معلومة

سؤال بخصوص وقف كودون

سؤال بخصوص وقف كودون


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أردت فقط أن أسأل ذلك في RNA معين ، إذا كان هناك كودون بداية ولا يوجد كودون توقف ، فهل لا يزال يعتبر mRNA ، أعني هل يمكن ترجمته إلى بروتين؟


نعم ، لا يزال هذا يعتبر mRNA. عادة ما يرجع عدم وجود كودون الإيقاف إلى ما يسمى بطفرة القراءة ، حيث يتغير تسلسل الحمض النووي داخل كود الإيقاف وبعد النسخ لا يمكن التعرف عليه من خلال عوامل الإطلاق. لكن نعم ، لا تزال الريبوسومات تتعرف على جزيء الرنا المرسال وتبدأ في تصنيع البروتينات غير الطبيعية ، عادةً حتى يتوقف الريبوسوم على الطرف الثالث من الرنا المرسال ولا يمكنه المضي قدمًا أو الانفصال. هناك آليات مختلفة لتحويل هذه "إشارة التوقف" إلى سلسلة من التفاعلات داخل الخلايا التي تؤدي إلى تدهور هذا البروتين وهذا الحمض النووي الريبي غير الطبيعي.

تمتلك البكتيريا على سبيل المثال آلية غريبة جدًا لحل هذه المشكلة ، وهي جزيء tmRNA الذي يستهدف الريبوسوم المتوقف بواسطة بعض البروتينات المحددة ويعمل كقالب aminoacyl-tRNA وكذلك نموذج mRNA. يستأنف الترجمة ، مما يسمح بإضافة علامة الببتيد إلى البروتين المشوه ، والذي سيكون بمثابة علامة للتحلل. المزيد عن ذلك هنا: https://en.wikipedia.org/wiki/Transfer-messenger_RNA https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3358797/


حفظ جنبا إلى جنب وقف الكودونات في الخمائر

ساد الاعتقاد منذ فترة طويلة أن كودون الإيقاف في الجين يتبعه كودون توقف آخر يعمل كنسخة احتياطية إذا تمت قراءة الكائن الحقيقي من خلال الحمض الريبي النووي النقال القريب. ومع ذلك ، لا يزال وجود "أكواد الإيقاف الترادفي" بعيد المنال.

نتائج

نوضح هنا أن فائضًا إحصائيًا من أكواد الإيقاف قد تطورت عند الكودون الثالث في اتجاه مجرى النهر الخاص بكودون الإيقاف الحقيقي UAA في الخمائر. يشير التحليل المقارن إلى أن أكواد الإيقاف في هذا الموقع يتم الحفاظ عليها بشكل كبير أكثر من أكواد الإحساس ، مما يشير إلى أن أكواد الإيقاف الترادفي هذه يتم الحفاظ عليها عن طريق التحديد. قمنا بتقييم تأثير مستويات التعبير عن الجينات والعوامل البيولوجية الأخرى على توزيع أكواد الإيقