) على تثبيت النصوص. تمشيا مع هذا الفهم ، أظهرت نتائجنا أن زيادة شغل PABP يرتبط بزيادة قابلية الترجمة واستقرار mRNA. لطالما كان يُعتقد أن ذيل بولي (A) مركزي في تنظيم ما بعد النسخ ، مع ذيول أطول تؤدي إلى زيادة الاستقرار والترجمة من خلال قدرتها على ربط المزيد من PABP. ومع ذلك ، وجدنا بشكل غير متوقع عدم وجود ارتباط بين شغل PABP وطول ذيل بولي (A) ، مما يشير إلى أن العلاقة بين طول الذيل متعدد (A) وربط PABP أكثر تعقيدًا مما كان يعتقد سابقًا. في الواقع ، على الرغم من أنه من بين النصوص المشتقة من نفس الجين ، تم تقليل شغل PABP إلى حد ما بالنسبة إلى mRNAs ذات الذيل الأقصر ، فإن الاختلافات في متوسط ​​طول الذيل المتعدد (A) لا يمكن أن تفسر الاختلافات في إشغال PABP الذي لوحظ في النسخ من الجينات المختلفة. وهكذا ، على الرغم من أن PABP قد يكون حاسمًا للإشارة إلى وجود ذيل بولي (A) ، في كل من خطوط الخلايا البشرية والذبابة وفي الخميرة ، يبدو أن PABP "قارئ" ضعيف جدًا لطول الذيل المتعدد (A).

أظهرت الدراسات الحديثة أنه في سياقات أخرى غير البويضات والأجنة المبكرة ، يفشل طول الذيل متعدد الحالة المستقر في الارتباط مع استقرار mRNA أو كفاءة ترجمة mRNA [36 ، 76].يمكن الآن التوفيق بين هذه النتائج السابقة والأدوار المعروفة لـ PABP في تعزيز استقرار mRNA والترجمة [15 ، 16 ، 77] ، حيث أظهرنا هنا أن الاختلافات في الحالة المستقرة لطول poly (A) لا تسبب بالضرورة الاختلافات في شغل PABP.

أظهرت نتائجنا أيضًا أن كثافة PABP على طول ذيول بولي (A) يمكن أن تختلف اختلافًا كبيرًا بالنسبة إلى mRNAs من جينات مختلفة. على سبيل المثال ، تحتوي mRNAs لبروتينات الريبوسوم على ذيول بولي (A) قصيرة جدًا ولكنها عالية جدًا في شغل PABP. على الرغم من أن نهجنا الحالي لا يمكنه تحديد العدد المطلق لـ PABPs المرتبطة بهذه الرنا المرسال ، فإن نتائجنا تتوافق مع كثافة PABP في هذه النسخ التي تكون أعلى من تلك الموجودة في mRNAs الأخرى. سيكون من المثير للاهتمام استكشاف هذه الاحتمالية بشكل أكبر وتحديد مدى تأثير كثافة PABP على عملية التثبيط و / أو عمليات ما بعد النسخ الأخرى.

ما الذي قد يحدد إذن مدى ارتباط PABP؟ نتائجنا ، جنبًا إلى جنب مع تلك الواردة من ذبابة الفاكهة المستخلصات [47] ، تبين أن فقدان PABP بوساطة miRNA قد يكون مجرد قمة جبل الجليد. قد يحدد التفاعل بين العوامل التنظيمية المختلفة ، بما في ذلك miRNAs والعوامل الأساسية ، مثل eIF4F ، طبيعة وتكوين كل mRNP ، بما في ذلك شغل PABP لمكوناته mRNAs. على سبيل المثال ، يمكن أن يؤثر eIF4G على تقارب PABP في المختبر [78] ، وبالتالي ، قد يكون للأحداث في 5 UTR تأثيرات مقابلة على ربط PABP. يتوافق هذا النموذج مع التفاعلات العديدة الموصوفة بين PABP والعوامل التنظيمية الأخرى [22 ، 42 ، 66 ، 79]. قد تعدل ميزات mRNA الجوهرية أيضًا شغل PABP. على سبيل المثال ، نظرًا لأن PABP يمكن أن يرتبط بامتدادات غنية بـ AU ذات تقارب عالٍ [80] ، فإن الارتباط التفاضلي بالنهاية 3 من 3 UTR ، والذي يمكن أن يكون غنيًا جدًا بـ AU ، قد يؤثر على الإشغال. علاوة على ذلك ، نظرًا لأن PABP يتفاعل مع عامل الإنهاء eRF3 ، فقد يكون لمعدل الترجمة أو كفاءة الإنهاء أيضًا تأثير على ربط PABP [81]. ستلقي الرؤى المستقبلية حول تنظيم mRNP وإعادة التصميم مزيدًا من الضوء على ميزات mRNA والعوامل التي تتفوق على طول الذيل لتحديد إشغال PABP.


آليات تنظيم الجينات بوساطة ميرنا

أظهرت معظم الدراسات حتى الآن أن miRNAs ترتبط بتسلسل محدد في 3 & # x02032 UTR من mRNAs المستهدفة للحث على القمع الترجمي و mRNA deadenylation وفك الرفع (40 ، 41). تم أيضًا اكتشاف مواقع ربط miRNA في مناطق mRNA الأخرى بما في ذلك 5 & # x02032 UTR وتسلسل الترميز ، وكذلك داخل مناطق المروج (42). إن ارتباط miRNAs بـ 5 & # x02032 UTR ومناطق الترميز له تأثيرات إسكات على التعبير الجيني (43 ، 44) بينما تم الإبلاغ عن تفاعل ميرنا مع منطقة المروج للحث على النسخ (45). ومع ذلك ، هناك حاجة إلى مزيد من الدراسات لفهم الأهمية الوظيفية لمثل هذا النمط من التفاعل بشكل كامل.

إسكات الجينات بوساطة MicroRNA عبر miRISC

يتكون الحد الأدنى من مجمع الإسكات الناجم عن الحمض النووي الريبي (miRISC) من خيط التوجيه و AGO (46). تعود الخصوصية المستهدفة لـ miRISC إلى تفاعلها مع التسلسلات التكميلية على mRNA الهدف ، والتي تسمى عناصر استجابة miRNA (MREs). تحدد درجة تكامل التوعية بمخاطر الألغام ما إذا كان هناك تشريح يعتمد على AGO2 من mRNA المستهدف أو تثبيط متعدية بوساطة miRISC واستهداف تحلل الرنا المرسال (47). ميرنا مكمل بالكامل: تفاعل التصوير بالرنين المغناطيسي يستحث نشاط نوكلياز AGO2 ويستهدف انقسام الرنا المرسال (47). ومع ذلك ، فإن هذا التفاعل يزعزع استقرار الارتباط بين AGO والنهاية 3 & # x02032 من ميرنا التي تعزز تدهورها (48 ، 49).

في الخلايا الحيوانية ، فإن غالبية تفاعلات miRNA: MRE ليست متكاملة تمامًا (50). تحتوي معظم أنواع MRE على الأقل على عدم تطابق مركزي مع دليل miRNA ، مما يمنع نشاط نوكلياز AGO2. وبالتالي ، يعمل AGO2 كوسيط لتداخل الحمض النووي الريبي ، على غرار أفراد عائلة AGO غير الحال للنووية (AGO1 و 3 و 4 في البشر). في كثير من الحالات ، يحدث تفاعل ميرنا وظيفي: MRE عبر منطقة البذور 5 & # x00027 (النيوكليوتيدات 2 & # x020138) (42 ، 51). ومع ذلك ، فإن التقشير الإضافي في الطرف 3 & # x02032 يساعد في استقرار وخصوصية تفاعل الهدف ميرنا (15).

يبدأ تكوين مجمع miRISC الصامت بتوظيف عائلة البروتينات GW182 بواسطة miRISC GW182 الذي يوفر السقالات اللازمة لتجنيد بروتينات فاعلية أخرى (52) ، مثل مجمعات poly (A) -deadenylase PAN2-PAN3 و CCR4-NOT ، بعد ميرنا: تفاعل مرنا الهدف (50 ، 53). الهدف من mRNA poly (A) -deadenylation يبدأ بواسطة PAN2 / 3 ويكتمل بواسطة مجمع CCR4-NOT. التفاعل بين تكرارات التربتوفان (W) لـ GW182 وبروتين ربط بولي (A) C (PABPC) يعزز عملية إبادة فعالة (50). بعد ذلك ، يتم إجراء عملية إزالة القشرة عن طريق فصل البروتين 2 (DCP2) والبروتينات المرتبطة به (52) ، متبوعًا بالتدهور 5 & # x02032 & # x022123 & # x02032 بواسطة exoribonuclease 1 (XRN1) (54) (الشكل 1).

التنشيط الترجمي بوساطة MicroRNA

على الرغم من أن معظم الدراسات تركز على كيفية تثبيط miRNAs للتعبير الجيني ، فقد أبلغ البعض أيضًا عن زيادة التنظيم للتعبير الجيني بواسطة miRNAs. في الخلايا المتعطشة في المصل ، ارتبط AGO2 وبروتين آخر مرتبط بمركب البروتين miRNA (microRNPs) ، البروتين المرتبط بالتخلف العقلي الهش 1 (FXR1) ، بالعناصر الغنية بـ AU (AREs) عند 3 & # x02032 UTR للتنشيط ترجمة (55). تم العثور على العديد من miRNAs ، بما في ذلك let-7 ، مرتبطة بـ AGO2 و FXR1 لتنشيط الترجمة أثناء توقف دورة الخلية ، لكنها تمنع الترجمة في الخلايا المتكاثرة (55). كما لوحظ زيادة تنظيم التعبير الجيني بواسطة miRNAs في الخلايا الهادئة ، مثل البويضات (56 ، 57). يتضمن تنشيط الترجمة بوساطة miRNA AGO2 و FXR1 بدلاً من GW182 (56). تتضمن الأمثلة الأخرى على تنشيط الجينات بواسطة miRNAs الارتباط بـ 5 & # x02032 UTR من mRNAs الذي يشفر البروتينات الريبوزومية أثناء تجويع الأحماض الأمينية (58) مما يشير إلى أن تنظيم التعبير الجيني بوساطة miRNA يحدث في ظل ظروف محددة.

تنظيم الجينات بوساطة MicroRNA و post-transcriptional داخل النواة

من خلال Importin-8 أو Exportin-1 ، يتنقل AGO2 البشري بين النواة والسيتوبلازم عبر تفاعله مع TNRC6A (بروتين عائلي GW182) الذي يحتوي على توطين نووي وإشارة تصدير (59). تم العثور على miRISC المترجمة نوويًا لتنظيم كل من معدلات النسخ ومستويات ما بعد النسخ من mRNA (59 & # x0201361) وربطها بالكروماتين الحقيقي في مواقع الجينات مع النسخ النشط (62). ومع ذلك ، فإن فهمنا لموعد وكيفية قيام الجزيئات الدقيقة بممارسة وظائفها في النواة لا يزال محدودًا.

تم الإبلاغ عن أن miRISC منخفض الوزن الجزيئي يمكن أن يتفاعل مع mRNAs داخل النواة ويحث على تحلل الرنا المرسال النووي ، على الرغم من أن الآلية الكامنة وراء ذلك غير واضحة (59 ، 61 ، 63). قد يوحي تخصيب miRNA في الجينات المنسوخة بنشاط أن miRISC يتفاعل مع mRNA الهدف المشترك / بعد النسخ. إن مشاركة AGO و Drosha في ربط mRNA (64 ، 65) يدعم أيضًا تفاعلات miRISC: mRNA في النسخ المشترك. قد يقوم miRISC أيضًا بتنظيم النسخ مباشرةً. أظهرت دراسة أن AGO2 كان يتركز في نواة الخلايا الليفية المسننة وتفاعل مع miRISC والورم الأرومي الشبكي (Rb) لقمع نسخ الجينات المعززة للانتشار التي تنظمها Rb / E2F. لوحظ أن let-7f كان مرتبطًا بمخاطر الألغام الموجودة في مروجي اثنين من الجينات المستهدفة من E2F ، CDCA8 و CDC2، بطريقة تعتمد على AGO2 (60). أيضًا ، تم تنظيم مجموعة فرعية من الجينات المرتبطة بمحفز AGO بعد الشيخوخة ، ووجد أن AGO2 يتشارك في المناعة مع euchromatin (60). دراسة أحدث بواسطة مياو وآخرون. وجد (66) نووي miR-522 يتفاعل مع بنية صليبية للحمض النووي (حلقة جذعية على خيوط DNA المعنى والمضادة المعنى) داخل مروج لـ CYP2E1 وقمع نسخها (66). وقد ثبت أيضًا أن miRNAs تتفاعل في المواقع الجينية ، حيث يتم نسخ الحمض النووي الريبي المشتق من المحسن (eRNA) ، وتزيد من مستويات mRNA للجينات المجاورة عن طريق تعزيز حالة الكروماتين النشطة نسبيًا (67) أثناء تغيير ملفات التضفير البديلة (64). لا يزال يتعين تحديد الدور العام لـ miRISC في تنظيم حالة الكروماتين وهيكله والتحكم في النسخ ، لكن هذه البيانات الحالية تشير إلى دور يشبه عامل النسخ. من الممكن أيضًا أن تشارك miRISC في إنشاء من جديد المثيلة ، وبالتالي ، دمج الكروماتين في مقصورات نووية ، وساطة إعادة التشكيل الجيني.


مراجع

Ghildiyal، M. & amp Zamore، P. D. الصغيرة إسكات الحمض النووي الريبي: الكون المتوسع. القس الطبيعة جينيه. 10, 94–108 (2009).

Ishizu ، H. ، Siomi ، H. & amp Siomi ، M. C. بيولوجيا الحمض النووي الريبي المتفاعل مع PIWI: رؤى جديدة في التكوين الحيوي والوظيفة داخل وخارج الخطوط الجرثومية. تطوير الجينات. 26, 2361–2373 (2012).

Huntzinger، E. & amp Izaurralde، E. إسكات الجينات بواسطة microRNAs: مساهمات القمع الترجمي واضمحلال الرنا المرسال. القس الطبيعة جينيه. 12, 99–110 (2011).

Bartel، D. P. MicroRNAs: التعرف على الهدف والوظائف التنظيمية. زنزانة 136, 215–233 (2009).

فريدمان ، آر سي ، فاره ، ك.ك ، بورج ، سي بي وأمبير بارتل ، دي بي معظم الرنا المرسال في الثدييات هي أهداف محفوظة لـ microRNAs. الدقة الجينوم. 19, 92–105 (2009).

Lujambio ، A. & amp Lowe ، S. W. العالم الصغير للسرطان. طبيعة سجية 482, 347–355 (2012).

Im ، H. I. & amp Kenny ، P. J. MicroRNAs في وظيفة الخلايا العصبية والخلل الوظيفي. الاتجاهات العصبية. 35, 325–334 (2012).

Kim، V.N، Han، J. & amp Siomi، M. C. Biogenesis of RNAs الصغيرة في الحيوانات. القس الطبيعة مول. خلية بيول. 10, 126–139 (2009).

Krol، J.، Loedige، I. & amp Filipowicz، W. التنظيم الواسع للتكوين الحيوي للـ microRNA والوظيفة والانحلال. القس الطبيعة جينيه. 11, 597–610 (2010).

Siomi، H. & amp Siomi، M. C. تنظيم ما بعد النسخ للتكوين الحيوي للـ microRNA في الحيوانات. مول. زنزانة 38, 323–332 (2010).

Axtell، M. J.، Westholm، J. O. & amp Lai، E.C Vive la Difference: biogenesis and evolution of microRNAs in plants and animal. جينوم بيول. 12, 221 (2011).

Cuperus ، J. T. ، Fahlgren ، N. & amp Carrington ، J.C. التطور والتنويع الوظيفي لـ ميرنا الجينات. الخلية النباتية 23, 431–442 (2011).

Voinnet ، O. أصل ، التولد الحيوي ، ونشاط الرنا الميكروي للنبات. زنزانة 136, 669–687 (2009).

Chang، S. S.، Zhang، Z. & amp Liu، Y. مسارات تداخل الحمض النووي الريبي في الفطريات: الآليات والوظائف. Annu. القس ميكروبيول. 66, 305–323 (2012).

Griffiths-Jones، S.، Saini، H.K، van Dongen، S. & amp Enright، A.J miRBase: أدوات لجينوم الرنا الميكروي. الدقة الأحماض النووية. 36، D154-D158 (2008).

شيانغ ، هـ. آر وآخرون. الرنا الميكروي للثدييات: تقييم تجريبي للجينات الجديدة والمشروحة مسبقًا. تطوير الجينات. 24, 992–1009 (2010).

Kozomara ، A. & amp Griffiths-Jones ، S. miRBase: التعليق على الحمض النووي الريبي الدقيق عالي الثقة باستخدام بيانات التسلسل العميق. الدقة الأحماض النووية 42، D68-D73 (2014).

هيرتل ، جيه وآخرون. توسيع ذخيرة الرنا الميكروي metazoan. علم الجينوم BMC 7, 25 (2006).

Berezikov ، E. تطور تنوع الرنا الميكروي وتنظيمه في الحيوانات. القس الطبيعة جينيه. 12, 846–860 (2011).

ويلر ، ب.م وآخرون. التطور العميق لـ microRNAs metazoan. Evol. ديف. 11, 50–68 (2009).

Ventura، A. et al. يكشف الحذف المستهدف عن الوظائف الأساسية والمتداخلة لـ miR-17 إلى 92 عائلة من مجموعات miRNA. زنزانة 132, 875–886 (2008).

كيم ، واي ك وآخرون. مكتبة بالضربة القاضية قائمة على TALEN للـ microRNAs البشرية. هيكل الطبيعة. مول. بيول. 20, 1458–1464 (2013).

Lee ، Y. ، Jeon ، K. ، Lee ، J. T. ، Kim ، S. & amp Kim ، V.N. نضج MicroRNA: المعالجة التدريجية والتوطين الخلوي. EMBO J. 21, 4663–4670 (2002).

Roush، S. & amp Slack، F. J. The let-7 family of microRNAs. اتجاهات خلية بيول. 18, 505–516 (2008).

Ozsolak ، F. et al. تحدد تحليلات بنية الكروماتين محفزات ميرنا. تطوير الجينات. 22, 3172–3183 (2008).

مونتيس ، إيه إم وآخرون. هيكل ونشاط محفزات ميرنا المفترضة. RNA 16, 495–505 (2010).

Cai، X.، Hagedorn، C.H & amp Cullen، B. R. تتم معالجة الرنا الميكروي البشري من نصوص متعددة الأدينيلات المغطاة والتي يمكن أن تعمل أيضًا مثل mRNAs. RNA 10, 1957–1966 (2004).

لي ، واي وآخرون. يتم نسخ جينات MicroRNA بواسطة RNA polymerase II. EMBO J. 23, 4051–4060 (2004).

بفيفر ، إس وآخرون. تحديد microRNAs لعائلة فيروس الهربس. طرق الطبيعة 2, 269–276 (2005).

Babiarz ، J. E. ، Ruby ، ​​J.G ، Wang ، Y. ، Bartel ، D.P & amp Blelloch ، R. Mouse ES cells. تعبر خلايا shRNAs الذاتية ، siRNAs ، وغيرها من الحمض النووي الريبي الصغير المستقل عن المعالجات الدقيقة ، والمعتمد على Dicer. تطوير الجينات. 22, 2773–2785 (2008).

Davis-Dusenbery، B.N & amp Hata، A. آليات التحكم في التكوّن الحيوي للـ microRNA. J. Biochem. 148, 381–392 (2010).

لي ، واي وآخرون. يبدأ RNase III Drosha النووي معالجة microRNA. طبيعة سجية 425, 415–419 (2003).

Denli، A. M.، Tops، B. B.، Plasterk، R.H، Ketting، R.F & amp Hannon، G.J. معالجة الرنا الميكروي الأولي بواسطة مجمع المعالجات الدقيقة. طبيعة سجية 432, 231–235 (2004).

جريجوري ، آر آي وآخرون. يتوسط مجمع المعالجات الدقيقة نشأة الرنا الميكروي. طبيعة سجية 432, 235–240 (2004).

هان ، ج وآخرون. مجمع Drosha-DGCR8 في معالجة microRNA الأولي. تطوير الجينات. 18, 3016–3027 (2004).

Landthaler ، M. ، Yalcin ، A. & amp Tuschl ، T. المنطقة الحرجة لمتلازمة دي جورج البشرية الجين 8 وما له من D. melanogaster متماثل مطلوبة للتكوين الحيوي ميرنا. بالعملة. بيول. 14, 2162–2167 (2004).

تشونغ ، إم إم وآخرون. الوظائف الأساسية والبديلة لآلة التكوُّن الحيوي للـ microRNA. تطوير الجينات. 24, 1951–1960 (2010).

Wang ، Y. ، Medvid ، R. ، Melton ، C. ، Jaenisch ، R. & amp Blelloch ، R. DGCR8 ضروري للتكوين الحيوي للـ microRNA وإسكات التجديد الذاتي للخلايا الجذعية الجنينية. طبيعة الجينات. 39, 380–385 (2007).

Shiohama، A.، Sasaki، T.، Noda، S.، Minoshima، S. & amp Shimizu، N. الاستنساخ الجزيئي وتحليل التعبير لجين جديد DGCR8 يقع في منطقة كروموسومات متلازمة دي جورج. بيوتشيم. بيوفيز. الدقة. كومون. 304, 184–190 (2003).

Goldberg، R.، Motzkin، B.، Marion، R.، Scambler، P. J. & amp Shprintzen، R.J Velo-cardio-Facial syndrome: مراجعة لـ 120 مريضًا. أكون. جيه ميد. جينيه. 45, 313–319 (1993).

Filippov ، V. ، Solovyev ، V. ، Filippova ، M. & amp Gill ، S. S. نوع جديد من بروتينات عائلة RNase III في حقيقيات النوى. الجين 245, 213–221 (2000).

Fortin، K.R، Nicholson، R.H & amp Nicholson، A.W Mouse ribonuclease III. بنية (كدنا) وتحليل التعبير والموقع الكروموسومي. علم الجينوم BMC 3, 26 (2002).

Wu ، H. ، Xu ، H. ، Miraglia ، L.J & amp Crooke ، S. T. Human RNase III هو بروتين 160 كيلو دالتون يشارك في معالجة الحمض النووي الريبي السابق. J. بيول. تشيم. 275, 36957–36965 (2000).

Tang، X.، Zhang، Y.، Tucker، L. & amp Ramratnam، B. مطلوب فسفرة إنزيم RNase III Drosha في Serine300 أو Serine302 لتوطينه النووي. الدقة الأحماض النووية. 38, 6610–6619 (2010).

Blaszczyk، J. et al. تشير الدراسات البلورية والنمذجة لـ RNase III إلى آلية لانقسام الحمض النووي الريبي مزدوج الشريطة. بنية 9, 1225–1236 (2001).

Zhang، H.، Kolb، F. A.، Jaskiewicz، L.، Westhof، E. & amp Filipowicz، W. نماذج مركز المعالجة الفردية للقامر البشري والبكتيريا RNase III. زنزانة 118, 57–68 (2004).

Shiohama، A.، Sasaki، T.، Noda، S.، Minoshima، S. & amp Shimizu، N. إكسب. دقة الخلية. 313, 4196–4207 (2007).

Yeom، K.H، Lee، Y.، Han، J.، Suh، M.R & amp Kim، V.N. توصيف DGCR8 / Pasha ، العامل المساعد الأساسي لـ Drosha في معالجة ميرنا الأولية. الدقة الأحماض النووية. 34, 4622–4629 (2006).

هان ، ج وآخرون. الأساس الجزيئي للتعرف على الرنا الميكروي الأولي بواسطة مجمع Drosha-DGCR8. زنزانة 125, 887–901 (2006).

Sohn، S. Y. et al. التركيب البلوري لنواة DGCR8 البشرية. هيكل الطبيعة. مول. بيول. 14, 847–853 (2007).

Faller، M.، Matsunaga، M.، Yin، S.، Loo، J.A & amp Guo، F. Heme يشارك في معالجة الرنا الميكروي. هيكل الطبيعة. مول. بيول. 14, 23–29 (2007).

فالر ، م وآخرون. يتعرف DGCR8 على النسخ الأولية من microRNAs من خلال الربط التعاوني للغاية وتشكيل الهياكل ذات الترتيب الأعلى. RNA 16, 1570–1583 (2010).

بار وآخرون. الهيم الحديدي ، وليس الحديدي ، ينشط بروتين DGCR8 المرتبط بالـ RNA من أجل معالجة microRNA الأولي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 109, 1919–1924 (2012).

Weitz، S. H.، Gong، M.، Barr، I.، Weiss، S. & amp Guo، F. تتطلب معالجة النصوص الأولية للـ microRNA وجود الهيم في خلايا الثدييات. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 111, 1861–1866 (2014).

Zeng ، Y. ، Yi ، R. & amp Cullen ، B. R. التعرف على سلائف microRNA وانقسامها بواسطة إنزيم المعالجة النووية Drosha. EMBO J. 24, 138–148 (2005).

Auyeung، V. C.، Ulitsky، I.، McGeary، S.E & amp Bartel، D. P. ما وراء البنية الثانوية: ترخص محددات التسلسل الأساسي دبابيس الشعر pri-miRNA للمعالجة. زنزانة 152, 844–858 (2013).

Ma، H.، Wu، Y.، Choi، J.G & amp Wu، H. تحدد تقاطعات الحمض النووي الريبي السفلية والعليا ذات السيقان المفردة معًا موقع انقسام دروشا. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 110, 20687–20692 (2013).

موري ، م وآخرون. تنظم إشارات فرس النهر المعالجات الدقيقة وتربط التكوُّن الحيوي ميرنا المعتمد على كثافة الخلايا بالسرطان. زنزانة 156, 893–906 (2014).

Kim، Y.K & amp Kim، V.N. معالجة الرنا الميكروي intronic. EMBO J. 26, 775–783 (2007).

مورلاندو م وآخرون. تتم معالجة نسخ microRNA الأولية بشكل مشترك. هيكل الطبيعة. مول. بيول. 15, 902–909 (2008).

Pawlicki ، J.M & amp Steitz ، J. A. يؤدي الاحتفاظ بنسخة microRNA الأولي في مواقع النسخ إلى إنتاج microRNA محسن. J. خلية بيول. 182, 61–76 (2008).

هان ، ج وآخرون. التنظيم المتبادل بعد النسخ بين Drosha و DGCR8. زنزانة 136, 75–84 (2009).

سوندارام ، جي إم وآخرون. تعبير "See-saw" عن microRNA-198 و FSTL1 من نسخة واحدة في التئام الجروح. طبيعة سجية 495, 103–106 (2013).

ناكلز ، ب. وآخرون. ينظم Drosha تكوين الخلايا العصبية عن طريق التحكم في تعبير neurogenin 2 بشكل مستقل عن microRNAs. طبيعة الأعصاب. 15, 962–969 (2012).

كادنر ، إس وآخرون. تحديد الجينوم لأهداف مجمع دروشا باشا / DGCR8. RNA 15, 537–545 (2009).

هربرت ، K. M. ، Pimienta ، G. ، DeGregorio ، S. J. ، Alexandrov ، A. & amp Steitz ، J. A. Phosphorylation of DGCR8 يزيد من استقراره داخل الخلايا ويحفز ملف تعريف mRNA متقدم. مندوب الخلية. 5, 1070–1081 (2013).

Tang، X.، Li، M.، Tucker، L. & amp Ramratnam، B. Glycogen synthase kinase 3 beta (GSK3β) فسفوريلات إنزيم RNAase III Drosha في S300 و S302. بلوس واحد 6، e20391 (2011).

يعزز Wada ، T. ، Kikuchi ، J. & amp Furukawa ، Y. Histone deacetylase 1 معالجة microRNA عبر deacetylation لـ DGCR8. ممثل EMBO. 13, 142–149 (2012).

تانغ إكس وآخرون. يمنع أستلة الدروشا على الطرف N تحللها عن طريق التواجد في كل مكان. بلوس واحد 8، e72503 (2013).

تشنغ ، ت.ل وآخرون. يمنع MeCP2 معالجة microRNA النووي ونمو شجيري من خلال تنظيم مجمع DGCR8 / Drosha. ديف. زنزانة 28, 547–560 (2014).

فوكودا ، ت. وآخرون. الوحدات الفرعية لـ DEAD-box RNA لمركب Drosha مطلوبة لمعالجة الرنا الريباسي ومجموعة فرعية من الرنا الميكروي. خلية الطبيعة بيول. 9, 604–611 (2007).

Davis ، B. N. ، Hilyard ، A.C ، Lagna ، G. & amp Hata ، A. تتحكم بروتينات SMAD في نضوج الرنا الميكروي DROSHA. طبيعة سجية 454, 56–61 (2008).

تربط بروتينات Davis ، B.N ، Hilyard ، A.C ، Nguyen ، P.H ، Lagna ، G. & amp Hata ، A. Smad تسلسل الحمض النووي الريبي المحفوظ لتعزيز نضج الرنا الميكروي بواسطة Drosha. مول. زنزانة 39, 373–384 (2010).

سوزوكي ، إتش آي وآخرون. تعديل معالجة microRNA بواسطة p53. طبيعة سجية 460, 529–533 (2009).

دي كارلو ، ف.وآخرون. ينظم TDP-43 نشاط المعالجات الدقيقة أثناء في المختبر التمايز العصبي. مول. نيوروبيول. 48, 952–963 (2013).

Kawahara، Y. & amp Mieda-Sato، A. يعزز TDP-43 التولد الحيوي للـ microRNA كمكون لمجمعي Drosha و Dicer. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 109, 3347–3352 (2012).

Guil، S. & amp Caceres، J.F. إن بروتين ربط الحمض النووي الريبي متعدد الوظائف hnRNP A1 مطلوب لمعالجة miR-18a. هيكل الطبيعة. مول. بيول. 14, 591–596 (2007).

Michlewski ، G. ، Guil ، S. ، Semple ، C.A & amp Caceres ، J. F. تنظيم ما بعد النسخ من miRNAs التي تؤوي حلقات طرفية محفوظة. مول. زنزانة 32, 383–393 (2008).

ترابوتشي ، إم وآخرون. يعزز البروتين المرتبط بـ RNA KSRP التكوين الحيوي لمجموعة فرعية من microRNAs. طبيعة سجية 459, 1010–1014 (2009).

Bohnsack، M. RNA 10, 185–191 (2004).

Lund، E.، Guttinger، S.، Calado، A.، Dahlberg، J. E. & amp Kutay، U. علم 303, 95–98 (2004).

Yi ، R. ، Qin ، Y. ، Macara ، I. تطوير الجينات. 17, 3011–3016 (2003).

أوكادا ، سي وآخرون. هيكل عالي الدقة لآلة التصدير النووي قبل microRNA. علم 326, 1275–1279 (2009).

جويزديك ، سي وآخرون. يتوسط Exportin-5 تصدير نووي من RNAs المحتوية على minihelix. J. بيول. تشيم. 278, 5505–5508 (2003).

Zeng، Y. & amp Cullen، B. R. المتطلبات الهيكلية للربط المسبق للـ microRNA والتصدير النووي بواسطة Exportin 5. الدقة الأحماض النووية. 32, 4776–4785 (2004).

إيواساكي ، واي دبليو وآخرون. ارتفاع الرنا الميكروي العالمي بواسطة Exportin 5 المحرض ينظم دخول دورة الخلية. RNA 19, 490–497 (2013).

وان ، جي وآخرون. ينظم مسار ATM-AKT التصدير النووي الناجم عن تلف الحمض النووي للسلائف microRNAs. مندوب الخلية. 3, 2100–2112 (2013).

ميلو ، إس إيه وآخرون. عيب جيني في exportin-5 يحبس السلائف microRNAs في نواة الخلايا السرطانية. الخلايا السرطانية 18, 303–315 (2010).

كسي ، م وآخرون. سلائف الرنا الميكروي للثدييات التي تولد رنا ميكرو واحدًا. زنزانة 155, 1568–1580 (2013).

Bernstein، E.، Caudy، A. A.، Hammond، S. M. & amp Hannon، G.J. طبيعة سجية 409, 363–366 (2001).

Grishok، A. et al. تنظم الجينات والآليات المتعلقة بتداخل الحمض النووي الريبي التعبير عن الحمض النووي الريبي الزماني الصغير الذي يتحكم C. ايليجانس توقيت النمو. زنزانة 106, 23–34 (2001).

Hutvagner، G. et al. وظيفة خلوية لإنزيم Dicer الخاص بتدخل الحمض النووي الريبي في نضوج الرنا الصغير الزمني let-7. علم 293, 834–838 (2001).

كيتينج ، آر إف وآخرون. يعمل Dicer في تدخل RNA وفي تخليق RNA صغير يشارك في توقيت النمو في C. ايليجانس. تطوير الجينات. 15, 2654–2659 (2001).

Knight، S. W. & amp Bass، B. L. دور لإنزيم RNase III DCR-1 في تداخل RNA وتطوير الخط الجرثومي في أنواع معينة انيقة. علم 293, 2269–2271 (2001).

لي ، واي إس وآخرون. أدوار مميزة لـ ذبابة الفاكهة Dicer-1 و Dicer-2 في مسارات إسكات siRNA / miRNA. زنزانة 117, 69–81 (2004).

شي ، زي وآخرون. التنويع الجيني والوظيفي لمسارات الحمض النووي الريبي الصغيرة في النباتات. بلوس بيول. 2، E104 (2004).

برنشتاين ، إي وآخرون. المقامر هو ضروري لتحقيق التنمية الماوس. طبيعة الجينات. 35, 215–217 (2003).

Kanellopoulou، C. et al. الخلايا الجذعية الجنينية للفأر التي تعاني من نقص Dicer معيبة في التمايز وإسكات المركز. تطوير الجينات. 19, 489–501 (2005).

Murchison ، E. P. ، Partridge ، J.F ، Tam ، O. H. ، Cheloufi ، S. & amp Hannon ، G.J. توصيف الخلايا الجذعية الجنينية التي تعاني من نقص دايسر. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 102, 12135–12140 (2005).

Yang ، J. S. & amp Lai ، E.C. مسارات التكوُّن الحيوي لميرنا البديلة وتفسير طفرات مسار ميرنا الأساسية. مول. زنزانة 43, 892–903 (2011).

كومار ، إم إس وآخرون. يعمل Dicer1 كمثبط للورم غير كافٍ. تطوير الجينات. 23, 2700–2704 (2009).

Tsutsumi، A.، Kawamata، T.، Izumi، N.، Seitz، H. & amp Tomari، Y. التعرف على بنية pre-miRNA بواسطة ذبابة الفاكهة المقامر -1. هيكل الطبيعة. مول. بيول. 18, 1153–1158 (2011).

جو ، إس وآخرون. يعد موضع حلقة shRNAs و pre-miRNAs أمرًا بالغ الأهمية لدقة معالجة dicer في الجسم الحي. زنزانة 151, 900–911 (2012).

ماكراي ، آي جيه وآخرون. الأساس الهيكلي لمعالجة RNA مزدوج الشريطة بواسطة Dicer. علم 311, 195–198 (2006).

بارك ، ج. إي وآخرون. يتعرف Dicer على نهاية 5 من الحمض النووي الريبي من أجل معالجة فعالة ودقيقة. طبيعة سجية 475, 201–205 (2011).

تيان ، واي وآخرون. جيب مرتبط بالفوسفات داخل كاسيت حلزوني موصل بمنصة PAZ لجهاز Dicer البشري. مول. زنزانة 53, 606–616 (2014).

Lau، P. W.، Potter، C. S.، Carragher، B. & amp MacRae، I.J. هيكل مجمع Dicer – TRBP البشري بواسطة المجهر الإلكتروني. بنية 17, 1326–1332 (2009).

تايلور ، دي دبليو وآخرون. إعادة ترتيب هيكلية خاصة بالركيزة من Dicer البشري. هيكل الطبيعة. مول. بيول. 20, 662–670 (2013).

وانغ ، هـ.و.وآخرون. رؤى هيكلية في معالجة الحمض النووي الريبي بواسطة مجمع تحميل RISC البشري. هيكل الطبيعة. مول. بيول. 16, 1148–1153 (2009).

MacRae ، I. J. ، Zhou ، K. & amp Doudna ، J. A. المحددات الهيكلية للتعرف على الحمض النووي الريبي وانقسامه بواسطة دايسر. هيكل الطبيعة. مول. بيول. 14, 934–940 (2007).

فيرميولين ، إيه وآخرون. مساهمات بنية الحمض الريبي النووي النقال (dsRNA) لخصوصية وكفاءة المقامر. RNA 11, 674–682 (2005).

Zhang، H.، Kolb، F. A.، Brondani، V.، Billy، E. & amp Filipowicz، W. Human Dicer بشكل مفضل يشق dsRNAs في نهاياتهم دون الحاجة إلى ATP. EMBO J. 21, 5875–5885 (2002).

فورستمان ، ك وآخرون. يتطلب نضج الرنا الميكروي الطبيعي وصيانة الخلايا الجذعية للخط الجرثومي ثرثرة ، وهو بروتين مجال ربط الحمض النووي الريبي مزدوج الشريطة. بلوس بيول. 3، e236 (2005).

جيانغ ، إف وآخرون. يحفز Dicer-1 و R3D1-L نضوج الرنا الميكروي في ذبابة الفاكهة. تطوير الجينات. 19, 1674–1679 (2005).

Saito، K.، Ishizuka، A.، Siomi، H. & amp Siomi، M. C. معالجة ما قبل microRNAs بواسطة مجمع Dicer-1-Loquacious in ذبابة الفاكهة الخلايا. بلوس بيول. 3، e235 (2005).

فوكوناجا ، آر وآخرون. تقوم بروتينات شريك Dicer بضبط طول miRNAs الناضجة في الذباب والثدييات. زنزانة 151, 533–546 (2012).

ليو ، إكس وآخرون. Dicer-1 ، ولكن ليس ثرثرة ، أمر بالغ الأهمية لتجميع مجمعات إسكات الناجم عن ميرنا. RNA 13, 2324–2329 (2007).

Park، J.K، Liu، X.، Strauss، T.J، McKearin، D.M & amp Liu، Q. يتحكم مسار miRNA جوهريًا في التجديد الذاتي لـ ذبابة الفاكهة الخلايا الجذعية الجرثومية. بالعملة. بيول. 17, 533–538 (2007).

شندريمادا ، تي ب وآخرون. تقوم TRBP بتجنيد مجمع Dicer إلى Ago2 لمعالجة microRNA وإسكات الجينات. طبيعة سجية 436, 740–744 (2005).

هاس ، إيه دي وآخرون. يتفاعل TRBP ، وهو منظم للتعبير الخلوي لفيروس PKR و HIV-1 ، مع Dicer ويعمل في إسكات RNA. ممثل EMBO. 6, 961–967 (2005).

لي ، واي وآخرون. دور PACT في مسار إسكات الحمض النووي الريبي. EMBO J. 25, 522–532 (2006).

Lee ، H. Y. ، Zhou ، K. ، Smith ، A. M. ، Noland ، C.L & amp Doudna ، J. A. الأدوار التفاضلية لبروتينات ربط Dicer البشرية TRBP و PACT في معالجة RNA الصغيرة. الدقة الأحماض النووية. 41, 6568–6576 (2013).

شاكرافارثي ، S. ، ستيرنبرغ ، S. H. ، Kellenberger ، C.A & amp Doudna ، J. A. حركية خاصة بالركيزة لمعالجة Dicer-catalyzed RNA. جيه مول. بيول. 404, 392–402 (2010).

Lee و H. Y. & amp Doudna و J.A TRBP يغيران معالجة السليفة البشرية microRNA في المختبر. RNA 18, 2012–2019 (2012).

Garcia، M.A، Meurs، E.F & amp Esteban، M. إن بروتين كيناز dsRNA PKR: التحكم في الفيروسات والخلية. بيوكيمي 89, 799–811 (2007).

Paroo، Z.، Ye، X.، Chen، S. & amp Liu، Q. فسفرة المركب البشري المولّد للـ microRNA يتوسط إشارات MAPK / Erk. زنزانة 139, 112–122 (2009).

ميلو ، إس إيه وآخرون. تضعف طفرة TARBP2 في سرطان الإنسان من معالجة microRNA ووظيفة DICER1. طبيعة الجينات. 41, 365–370 (2009).

Tokumaru، S.، Suzuki، M.، Yamada، H.، Nagino، M. & amp Takahashi، T. اسمحوا 7 ينظم تعبير Dicer ويشكل حلقة ردود فعل سلبية. التسرطن 29, 2073–2077 (2008).

Forman، J. J.، Legesse-Miller، A. & amp Coller، H. A. يكشف البحث عن التسلسلات المحفوظة في مناطق الترميز أن let-7 microRNA يستهدف Dicer ضمن تسلسل الترميز الخاص به. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 105, 14879–14884 (2008).

Hammond، S. M.، Boettcher، S.، Caudy، A. A.، Kobayashi، R. & amp Hannon، G.J. Argonaute2، a link between genetic and biochemical analysis of RNAi. علم 293, 1146–1150 (2001).

موريلاتوس ، زد وآخرون. miRNPs: فئة جديدة من البروتينات النووية تحتوي على العديد من جزيئات الحمض النووي الريبي. تطوير الجينات. 16, 720–728 (2002).

تابارا ، هـ وآخرون. الجين rde-1 ، تدخل RNA ، وإسكات الينقولات في C. ايليجانس. زنزانة 99, 123–132 (1999).

Kawamata، T. & amp Tomari، Y. مما يجعل RISC. اتجاهات Biochem. علوم. 35, 368–376 (2010).

Elkayam، E. et al. هيكل الأرجونوت -2 البشري في مركب مع مير -20 أ. زنزانة 150, 100–110 (2012).

Nakanishi، K.، Weinberg، D. E.، Bartel، D.P & amp Patel، D.J. هيكل الخميرة Argonaute مع دليل RNA. طبيعة سجية 486, 368–374 (2012).

Schirle ، N.T. & amp MacRae ، I.J. التركيب البلوري للأرجونوت البشري 2. علم 336, 1037–1040 (2012).

Song ، J. J. ، Smith ، S. K. ، Hannon ، G. J. & amp Joshua-Tor ، L. علم 305, 1434–1437 (2004).

Ma ، J.B et al. الأساس الهيكلي للاعتراف الخاص بنهاية 5′ لدليل RNA بواسطة A. fulgidus بروتين Piwi. طبيعة سجية 434, 666–670 (2005).

Parker ، J. S. ، Roe ، S. M. & amp Barford ، D. رؤى هيكلية في التعرف على الرنا المرسال من مجمع دليل PIWI domain-siRNA. طبيعة سجية 434, 663–666 (2005).

Wang ، Y. ، Sheng ، G. ، Juranek ، S. ، Tuschl ، T. & amp Patel ، D.J. هيكل مجمع إسكات الأرجونوت الذي يحتوي على دليل خيوط. طبيعة سجية 456, 209–213 (2008).

Frank ، F. ، Sonenberg ، N. & amp Nagar ، B. الأساس الهيكلي للاعتراف الخاص بقاعدة 5′-nucleotide الخاص بدليل RNA بواسطة AGO2 البشري. طبيعة سجية 465, 818–822 (2010).

وانج واي وآخرون. هيكل مجمع إسكات الأرجونوت مع دليل DNA يحتوي على بذرة و RNA مستهدف مزدوج. طبيعة سجية 456, 921–926 (2008).

وانج واي وآخرون. تنوي وانتشار وانقسام الحمض النووي الريبي المستهدف في مجمعات إسكات Ago. طبيعة سجية 461, 754–761 (2009).

ليو ، جيه وآخرون. Argonaute2 هو المحرك الحفاز للثدييات RNAi. علم 305, 1437–1441 (2004).

Cheloufi، S.، Dos Santos، C.O.، Chong، M.M & amp Hannon، G.J. طبيعة سجية 465, 584–589 (2010).

Su، H.، Trombly، M. I.، Chen، J. & amp Wang، X. الوظائف الأساسية والمتداخلة للثدييات Argonautes في إسكات الرنا الميكروي. تطوير الجينات. 23, 304–317 (2009).

Modzelewski، A. J.، Holmes، R. J.، Hilz، S.، Grimson، A. & amp Cohen، P. E. AGO4 ينظم الدخول إلى الانقسام الاختزالي ويؤثر على إسكات الكروموسومات الجنسية في السلالة الجرثومية للذكور. ديف. زنزانة 23, 251–264 (2012).

Forstemann، K.، Horwich، M. D.، Wee، L.، Tomari، Y. & amp Zamore، P. D. ذبابة الفاكهة يتم فرز microRNAs إلى مجمعات أرجونوت متميزة وظيفيًا بعد الإنتاج بواسطة dicer-1. زنزانة 130, 287–297 (2007).

Okamura ، K. ، Ishizuka ، A. ، Siomi ، H. & amp Siomi ، M. C. أدوار مميزة لبروتينات الأرجونوت في مسارات انقسام الحمض النووي الريبي الصغيرة الموجهة بالـ RNA. تطوير الجينات. 18, 1655–1666 (2004).

Tomari، Y.، Du، T. & amp Zamore، P. D. Sorting of ذبابة الفاكهة RNAs الصغيرة إسكات. زنزانة 130, 299–308 (2007).

التشيك ، ب وآخرون. القواعد الهرمية لتحميل Argonaute بتنسيق ذبابة الفاكهة. مول. زنزانة 36, 445–456 (2009).

غيلديال ، إم ، شو ، جي ، سيتز ، إتش ، وينغ ، زد ، أمبير زامور ، بي دي فرز من ذبابة الفاكهة الصغيرة إسكات أقسام الحمض النووي الريبي جزيئات microRNA * في مسار تدخل الحمض النووي الريبي. RNA 16, 43–56 (2010).

Kawamata ، T. ، Seitz ، H. & amp Tomari ، Y. المحددات الهيكلية لـ miRNAs لتحميل RISC والفك المستقل عن التقطيع. هيكل الطبيعة. مول. بيول. 16, 953–960 (2009).

Okamura، K.، Liu، N. & amp Lai، E.C. آليات مميزة لاختيار خيوط microRNA بواسطة ذبابة الفاكهة أرجونوتس. مول. زنزانة 36, 431–444 (2009).

Jannot، G.، Boisvert، M. E.، Banville، I.H & amp Simard، M. J. تساهم ميزتان جزيئيتان في خصوصية Argonaute لمسارات microRNA و RNAi في C. ايليجانس. RNA 14, 829–835 (2008).

شتاينر ، إف إيه وآخرون. تحدد السمات الهيكلية لسلائف الحمض النووي الريبي الصغيرة تحميل أرجونوت في أنواع معينة انيقة. هيكل الطبيعة. مول. بيول. 14, 927–933 (2007).

أزوما-موكاي ، إيه وآخرون. توصيف Argonautes الإنسان الذاتية وشركائها من mRNA في إسكات RNA. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 105, 7964–7969 (2008).

مايستر ، ج. وآخرون. يتوسط الإنسان Argonaute2 انقسام الحمض النووي الريبي المستهدف بواسطة miRNAs و siRNAs. مول. زنزانة 15, 185–197 (2004).

Dueck ، A. ، Ziegler ، C. ، Eichner ، A. ، Berezikov ، E. & amp Meister ، G. microRNAs المرتبطة ببروتينات الأرجونوت البشرية المختلفة. الدقة الأحماض النووية. 40, 9850–9862 (2012).

يودا ، م وآخرون. مسارات تجميع RISC البشرية المعتمدة على ATP. هيكل الطبيعة. مول. بيول. 17, 17–23 (2010).

ليو ، واي وآخرون. C3PO ، نوكلياز داخلي يعزز RNAi من خلال تسهيل تنشيط RISC. علم 325, 750–753 (2009).

Pham، J.W، Pellino، J.L، Lee، Y. S.، Carthew، R.W & amp Sontheimer، E.J. ذبابة الفاكهة. زنزانة 117, 83–94 (2004).

توماري ، واي وآخرون. عيوب تجميع RISC في ذبابة الفاكهة أرميتاج متحولة رني. زنزانة 116, 831–841 (2004).

Gregory، R. I.، Chendrimada، T. P.، Cooch، N. & amp Shiekhattar، R. Human RISC يزاوجان تكوين الحمض النووي الريبي الميكروي وإسكات الجينات بعد النسخ. زنزانة 123, 631–640 (2005).

MacRae ، I. J. ، Ma ، E. ، Zhou ، M. ، Robinson ، C.V & amp Doudna ، J. A. في إعادة تشكيل المختبر لمركب تحميل RISC البشري. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 105, 512–517 (2008).

Maniataki، E. & amp Mourelatos، Z. آلة تجميع بشرية ، مستقلة عن ATP ، RISC تغذيها pre-miRNA. تطوير الجينات. 19, 2979–2990 (2005).

Miyoshi، K.، Tsukumo، H.، Nagami، T.، Siomi، H. & amp Siomi، M.C.Slicer function of ذبابة الفاكهة Argonautes ومشاركتها في تشكيل RISC. تطوير الجينات. 19, 2837–2848 (2005).

Gredell، J. A.، Dittmer، M. J.، Wu، M.، Chan، C. & amp Walton، S. P. التعرف على عدم تناسق siRNA بواسطة بروتين رابط TAR RNA. الكيمياء الحيوية 49, 3148–3155 (2010).

Noland، C. L.، Ma، E. & amp Doudna، J. A. siRNA إعادة تحديد موضع لاختيار حبلا الدليل بواسطة مجمعات Dicer البشرية. مول. زنزانة 43, 110–121 (2011).

Liu، X.، Jin، D. Y.، McManus، M.T & amp Mourelatos، Z. السلائف microRNA المبرمجة لإسكات مسارات التجميع المعقدة في الثدييات. مول. زنزانة 46, 507–517 (2012).

Betancur، J.G & amp Tomari، Y. Dicer يمكن الاستغناء عنها للتحميل غير المتماثل RISC في الثدييات. RNA 18, 24–30 (2012).

يي ، إكس وآخرون. هيكل C3PO وآلية تفعيل RISC البشري. هيكل الطبيعة. مول. بيول. 18, 650–657 (2011).

Diederichs، S. & amp Haber، D. A. دور مزدوج للأجناس في معالجة microRNA وتنظيم ما بعد النسخ لتعبير microRNA. زنزانة 131, 1097–1108 (2007).

Leuschner، P. J.، Ameres، S. L.، Kueng، S. & amp Martinez، J. ممثل EMBO. 7, 314–320 (2006).

Matranga ، C. ، Tomari ، Y. ، Shin ، C. ، Bartel ، D. P. & amp Zamore ، P. D. يسهل انشقاق حبلا الركاب تجميع siRNA في مجمعات إنزيم RNAi المحتوية على Ago2. زنزانة 123, 607–620 (2005).

Rand، T. A.، Petersen، S.، Du، F. & amp Wang، X. Argonaute2 يشق الخيط المضاد للدليل من siRNA أثناء تنشيط RISC. زنزانة 123, 621–629 (2005).

Nykanen ، A. ، Haley ، B. & amp Zamore ، P. D. متطلبات ATP وهيكل RNA صغير متداخل في مسار تداخل RNA. زنزانة 107, 309–321 (2001).

إيواساكي ، إس وآخرون. تتوسط ماكينات الكابينة Hsc70 / Hsp90 في تحميل RISC المعتمد على ATP لوحدات RNA المزدوجة الصغيرة. مول. زنزانة 39, 292–299 (2010).

Miyoshi، K.، Miyoshi، T.، Hartig، J.V، Siomi، H. & amp Siomi، M. ذبابة الفاكهة. RNA 16, 506–515 (2010).

Han ، B.W ، Hung ، J.H ، Weng ، Z. ، Zamore ، P. D. & amp Ameres ، S. L. ذبابة الفاكهة أرجونوت 1. بالعملة. بيول. 21, 1878–1887 (2011).

ليو ، ن. وآخرون. يتحكم Nibbler exoribonuclease في معالجة 3 end من microRNAs في ذبابة الفاكهة. بالعملة. بيول. 21, 1888–1893 (2011).

Khvorova ، A. ، Reynolds ، A. & amp Jayasena ، S. D. تظهر siRNAs الوظيفية و miRNAs انحيازًا في حبلا. زنزانة 115, 209–216 (2003).

شوارتز ، دي إس وآخرون. عدم التناسق في تجميع مجمع إنزيم RNAi. زنزانة 115, 199–208 (2003).

Hu ، H. Y. et al. ميزات التسلسل المرتبطة باختيار خيوط microRNA في البشر والذباب. علم الجينوم BMC 10, 413 (2009).

لاو ، إن سي ، ليم ، إل بي ، وينشتاين ، إي جي وأم بارتل ، دي بي فئة وفيرة من الحمض النووي الريبي الصغير مع أدوار تنظيمية محتملة في أنواع معينة انيقة. علم 294, 858–862 (2001).

Wu ، H. ، Ye ، C. ، Ramirez ، D. & amp Manjunath ، N. المعالجة البديلة لنصوص الرنا الميكروي الأولية بواسطة Drosha تولد 5 نهاية تباين من microRNA الناضج. بلوس واحد 4، e7566 (2009).

Qi ، H. H. et al. ينظم Prolyl 4-hydroxylation استقرار الأرجونوت 2. طبيعة سجية 455, 421–424 (2008).

وو ، سي وآخرون. يعمل نقص الأكسجة على تقوية إسكات الجينات بوساطة microRNA من خلال تعديل ما بعد الترجمة لـ Argonaute. مول. زنزانة. بيول. 31, 4760–4774 (2011).

تسهل Zeng ، Y. ، Sankala ، H. ، Zhang ، X. & amp Graves ، P. R. Phosphorylation of Argonaute 2 at serine-387 توطينها إلى هيئات المعالجة. بيوتشيم. ج. 413, 429–436 (2008).

هورمان ، إس آر وآخرون. تعمل فسفرة الأرجونوت 2 بوساطة Akt على تقليل الانقسام وتنظيم القمع الترجمي لأهداف الرنا الميكروي. مول. زنزانة 50, 356–367 (2013).

شين ، جيه وآخرون. يعدل EGFR نضوج الرنا الميكروي استجابة لنقص الأكسجة من خلال فسفرة AGO2. طبيعة سجية 497, 383–387 (2013).

روديل ، إس وآخرون. تؤثر الفسفرة لبروتينات الأرجونوت البشرية على ارتباط الحمض النووي الريبي الصغير. الدقة الأحماض النووية. 39, 2330–2343 (2011).

Mazumder، A.، Bose، M.، Chakraborty، A.، Chakrabarti، S. & amp Bhattacharyya، S.N. الانعكاس العابر للقمع بوساطة ميرنا يتحكم في تنشيط البلاعم. ممثل EMBO. 14, 1008–1016 (2013).

ليونج ، إيه ك وآخرون. ينظم Poly (ADP-ribose) استجابات الإجهاد ونشاط microRNA في السيتوبلازم. مول. زنزانة 42, 489–499 (2011).

سيو ، جي جي وآخرون. تثبيط متبادل بين الإشارات المضادة للفيروسات داخل الخلايا وآلية RNAi في خلايا الثدييات. ميكروب مضيف الخلية 14, 435–445 (2013).

Rybak، A. et al. إن فأرة الجين الهدف Let-7 lin-41 عبارة عن خلية جذعية خاصة بـ E3 ubiquitin ligase لبروتين مسار miRNA Ago2. خلية الطبيعة بيول. 11, 1411–1420 (2009).

Johnston، M.، Geoffroy، M.C، Sobala، A.، Hay، R. & amp Hutvagner، G. HSP90 يعمل البروتين على تثبيت مجمعات الأرجونوت المفرغة والأجسام P المجهرية في الخلايا البشرية. مول. بيول. زنزانة 21, 1462–1469 (2010).

Smibert ، P. ، Yang ، J. S. ، Azzam ، G. ، Liu ، J.L & amp Lai ، E.C. هيكل الطبيعة. مول. بيول. 20, 789–795 (2013).

Bronevetsky، Y. et al. يؤدي تنشيط الخلايا التائية إلى تحلل البروتوزوم في الأرجونوت وإعادة التشكيل السريع لذخيرة الرنا الميكروي. ياء إكسب. ميد. 210, 417–432 (2013).

Loedige، I.، Gaidatzis، D.، Sack، R.، Meister، G. & amp Filipowicz، W. بروتين TRIM-NHL للثدييات TRIM71 / LIN-41 هو مثبط لوظيفة الرنا المرسال. الدقة الأحماض النووية. 41, 518–532 (2013).

تشانغ ، هـ م وآخرون. يتعاون Trim71 مع microRNAs لقمع تعبير Cdkn1a وتعزيز تكاثر الخلايا الجذعية الجنينية. طبيعة كومون. 3, 923 (2012).

Chen، J.، Lai، F. & amp Niswander، L. إن ubiquitin ligase mLin41 يعزز مؤقتًا صيانة الخلايا السلفية العصبية من خلال إشارات FGF. تطوير الجينات. 26, 803–815 (2012).

Martinez ، N.J. & amp Gregory ، R. I. يقترن تعبير Argonaute2 بعد النسخ إلى وفرة الرنا الميكروي. RNA 19, 605–612 (2013).

Ryan، B. M.، Robles، A.I & amp Harris، C.C. التباين الجيني في شبكات microRNA: الآثار المترتبة على أبحاث السرطان. القس الطبيعة. السرطان 10, 389–402 (2010).

كالين ، جي إيه وآخرون. توقيع الرنا الميكروي المرتبط بالتشخيص والتقدم في ابيضاض الدم الليمفاوي المزمن. إنجل. جيه ميد. 353, 1793–1801 (2005).

تيان ، تي وآخرون. يرتبط المتغير الجيني الوظيفي في microRNA-196a2 بزيادة التعرض لسرطان الرئة في اللغة الصينية. السرطان Epidemiol. المؤشرات الحيوية السابق. 18, 1183–1187 (2009).

Jazdzewski، K. et al. تساهم الرنا الميكروي الناضج متعدد الأشكال من حبلا الركاب قبل مير -146 أ في الإصابة بسرطان الغدة الدرقية. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 106, 1502–1505 (2009).

Jazdzewski، K. et al. يقلل SNP الشائع في ما قبل miR-146a من تعبير miR الناضج ويؤدي إلى الإصابة بسرطان الغدة الدرقية الحليمي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 105, 7269–7274 (2008).

Ameres، S. L. & amp Zamore، P. D. تنويع تسلسل الحمض النووي الريبي ووظيفته. القس الطبيعة مول. خلية بيول. 14, 475–488 (2013).

باسكينيلي ، إيه إي وآخرون.الحفاظ على التسلسل والتعبير الزمني للـ let-7 غير المتجانسة RNA التنظيمي. طبيعة سجية 408, 86–89 (2000).

سوه ، إم آر وآخرون. تعبر الخلايا الجذعية الجنينية البشرية عن مجموعة فريدة من الرنا الميكروي. ديف. بيول. 270, 488–498 (2004).

طومسون ، جيه إم وآخرون. تنظيم واسع النطاق بعد النسخ من الرنا الميكروي وآثاره على السرطان. تطوير الجينات. 20, 2202–2207 (2006).

Wulczyn ، F. G. et al. تنظيم ما بعد النسخ لـ let-7 microRNA أثناء مواصفات الخلية العصبية. FASEB J. 21, 415–426 (2007).

هيو ، آي وآخرون. يتوسط Lin28 في uridylation الطرفي لـ let-7 السلائف microRNA. مول. زنزانة 32, 276–284 (2008).

نيومان ، إم إيه ، طومسون ، جي إم أند هاموند ، إس إم.يتفاعل لين 28 مع حلقة السلائف Let-7 يتوسط معالجة microRNA المنظمة. RNA 14, 1539–1549 (2008).

Rybak، A. et al. تتحكم حلقة التغذية الراجعة التي تشتمل على lin-28 و let-7 في النضج المسبق لـ let-7 أثناء التزام الخلايا الجذعية العصبية. خلية الطبيعة بيول. 10, 987–993 (2008).

Viswanathan ، S.R ، Daley ، G. Q. & amp Gregory ، R. I. الحصار الانتقائي لمعالجة microRNA بواسطة Lin28. علم 320, 97–100 (2008).

لوغلين ، إف إي وآخرون. الأساس الهيكلي للتعرف قبل السماح لـ 7 miRNA بواسطة مفاصل الزنك لعامل تعدد القدرات Lin28. هيكل الطبيعة. مول. بيول. 19, 84–89 (2012).

Nam ، Y. ، Chen ، C. ، Gregory ، R. I. ، Chou ، J. J. & amp Sliz ، P. الأساس الجزيئي لتفاعل let-7 microRNAs مع Lin28. زنزانة 147, 1080–1091 (2011).

هاجان ، ج. ب ، بيسكونوفا ، إ. وأمبير جريجوري ، آر آي. يقوم Lin28 بتجنيد TUTase Zcchc11 لمنع نضج let-7 في الخلايا الجذعية الجنينية للفأر. هيكل الطبيعة. مول. بيول. 16, 1021–1025 (2009).

هيو ، آي وآخرون. يقوم TUT4 بالتنسيق مع Lin28 بقمع التولد الحيوي للـ microRNA من خلال uridylation ما قبل microRNA. زنزانة 138, 696–708 (2009).

تشانغ ، إتش إم ، تريبوليت ، آر ، ثورنتون ، جي إي & أمبير غريغوري ، آر آي دور لمتلازمة بيرلمان Dis3lease Dis3l2 في مسار Lin28-let-7. طبيعة سجية 497, 244–248 (2013).

Ustianenko، D. et al. يستهدف Mammalian DIS3L2 exoribonuclease السلائف uridylated لـ let-7 miRNAs. RNA 19, 1632–1638 (2013).

هيو ، آي وآخرون. أحادية uridylation من قبل microRNA كخطوة رئيسية في التكاثر الحيوي للمجموعة II let-7 microRNAs. زنزانة 151, 521–532 (2012).

كاتوه ، ت. وآخرون. الاستقرار الانتقائي للرنا الميكروي للثدييات بواسطة 3 ′ adenylation بوساطة بولي السيتوبلازميك (A) polymerase GLD-2. تطوير الجينات. 23, 433–438 (2009).

باكس ، إس وآخرون. يكشف تدهور الرنا الميكروي المضيف بواسطة بوليميراز فيروس الجدري بولي (A) عن مثيلة الحمض النووي الريبي الطرفية كآلية واقية مضادة للفيروسات. ميكروب مضيف الخلية 12, 200–210 (2012).

يانغ ، دبليو وآخرون. تعديل معالجة microRNA والتعبير من خلال تحرير RNA بواسطة نزع الأمين ADAR. هيكل الطبيعة. مول. بيول. 13, 13–21 (2006).

Kawahara ، Y. ، Zinshteyn ، B. ، Chendrimada ، T. P. ، Shiekhattar ، R. & amp Nishikura ، K. ممثل EMBO. 8, 763–769 (2007).

Xhemalce، B.، Robson، S.C & amp Kouzarides، T. Human RNA methyltransferase BCDIN3D ينظم معالجة microRNA. زنزانة 151, 278–288 (2012).

Ruegger، S. & amp Grosshans، H. MicroRNA turnover: متى وكيف ولماذا. اتجاهات Biochem. علوم. 37, 436–446 (2012).

سوزوكي ، إتش آي وآخرون. يعاكس الريبونوكلياز MCPIP1 المقامر وينهي التولد الحيوي للـ microRNA من خلال تحلل الرنا الميكروي السلائف. مول. زنزانة 44, 424–436 (2011).

أبتون ، ج.ب وآخرون. يشق IRE1α تحديد microRNAs أثناء إجهاد ER لإلغاء ترجمة ترجمة caspase-2 proapoptotic. علم 338, 818–822 (2012).

Ramachandran، V. & amp Chen، X. تدهور الرنا الميكروي بواسطة عائلة من نوكليازات exoribonucleases في أرابيدوبسيس. علم 321, 1490–1492 (2008).

Chatterjee، S.، Fasler، M.، Bussing، I. & amp Grosshans، H. C. ايليجانس. ديف. زنزانة 20, 388–396 (2011).

Chatterjee، S. & amp Grosshans، H. معدل الدوران النشط يعدل نشاط microRNA الناضج في أنواع معينة انيقة. طبيعة سجية 461, 546–549 (2009).

كرول ، ج. وآخرون. يكشف توصيف الرنا الميكروي الشبكي الخاضع للضوء عن دوران سريع كخاصية مشتركة للـ microRNAs العصبية. زنزانة 141, 618–631 (2010).

داس ، إس ك وآخرون. يقوم فوسفوريلاز البولينيوكليوتيد البشري بشكل انتقائي وتفضيلي بتحطيم microRNA-221 في خلايا الورم الميلانيني البشري. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 107, 11948–11953 (2010).

توماس ، إم إف وآخرون. ينظم Eri1 توازن الرنا الميكروي وتطور الخلايا الليمفاوية للفأر والوظيفة المضادة للفيروسات. دم 120, 130–142 (2012).

ليبري ، ف. وآخرون. يشفر الفيروس المضخم للخلايا Murine مثبط miR-27 متخفيًا كهدف. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 109, 279–284 (2012).

Ameres، S.L et al. الهدف من RNA التشذيب والذيل لإسكات RNAs الصغيرة. علم 328, 1534–1539 (2010).

Baccarini، A. et al. يكشف التحليل الحركي عن مصير الرنا الميكروي الذي يتبع التنظيم المستهدف في خلايا الثدييات. بالعملة. بيول. 21, 369–376 (2011).

Xie ، J. et al. تثبيط فعال طويل المدى لوظيفة الرنا الميكروي في الفئران باستخدام ناقلات rAAV. طرق الطبيعة 9, 403–409 (2012).

Cazalla، D.، Yario، T. & amp Steitz، J.A Down-Regulation of a host microRNA by a Herpesvirus saimiri noncoding RNA. علم 328, 1563–1566 (2010).

لي ، إس وآخرون. يؤدي التحلل الانتقائي للمضيفة MicroRNAs بواسطة الحمض النووي الريبي غير المشفر HCMV بين الجينات إلى تسريع إنتاج الفيروس. ميكروب مضيف الخلية 13, 678–690 (2013).

Xie ، M. & amp Steitz ، J. A. التكاثر الحيوي للحمض الريبي النووي الميكروي متعدد الاستخدامات في الحيوانات وفيروساتها. RNA بيول. http://dx.doi.org/10.4161/rna.28985 (2014).

Berezikov ، E. ، Chung ، W. J. ، Willis ، J. ، Cuppen ، E. & amp Lai ، E.C Mammalian mirtron genes. مول. زنزانة 28, 328–336 (2007).

Okamura، K.، Hagen، J.W، Duan، H.، Tyler، D. M. & amp Lai، E.C. مسار mirtron يولد جزيئات RNA تنظيمية من فئة microRNA في ذبابة الفاكهة. زنزانة 130, 89–100 (2007).

روبي ، جي جي ، جان ، سي إتش آند بارتل ، دي بي سلائف Intronic microRNA التي تتجاوز معالجة Drosha. طبيعة سجية 448, 83–86 (2007).

Flynt، A. S.، Greimann، J.C، Chung، W.J، Lima، C.D & amp Lai، E.C MicroRNA biogenesis عن طريق الربط والتشذيب الخارجي في ذبابة الفاكهة. مول. زنزانة 38, 900–907 (2010).

إندر ، سي وآخرون. snoRNA بشري بوظائف تشبه microRNA. مول. زنزانة 32, 519–528 (2008).

Cazalla، D.، Xie، M. & amp Steitz، J. A. يستخدم فيروس الهربس الرئيسى المركب المتكامل لتوليد microRNAs الفيروسية. مول. زنزانة 43, 982–992 (2011).

بوجيرد ، هـ.ب.آخرون. يستخدم فيروس الهربس في الثدييات التعبير غير الكنسي وآليات المعالجة لتوليد ميكرو آر إن إيه فيروسي. مول. زنزانة 37, 135–142 (2010).

سيفوينتس ، دي وآخرون. يتطلب مسار معالجة miRNA الجديد المستقل عن Dicer نشاطًا تحفيزيًا لـ Argonaute2. علم 328, 1694–1698 (2010).

يانغ ، ج.س وآخرون. يوفر الفقاريات المحفوظة mir-451 منصة للتكوين الحيوي microRNA المستقل عن Dicer ، بوساطة Ago2. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 107, 15163–15168 (2010).

يودا ، م وآخرون. بولي (A) محدد الريبونوكلييز يتوسط 3′-end تقليم من السلائف المجهري Argonaute2 المشقوق. مندوب الخلية. 5, 715–726 (2013).

يقترح التحليل الجينومي Shenoy، A. & amp Blelloch، R. أن زعزعة استقرار الرنا المرسال بواسطة المعالج الدقيق متخصص في التنظيم التلقائي لـ Dgcr8. بلوس واحد 4، e6971 (2009).

Triboulet ، R. ، Chang ، H. M. ، Lapierre ، R.J & amp Gregory ، R. I. التحكم بعد النسخ لتعبير DGCR8 بواسطة المعالج الدقيق. RNA 15, 1005–1011 (2009).

كارجينوف ، إف في وآخرون. تعتمد مواقع الانقسام المتنوعة للنووية في نسخة الثدييات على microRNAs و Drosha و nucleases الإضافية. مول. زنزانة 38, 781–788 (2010).

Lin، Y.T & amp Sullivan، C. S. توسيع دور Drosha لتنظيم التعبير الجيني الفيروسي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 108, 11229–11234 (2011).

هيراس ، إس آر وآخرون. يتحكم المعالج الدقيق في نشاط الينقولات الرجعية للثدييات. هيكل الطبيعة. مول. بيول. 20, 1173–1181 (2013).

Macias، S. et al. يكشف DGCR8 HITS-CLIP عن وظائف جديدة للمعالج الدقيق. هيكل الطبيعة. مول. بيول. 19, 760–766 (2012).

Luhur ، A. ، Chawla ، G. ، Wu ، Y. C. ، Li ، J. & amp Sokol ، N. S. Drosha المستقل عن مسار DGCR8 / Pasha ينظم التشكل العصبي. بروك. ناتل أكاد. علوم. الولايات المتحدة الأمريكية 111, 1421–1426 (2014).

كانيكو ، هـ وآخرون. يؤدي عجز DICER1 إلى سمية Alu RNA في الضمور البقعي المرتبط بالعمر. طبيعة سجية 471, 325–330 (2011).

هو ، كيو وآخرون. الجيل المعتمد على DICER و AGO3 من الحمض النووي الريبي DR2 Alu الناجم عن حمض الريتينويك ينظم تكاثر الخلايا الجذعية البشرية. هيكل الطبيعة. مول. بيول. 19, 1168–1175 (2012).

مايستر ، بروتينات جي أرجونوت: رؤى وظيفية وأدوار ناشئة. القس الطبيعة جينيه. 14, 447–459 (2013).

Karamyshev، A. L. et al. يؤدي تفاعل SRP غير الفعال مع سلسلة ناشئة إلى تشغيل مسار مراقبة جودة mRNA. زنزانة 156, 146–157 (2014).

Ipsaro ، J. J. ، Haase ، A. D. ، Knott ، S.R ، Joshua-Tor ، L. & amp Hannon ، G.J. الكيمياء الحيوية الهيكلية للكوسا تشير إلى أنها نوكلياز في التكوين الحيوي للبيرنا. طبيعة سجية 491, 279–283 (2012).

نيشيماسو وآخرون. هيكل ووظيفة نوكلياز كوسة في التكوين الحيوي للبيرنا. طبيعة سجية 491, 284–287 (2012).

Siomi، M.C، Sato، K.، Pezic، D. & amp Aravin، A. A. PIWI - RNAs الصغيرة المتفاعلة: طليعة الدفاع الجينومي. القس الطبيعة مول. خلية بيول. 12, 246–258 (2011).

Kataoka، N.، Fujita، M. & amp Ohno، M. الارتباط الوظيفي لمجمع المعالجات الدقيقة مع spliceosome. مول. خلية بيول. 29, 3243–3254 (2009).


RNAs دائرية: التكوين والوظيفة

باعتبارها "أطفالًا جددًا على الكتلة" في عائلة RNA غير المشفرة ، فإن RNAs الدائرية (CircRNAs) عبارة عن مجموعة كبيرة من جزيئات الحمض النووي الريبي المقسمة بشكل فريد ، والتي توجد في كل مكان بين حقيقيات النوى وتثبت أنها وظيفية في عدد كبير من السياقات. تاريخيًا ، كان كثيرًا من الأذى بسبب وفرتها المنخفضة نسبيًا وتنوعها العالي ، فقد يكون من المدهش أن تركز العروض التقديمية لخمسة أفراد في الغالب أو بشكل حصري على الجوانب المنفصلة للتكوين الحيوي للحلقات الدائرية ، والتعرف عليها وتنظيمها. قدم البعض على وظائف CircRNA التي لم يسمع بها حتى الآن لأي ncRNA.

أظهرت Mariangela Morlando (Universita di Roma ، روما ، إيطاليا) أنه على الرغم من عدم انتشارها ، إلا أن بعض الجسيمات الحلقية ليست RNAs غير مشفرة على الإطلاق. مثال على ذلك هو Circ-ZNF609 ، تحتفظ هذه الجزيئات الحلقية بمواقع دخول الريبوسوم الداخلية من الرنا المرسال المشابه ، مما يتيح ترجمتها إلى بروتين. كما حددت عامل التكوُّن الحيوي للحلقة الجديدة ، FUS ، الذي ترتبط طفراته المسببة للأمراض في التصلب الجانبي الضموري والتوحد بتشكيل الحمض النووي الريبي المتغير. أبلغ غريغوري جودال (مركز بيولوجيا السرطان ، أديلايد ، أستراليا) عن دور Quaking ، وهو بروتين مرتبط بالحمض النووي الريبي ينظم التكوُّن الحيوي لحلقة الحمض النووي الريبوزي في الانتقال الظهاري - اللحمي المتوسط ​​، وهو نموذج لورم خبيث السرطان. وصف Nikolaus Rajewsky (مركز Max Delbrück للطب الجزيئي ، برلين ، ألمانيا) كيف يمكن استخدام تحرير الجينوم المستند إلى CRISPR-Cas9 لإزالة التعبير عن حلقي واحد خاص بالدماغ ، CDR1as. هذا هو "الإسفنج" للـ microRNA-7 البشري (hsamiR-7) ، والذي ينتج الفئران ذات النمط الظاهري الطبيعي ولكن استجابات عصبية متغيرة بشكل طفيف.

أبلغ سيمون كون (مركز بيولوجيا السرطان ، أديلايد ، أستراليا) عن اكتشاف مهم آخر من خلال إثبات أن الجزيئات الحلقية مفضلة من الناحية المتكافئة لربط أهداف معينة في الخلية. على وجه التحديد ، التفاعلات بين سيرنا من أرابيدوبسيس وموقعه المشابه للحمض النووي عن طريق الاقتران الأساسي التكميلي لإنتاج RNA: هجين DNA ، أو R-loop ، كافٍ لتعزيز التضفير البديل للـ mRNA الخاص به ، مما يؤدي إلى تغيير مورفولوجيا الأزهار. تم دعم قدرة الجزيئات الحلقية على ربط الحمض النووي من قبل إنجريد جرومت ، التي أفادت بأن الرنا الحلقي ، بالإضافة إلى الرناوات الأخرى و الرناوات الخطية ، ترتبط بالحمض النووي دون اقتران أساسي تكميلي في الثلاثية DNA و RNA. ومع ذلك ، فإن الثبات المفرط للجسيمات الحلقية يعني أنها وسطاء فعالون في أي منظر طبيعي ، لا سيما في الكروماتين الديناميكي.

من المعروف منذ فترة طويلة أن فيروسات الحمض النووي الريبي وحيدة الشريطة ، والمعترف بها على أنها كيانات أجنبية ، يمكن أن تحرك الاستجابات المناعية للمضيف. ومع ذلك ، فإن حقيقة أن الجزيئات الحلقية هي متطابقة هيكليًا بواسطة المتحدث الافتتاحي هوارد تشانج (جامعة ستانفورد ، ستانفورد ، الولايات المتحدة الأمريكية) لتفسير أن الجزيئات الحلقية قد تفعل الشيء نفسه. كما يتضح من ChiRP-MS (تحديد شامل لبروتينات ربط الحمض النووي الريبي عن طريق قياس الطيف الكتلي) ، فإن التعرف على الجزيئات الحلقية الذاتية مقابل غير الذاتية يعتمد على تكوينها الحيوي وتمييزها بواسطة العوامل المساعدة للبروتين الداخلي. الأهم من ذلك ، أن استخدام الجزيئات الحلقية يبدو فعالا مثل المواد المساعدة الأيونية المعدنية الحالية في تعزيز الاستجابات المناعية للتلقيح ومنع انتقال الفيروس.

إذا أخذناها معًا ، فقد تعلمنا الكثير عن الجزيئات الحلقية منذ التعرف عليها بشكل منهجي بواسطة NGS في عام 2013. ومن الواضح بشكل متزايد أنها ليست منتجات ثانوية عرضية للتضفير. تقدم المحادثات التي تم تلخيصها أعلاه نظرة ثاقبة حول الطرق التي تشارك بها الجزيئات الحلقية في التطور العصبي والتنكس ، وتطور النبات ، والسرطان. من المؤكد أن الدراسات المتعلقة بكيفية توليد الحمض النووي الريبي ووظائفه على مستوى الكائن الحي سوف تستمر بسرعة في السنوات القادمة.


الكشف الدقيق للغاية عن الرنا الميكروي

لإثبات خصوصية التقدير الكمي لـ Mir-X miRNA ، استخدمنا سلسلة من 8 متغيرات تركيبية متشابهة للغاية من Let7 miRNA. قمنا أولاً بتدوير كل من Let7 miRNAs في عينات منفصلة من خميرة polyA + RNA وقمنا بتوليد cDNA باستخدام تفاعل Mir-X أحادي الأنبوب. قمنا بعد ذلك باختبار لوحة من البادئات الخاصة بالمتغير مع كل عينة (كدنا) لتحديد قدرة كل من التمهيدي و rsquos على تحديد الأنواع الفرعية Let7 في عينة (كدنا) على وجه التحديد وبشكل فردي. على الرغم من درجات التشابه العالية بين المتغيرات والبادئات ، كان Mir-X qPCR محددًا للغاية في اكتشاف كل متغير من Let7.


أساليب

ثقافة الخلية والعدوى

تم الحصول على خلايا Huh7 و HEK293 من مختبر Witold Filipowicz. كانت الخلايا خالية من تلوث الميكوبلازما وتم تربيتها في وسط DMEM يحتوي على 2 ملي L-glutamine و 10 ٪ FCS معطل بالحرارة كما هو موضح سابقًا. جميع الكواشف المزروعة للخلايا كانت من Life Technologies. تم إجراء جميع عمليات نقل البلازميد باستخدام Lipofectamine 2000 و siRNAs باستخدام RNAiMax (تقنيات الحياة) باستخدام تعليمات الشركة المصنعة.

في خلايا HEK293 ، تم نقل 1 ميكروغرام من بلازميدات ترميز mRNA المستهدفة في تنسيق ستة آبار مع 5 pmol pre-miR-122 (تقنيات الحياة) أو 500 نانوغرام قبل miR-122 ترميز بلازميد. أربعمائة نانوجرام من مادة تركيبية في المختبر- تم نقل mRNAs الهدف المكتوب بتنسيق 24 جيدًا ، ما لم يتم وصف خلاف ذلك. تم إجراء انسداد النسخ باستخدام 10 ميكروغرام مل −1 α-Amanitin (Calbiochem). للتجارب باستخدام بنيات IRE ، تمت إضافة 50 ميكرومتر من Hemin (Sigma) أو 100 ميكرومتر DFMO (Calbiochem) إلى وسائط ثقافة الخلية للوقت المطلوب. بالنسبة للتجارب التي تستخدم التركيبات التي تحفز على التتراسيكلين ، تمت زراعة خلايا TET-ON HEK293 ذات التركيبات التعبيرية الحثية في DMEM المكملة بـ 10 ٪ من FCS المعتمدة من TET (Clontech) وتم إجراء تحريض التعبير عن المنتج الجيني المعني لفترات زمنية محددة باستخدام 300 نانوغرام مل -1 دوكسيسيكلين (سيغما) 47.

تم نقل siDICER1 عند تركيز 30 نانومتر في شكل 24 بئر و siCAT-1 عند 50 نانومتر بنفس التنسيق. تم شراء CAT-1 siRNA (5′- CCAGCCUUAUAGCUGUUCU -3 ′) من Eurogentec. تم شراء Dharmacon SMARTpool ON-TARGETplus siRNAs مقابل DICER1 من Thermo Scientific. تم إدراج جميع البلازميدات المستخدمة في الدراسة في الجدول التكميلي 1.

Huh7 الجوع والتغذية

بالنسبة لتجارب التجويع ، تم تحضين خلايا Huh7 المزروعة في DMEM الطبيعي في محلول ملح متوازن من Hanks (HBSS) مكملًا بـ 10 ٪ FCS مملوءة بالديال لمدة 4 ساعات تليها خلايا `` إعادة التغذية '' بـ HBSS المكملة بـ 10 ٪ FCS طبيعي مقابل 2 إضافي. ح. تم استخدام HBSS مع 10 ٪ FCS عادي للتحكم في "التغذية".

فحص Luciferase

تم قياس أنشطة Renilla luciferase (RL) و Firefly luciferase (FF) باستخدام مجموعة الفحص المزدوجة Luciferase (Promega) ، باتباع إرشادات الشركة المصنعة ، على قارئ اللوحة VICTOR X3 المزود بحقن (Perkin Elmer). تم استخدام نسبة Firefly luciferase التي تم تطبيعها مستويات التعبير Renilla luciferase للتحكم في المراسل لحساب قمع أضعاف.

في التجربة باستخدام المراسلين المستهدفين لـ GFP ، تم نقل خلايا HEK293 بتنسيق 24 بئرًا مع 250 نانوغرام من pmiR-122 ، و 100 نانوغرام من لوسيفيراز اليراع ، و 500 نانوغرام من GFP-con أو GFP-3 × bulge-miR-122 مع 10 نانوغرام. من مراسل luciferase RL-con أو RL-3 × bulge-miR-122 أو RL-3 × bulge-let-7a (تحكم إضافي). بعد 24 ساعة تم تقسيم الخلايا وقياس نشاط اللوسيفيراز عند 48 ساعة. تم رسم قيم RL التي تم تطبيعها في Firefly. بالنسبة لمراسل GFP-3 × bulge-let-7a ، تم إجراء نفس عمليات النقل تمامًا باستثناء مراسل GFP-3 × bulge-miR-122.

عزل الحمض النووي الريبي والنشاف الشمالي

تم عزل مجموع الحمض النووي الريبي باستخدام كاشف TRIzol (تقنيات الحياة). تم عزل الحمض النووي الريبي الصغير باستخدام مجموعة عزل ميرنا ميرنا (تقنيات الحياة) وفقًا لتعليمات الشركة المصنعة. تم إجراء النشاف الشمالي للحمض النووي الريبي الخلوي الكلي (5-10 ميكروغرام) كما وصفته بيلاي وآخرون. 48. باختصار ، تم فصل كمية متساوية من إجمالي الحمض النووي الريبي في 15٪ Urea-PAGE متبوعًا بالنقل الكهربائي إلى غشاء النايلون. للكشف ، تم استخدام γ 32 P المسمى 22-nt miRCURY تحقيقات LNA التكميلية لـ miR-122 و let-7a (Exiqon) أو مسبار DNA التكميلي لـ miR-16 ، U6 snRNA. تم إجراء تصوير الفوسفور للبقع في Cyclone Plus Storage Phosphor System (Perkin Elmer). يتم إعطاء إصدارات غير مقصوصة من جميع اللطخات في الشكل التكميلي .7.

الوقت الحقيقي PCR

تم إجراء PCR في الوقت الحقيقي (النسخ العكسي) لـ mRNA باستخدام Mesa Green qPCR Mastermix Plus لـ SYBR Assay-Low ROX (Eurogentec) باستخدام 100-200 نانوغرام من إجمالي الحمض النووي الريبي مع الاشعال المدرجة في الجدول التكميلي 2. كان التحكم المستخدم هو 18S الريبوسوم RNA. لتقدير ميرنا ، تم أخذ 30 نانوغرام من مجموع الحمض النووي الريبي. تم استخدام الاشعال التالية لتضخيم miRNAs المختلفة. على سبيل المثال ، الإنسان let-7a (معرّف الفحص 000377) ، الإنسان miR-122 (معرف الفحص 000445) ، الإنسان miR-122 * (معرف الفحص 002130) ، miR-16 البشري (معرف الفحص 000391) ، الإنسان miR-21 (الفحص تم استخدام المعرف 000397) ، و miR-24 البشري (معرف الفحص 000402) ، و miR-125b البشري (معرف الفحص 000449) ، و U6 snRNA (معرف الفحص 001973) ونظام الفحص ميرنا القائم على الكيمياء التطبيقية Taqman للتجربة. تم إجراء جميع التفاعلات في 7500 Applied Biosystem Real Time System أو BIO-RAD CFX96 Real-Time system. تم ضبط الدورات وفقًا لبروتوكول الشركة المصنعة.

نسخة تحديد الرقم

لتحديد رقم نسخة miR-122 ، أنشأنا منحنىًا قياسيًا باستخدام miR-122 الاصطناعية المنقاة من PAGE. تم رفع خمسة نانوجرام من إجمالي الحمض النووي الريبي من خلايا HEK293 (لا تحتوي على miR-122) باستخدام 10 6-10 10 جزيئات من miR-122 الاصطناعية وتم تحليلها بواسطة PCR في الوقت الفعلي باستخدام مقايسات Taqman miRNA (تقنيات الحياة). لم يتم الحصول على Ct في عنصر تحكم حيث لم تتم إضافة miR-122 الاصطناعية. تم رسم قيم Ct التي تم الحصول عليها للحصول على المنحنى القياسي. تم تحويل قيم Ct التي تم الحصول عليها من عينات التغذية أو التجويع أو المعاد تغذيتها باستخدام 5 و 25 نانوغرام من Huh7 RNA إلى رقم نسخة الجزيء باستخدام المنحنى القياسي. لحساب عدد النسخ من miR-122 لكل خلية Huh7 ، حددنا المبلغ الإجمالي للحمض النووي الريبي الذي تم الحصول عليه لكل خلية Huh7 في ظل ظروف التغذية والتجويع وإعادة التغذية عن طريق إنشاء منحنى قياسي من إجمالي الحمض النووي الريبي مقابل عدد خلايا Huh7 مرة أخرى. للقيام بذلك ، قمنا بحساب الخلايا باستخدام مقياس الكريات وعزل الحمض النووي الريبي بواسطة كاشف TRIzol والحمض النووي الريبي الكلي الكمي باستخدام NanoDrop. كانت القيم التي تم الحصول عليها كما يلي: 34.69 جزء من الغرام (تغذية 4 ساعات) ، 21.55 جزء من الغرام (تجويع 4 ساعات) و 23.19 جزء من الغرام (تمت إعادة تغذيته لمدة ساعتين). كانت هذه القيمة متوافقة إلى حد ما مع Chang وآخرون. 24 حصلوا على 25 بيكوغرام من الحمض النووي الريبي لكل خلية. كان رقم النسخة الذي تم الحصول عليه من خلال طريقتنا القائمة على الوقت الحقيقي لـ Huh7 غير المتعطش (تغذية) بهذا الترتيب من 10 4 (∼ 1.2 × 10 4). كان هذا أقل مما حصل عليه Siegrist وآخرون. 49 ، (3 × 10 4) باستخدام تقنية صفيف الخرزة.

وبالمثل ، تم إنشاء المنحنى القياسي لـ CAT-1 mRNA باستخدام 100 نانوغرام RAW264.7 (خط خلية الفأر) RNA مع 10 6-10 10 جزيئات من في المختبر- نسخ RL-CatA مرنا الذي يحتوي على رينيلا-منطقة تشفير مدمجة في 3′-UTR (القواعد 2،169-4،646) من CAT-1 mRNA البشري. لم ينتج عن تحكم RL-catA ناقص أي تضخيم تم استخدام بادئات خاصة بـ 3′-UTR واستخدمت نفس المجموعة من البادئات لتحديد CAT-1 من 500 نانوغرام من RNA لخلايا Huh7.

الترسيب المناعي

تم إجراء الترسيب المناعي للبروتينات بشكل أساسي وفقًا للبروتوكولات المنشورة 25،50. تم فصل الخلايا في محلول تحلل [20 ملي مولار Tris-HCl pH 7.4 ، 200 ملي مول كلوريد ، 5 ملي مول كلوريد2، 1 ملي ديثيوثريتول (DTT) ، 1 × مثبط الأنزيم البروتيني الخالي من EDTA (روش) ، 5 ملي من فاناديل ريبونوكليوسيد كومبليز (سيغما) ، 0.5٪ تريتون X-100 ، 0.5٪ ديوكسيكولات الصوديوم] عند 4 درجات مئوية لمدة 15 دقيقة ، تليها تطهير المحللة في 3000 ز لمدة 10 دقائق. تم حظر خرزات البروتين G agarose (Invitrogen) بنسبة 5٪ BSA في محلول تحلل لمدة ساعة واحدة ثم تم تحضينها بالجسم المضاد الأولي المطلوب لمدة 3-4 ساعات أخرى قبل إضافة اللياست. تم استخدام التخفيف النهائي من 1:50 (الجسم المضاد: المحللة) للترسيب المناعي. تم إجراء الترسيب المناعي لمدة 16 ساعة عند 4 درجات مئوية. بعد الغسل باستخدام عازلة IP (20 ملم Tris-HCl pH 7.4 ، 150 ملم بوكل ، 5 ملم MgCl2، 1 ملي مولار DTT ، 1 × مثبط البروتياز الخالي من EDTA (Roche)) ، تم تقسيم الخرزات إلى نصفين: أحدهما تعرض لعزل الحمض النووي الريبي باستخدام TRIzol LS والآخر للنشاف الغربي.

مناعي

تم إجراء النشاف الغربي للبروتينات بشكل أساسي كما هو موضح سابقًا. من أجل التكتل المناعي ، تم إخضاع البروتينات الخلوية أو البروتينات المثبطة للمناعة لـ SDS-PAGE ، وتم نقلها إلى غشاء النيتروسليلوز وفحصها بأجسام مضادة محددة. كانت الأجسام المضادة المستخدمة على النحو التالي: anti-AGO2 (Novus Biologicals Cat # H00027161-M01 1: 1،000) ، anti-DICER (Bethyl Cat # A301-936A 1: 5000) ، anti-HA (Roche Cat # 11867431001 1: 1،000) ، β-Actin (Sigma Cat # A3854 1: 10،000) و phospho-eIF2α (تقنية تشوير الخلايا Cat # 9721 1: 500). تم تصوير جميع النشافات الغربية في نظام UVP BioImager 600 المجهز ببرنامج VisionWorks Life Science (UVP) V6.80 وتقدير النطاقات باستخدام نفس البرنامج. يتم تضمين الإصدارات غير المقصوصة من جميع النشافات جنبًا إلى جنب مع مواضع علامة الوزن الجزيئي في الشكل التكميلي .7.

العزلة المتعددة

تم إجراء العزلة الكلية متعددة السلالات كما هو موصوف. لعزل polysome الكلي ، تم تحليل حوالي 6 × 10 6 HEK293 خلية في مخزن مؤقت يحتوي على 10 ملي مولار HEPES درجة الحموضة 8.0 ، 25 ملي مول كلوريد ، 5 ملي MgCl2، 1 مم DTT ، 5 ملي مولار من مركب فاناديل ريبونوكليوسيد ، 1٪ تريتون X-100 ، 1٪ ديوكسيكولات الصوديوم و 1 × كوكتيل مثبط البروتياز الخالي من EDTA (روش) المكمّل بـ Cycloheximide (100 ميكروغرام مل -1 Calbiochem). تم تطهير المحللة في 3000 ز لمدة 10 دقائق تليها جولة أخرى من المقاصة المسبقة عند 20000 ز لمدة 10 دقائق عند 4 درجات مئوية. تم تحميل المحللة الموضحة على وسادة سكروز بنسبة 30 ٪ وطردها فائقًا عند 100000 ز لمدة 1 ساعة عند 4 درجات مئوية. تم جمع المادة الطافية غير متعددة الخصائص من الأعلى. تم غسل وسادة السكروز بمخزن مؤقت (10 ملي مولار HEPES درجة الحموضة 8.0 ، 25 ملي مول كلوريد ، 5 ملي MgCl2، 1 مم DTT) ، فائق الطرد لمدة 30 دقيقة إضافية وتم تعليق الحبيبات متعددة العناصر أخيرًا في المخزن المؤقت متعدد الأشكال (10 مم HEPES درجة الحموضة 8.0 ، 25 ملي بوكل ، 5 ملي MgCl2، 1 مم DTT ، 5 مم فاناديل ريبونوكليوسيد المركب ، 1 × كوكتيل مثبط البروتياز الخالي من EDTA) لعزل الحمض النووي الريبي.

مقايسة انشقاق RISC

تم إجراء اختبار الانقسام RISC بشكل أساسي كما هو موضح في مكان آخر مع تعديلات طفيفة 50،51. تم نقل خلايا HEK293 التي تعبر بشكل ثابت عن FH-AGO2 باستخدام pmiR-122 وبلازميدات تعبير mRNA المستهدفة. لعزل miRISC ، تم تحلل الخلايا ، 48 ساعة بعد تعداء ، في محلول تحلل [10 ملي HEPES درجة الحموضة 7.4 ، 200 ملي مول كلوريد ، 5 ملي مولار MgCl2، 1 مم DTT ، 1 × مثبط البروتياز الخالي من EDTA (Roche) ، 5 ملي مولار من الفاناديل ريبونوكليوزيد (Sigma) ، 1٪ Triton X-100] عند 4 درجات مئوية لمدة 15 دقيقة ، متبوعًا بإزالة المحللة عند 3000 ز لمدة 10 دقائق. تعرض المادة الطافية الموضحة للترسيب المناعي باستخدام هلام تقارب مضاد لـ FLAG M2 (Sigma) لمدة 16 ساعة عند 4 درجات مئوية. تم غسل الحبيبات في محلول IP [20 مللي مولار Tris-HCl pH 7.4 ، 150 مللي مولار بوكل ، 5 مللي مولار MgCl2، 1 مم DTT ، 1 × مثبط البروتياز الخالي من EDTA (Roche)] لثلاث مرات عند 4 درجات مئوية. تمت إزالة miRISC المنقى من الحبيبات باستخدام 3 × FLAG Peptide (Sigma) وفقًا لتعليمات الشركة المصنعة في محلول تنقية RISC (30 مم HEPES درجة الحموضة 7.4 ، 100 ملي بوكل ، 5 ملي MgCl20.5 ملي DTT ، 3٪ جلسرين).

تم تقييم miRISC-122 المنقى بتقارب لانقسام الحمض النووي الريبي المستهدف باستخدام 36 nt RNA 5′- AAAUUCAAACACCAUUGUCACUCCACCAGAUAA -3 تحمل التسلسل التكميلي للنضج miR-122. تم إجراء فحوصات انشقاق الحمض النووي الريبي المستهدف بحجم إجمالي قدره 30 ميكرولتر مع 10 fmol من 5 '32 P-المسمى RNA في مخزن مؤقت للمقايسة (100 ملي كلوريد البوتاسيوم ، 5.75 ملي مولار MgCl2، 2.5 ملي ATP ، 0.5 ملي GTP) وكميات البروتين المكافئة من RISC عند 30 درجة مئوية لمدة 30 دقيقة. تم إجراء عزل الحمض النووي الريبي من خليط التفاعل ، وتم تحليل المنتجات المشقوقة على 12 ٪ تغيير طبيعة 8 M Urea-PAGE وتم تصورها بواسطة التصوير الشعاعي الذاتي.

في المختبر مقايسة تحميل RISC

تم تحضين تقارب FH-AGO2 المنقى على حبات agarose من خلايا HEK293 المستقرة من FH-AGO2 مع 10 نانومتر اصطناعي 5′-فسفرة قبل miR-122 أو pre-let-7a ، و 500 نانوغرام في المختبر- نسخ mRNA الهدف في تفاعل 20 ميكرولتر في المخزن المؤقت للمقايسة [20 مللي مولار Tris-HCl pH 7.5 ، 200 مللي مولار بوكل ، 2 مللي مولار MgCl2، 5٪ جلسرين ، 1 مم DTT ، 40 U RNase inhibitor (Fermentas)] لمدة ساعة واحدة عند 37 درجة مئوية متبوعًا بغسل الحبيبات ثلاث مرات باستخدام محلول IP. تم بعد ذلك تقسيم كل تفاعل إلى نصفين: أحدهما لعزل الحمض النووي الريبي والآخر للنشاف الغربي لـ AGO2.

للمقايسات مع البروتينات المؤتلفة ، تم استخدام 50 نانوغرام من rAGO2 (Sino Biologicals) مع 0.1 U من rDICER1 (مجموعة إنزيم Dicer البشري المؤتلف ، Genlantis) مع الحفاظ على باقي معلمات التفاعل كما هو مذكور أعلاه.

لقياس ارتباط AGO2 و DICER1 على طول 3′-UTR ، تم نقل FH-AGO2 التي تعبر بشكل ثابت عن خلايا HEK293 باستخدام NHA-DICER1 بشكل عابر ومناعة FH-AGO2 مع خرز agarose المضاد لـ FLAG كما هو موصوف من قبل. تمت تصفية FH-AGO2 من خرزات مضادة لـ FLAG مع 3 × FLAG Peptide (Sigma) وتم تحضين miRISC المعزول باستخدام RL-3 × bulge-miR-122 عند 37 درجة مئوية مع 10 نانومتر قبل miR-122 لمدة 60 دقيقة. تم بعد ذلك تقسيم التفاعل إلى نصفين وتم ترسيب مناعي بأجسام مضادة لـ AGO2 ومضادة لـ DICER1 لمدة 3 ساعات عند 4 درجات مئوية. تم غسل الحبيبات وعزل الحمض النووي الريبي باستخدام TRIzolLS متبوعًا بالنسخ العكسي الكمي – PCR باستخدام مجموعة واحدة للأمام ومجموعتين من البادئات العكسية.

لتسجيل عملية DICER1 ، تم تحليل خلايا HEK293 التي تعبر بشكل عابر عن FH-AGO2 و pre-let-7a وتم تحصين FH-AGO2 كما هو موضح سابقًا. تمت تصفية FH-AGO2 من خرزات مضادة لـ FLAG مع 3 × FLAG Peptide (Sigma) وتم تحضين miRISC المعزول باستخدام RL-con أو RL-3 × bulge-let-7a عند 37 درجة مئوية مع 10 نانومتر قبل miR-122 لـ 30 دقيقة. تم عزل الحمض النووي الريبي من التفاعل وتشكلت miR-122 الناضجة كمياً بواسطة PCR في الوقت الحقيقي.

في المختبر النسخ

في المختبر تم إجراء النسخ باستخدام مجموعة mMESSAGE mMACHINE (تقنيات الحياة) و poly A المخلفات التي تم إجراؤها باستخدام مجموعة أدوات Poly (A) (تقنيات الحياة) وفقًا لبروتوكول الشركة المصنعة. لإعداد قالب DNA البلازميد ، RL-con ، RL-1 × bulge-miR-122 ، RL-3 × bulge-miR-122 ، RL-3 × bulge-miR-122 (W5 ′) ، RL-3 × انتفاخ تم هضم -miR-122 (W3 ′) و RL-CatA لمدة 4 ساعات عند 37 درجة مئوية باستخدام DraI (New England Biolabs) وتم هضم RL-3 × bulge-let-7a باستخدام HpaI (New England Biolabs) بقية كان البروتوكول وفقًا لتعليمات الشركة المصنعة. تم تحليل جميع النصوص التي تم الحصول عليها والتحقق من حجمها بواسطة 6 ٪ Urea-PAGE والكشف القائم على بروميد الإيثيديوم.

مقايسة حماية RNase

تم إجراء اختبار حماية RNase كما هو موضح سابقًا 52. تم وضع علامة على مسبار miR-122 RNA الاصطناعي مع γ 32 P ATP باستخدام T4 Polynucleotide kinase (Ferementas) وفقًا لبروتوكول الشركة المصنعة. تم خلط miR-122 المسمى (1.5 pmol 100 fmol radiolabelled و 1.4 pmol 5′-end المسمى بـ ATP البارد) مع 500 fmol من mRNA المستهدف وترسب مع 0.1 vol acetate sodium acetate (pH 5.2) و 2.5 vol ice-cold ethanol for 1 ح عند -80 درجة مئوية. تم إذابة الحمض النووي الريبي المستعاد في 30 ميكرولتر من المخزن المؤقت للتهجين (40 ملي أنابيب درجة الحموضة 6.8 ، 1 ملي مولار EDTA درجة الحموضة 8.0 ، 0.4 مولار كلوريد الصوديوم ، 80 ٪ فورماميد منزوع الأيونات) ، تم تغيير طبيعته عند 85 درجة مئوية لمدة 5 دقائق ثم صلب عند 35 درجة مئوية طوال الليل. تم تبريد الخليط بعد ذلك إلى درجة حرارة الغرفة ثم تم إجراء عملية هضم RNase في 300 ميكرولتر من خليط RNase (300 ملي مول كلوريد الصوديوم ، 10 ملي مولار من الأس الهيدروجيني 7.4 ، 5 ملي مولار EDTA pH 7.5 ، 30 ميكروغرام RNase A (Fermentas)) عند 30 درجة ج 1 ح. تم إجراء علاج بروتيناز K (10٪ SDS و 20 مجم مل -1 بروتيناز K (Roche) عند 37 درجة مئوية لمدة 30 دقيقة) متبوعًا باستخراج الحمض النووي الريبي مع حمض الفينول: كلوروفورم pH 4.5 في وجود 20 ميكروغرام من الحمض النووي الريبي (سيغما). . تم تشغيل العينات في 18٪ Urea-PAGE متبوعًا بتجفيف الهلام وتم الحصول على الصورة باستخدام phosphorimager. للهضم الجزئي ، تم تحضين التفاعل على الجليد بدلاً من 30 درجة مئوية.

نسخ تشغيل نووي

تم إجراء نسخ التشغيل النووي كما وصفه روبرتس وآخرون. 53. لعزل النواة السليمة من خلايا Huh7 ، تم تحليل ∼ 4 × 10 6 خلايا في محلول NP-40 للتحلل [10 ملي مولار Tris-HCl pH 7.4 ، 10 ملي كلوريد الصوديوم ، 3 ملي مولار MgCl2 و 0.5٪ (المجلد / المجلد) NP-40]. تم التحقق من التجزئة بواسطة النشاف الغربي للعلامات النووية والخلوية. تم تعليق النوى في مخزن تخزين نوى سعة 30 ميكرولتر [50 ملي مولار من حمض الهيدروكلوريك Tris-HCl 8.3 ، 0.1 ملي مولار EDTA ، 5 ملي مولار MgCl2، 40٪ (المجلد / المجلد) الجلسرين] وتخضع لعملية النسخ في المخزن المؤقت للنسخ (10 ملي مولار Tris-HCl pH 8.3 ، 2.5 ملي MgCl2، 150 ملي كلوريد البوتاسيوم ، 2 ملي مولار DTT ، 1 مم ATP ، 1 مم CTP ، 1 مم GTP ، 1 مم GTP ، مثبط 100 U RNase) عند 30 درجة مئوية لمدة 30 دقيقة. مباشرة بعد التفاعل ، تم عزل الحمض النووي الريبي باستخدام TRIzolLS وتعرض لعلاج DNaseI (New England Biolabs) عند 37 درجة مئوية لمدة 15 دقيقة. تم تعطيل DNaseI بالتسخين عند 75 درجة مئوية لمدة 5 دقائق. تم استخدام ستمائة نانوجرام من الحمض النووي الريبي لإعداد (كدنا) في رد فعل 10 ميكرولتر. تم إجراء التحكم في النسخ العكسي الناقص للتحقق من عدم وجود أي تلوث للحمض النووي الجيني.

إعداد جيش تحرير السودان

تم إعداد SLA باستخدام البروتوكول المنشور 54. باختصار ، لتحضير جيش تحرير السودان ، حوالي 10 10 الليشمانيا دونوفاني تم غسل الخلايا ثلاث مرات باستخدام 1 × PBS متبوعًا بخمس إلى ست دورات من ذوبان تجميد النيتروجين السائل. ثم تم صوت الخلايا في برنامج تلفزيوني بنسبة 0.04٪ NP-40 لست مرات. تم تطهير Lysate في 12000 ز لمدة 10 دقائق عند 4 درجات مئوية وكان الطاف الذي تم جمعه هو جيش تحرير السودان. تم إجراء تقدير البروتين لـ SLA باستخدام طريقة برادفورد عند 595 نانومتر.

ال في المختبر تم إجراء اختبار الانقسام DICER1 كما هو مذكور في مكان آخر 32. تم تحضير محلول خلايا HEK293 التي تعبر بشكل ثابت عن FH-AGO2 كترسيب مناعي. لكل تفاعل انقسام ، تم تحضين 30 ميكروغرام محلول خلية مع 20 ميكروغرام SLA في محلول الفحص (10 ملي مولار Tris-HCl الأس الهيدروجيني 7.5 ، 1 ملي مولار DTT ، 100 ملي بوكل ، 1 × مثبط البروتياز الخالي من EDTA (روش)) و 1 مجم مل −1 BSA لمدة 30 دقيقة عند 37 درجة مئوية. تبع ذلك ترسيب مناعي للخليط مع حبات agarose المضادة لـ FLAG M2. بعد الترسيب المناعي ، تعرضت الخرزات في المختبر مقايسة نشاط DICER.

تحليل احصائي

تم إجراء جميع الرسوم البيانية والتحليلات الإحصائية في GraphPad Prism 5.00 (GraphPad ، سان دييغو ، كاليفورنيا ، الولايات المتحدة الأمريكية). يقترن اللامعلمية ر- تم استخدام الاختبار للتحليل و ص- تم تحديد القيم. تشير أشرطة الخطأ إلى متوسط ​​± sd.

توافر البيانات

يعلن المؤلفون أن جميع البيانات التي تدعم نتائج هذه الدراسة متوفرة داخل المقالة وملفات المعلومات التكميلية الخاصة بها أو عند الطلب.


الاستنتاجات

يوفر خادم الويب miRvestigator لعلماء الأحياء مجموعة قوية من الخوارزميات التي تحدد معًا الجزيئات الدقيقة التي تربط وتنظم الجينات المكتشفة ليتم التعبير عنها بشكل مشترك في دراسات التنميط النسبي. يأخذ موقع الويب كمدخلات قائمة بمعرفات الجينات (جين Entrez أو جين Ensembl أو نسخة RefSeq أو رمز الجين الرسمي) لواحد من ستة أنواع مختلفة ( C. ايليجانس , D. melanogaster , جالوس , H. العاقل , M. العضلات أو R. norvegicus ). بالنسبة لمجموعة معينة من الجينات ، فإن miRvestigator: (1) يستخرج متواليات 3′-UTR ذات الصلة (2) بمسح متواليات 3′-UTR هذه للحصول على فكرة تم تمثيلها بشكل زائد باستخدام خوارزمية Weeder (3) تحدد مواقع الربط المفترضة للعنصر الذي تم تمثيله بشكل مفرط و (4) يطبق خوارزمية HMM و Viterbi لتحديد miRNA (s) الذي من المرجح أن يرتبط بالعنصر الذي تم تمثيله بشكل زائد. تسهل واجهة الويب سهلة الاستخدام على علماء الأحياء ضبط المعلمات وإرسال الوظائف إلى miRvestigator. الإخراج من miRvestigator عبارة عن قائمة مرتبة من miRNAs المقدمة في تنسيق جدولي مع روابط إلى السجلات المقابلة في miRBase ، والتقييم الإحصائي لجودة التكامل ، ومحاذاة الحافز لتسلسل بذور miRNA. يتضمن الإخراج أيضًا جدولًا ثانيًا مع مواقع الربط المفترضة لـ miRNA داخل 3′-UTRs من جينات الاستعلام. يوفر miRvestigator أداة قيمة للمستخدمين لتحديد miRNAs التي تنظم العمليات البيولوجية ذات الأهمية والمعلومات المطلوبة لتصميم التجارب لاختبار هذه التنبؤات.


شاهد الفيديو: Dr. Susan Magdaleno: miRNAs are a fascinating field (شهر فبراير 2023).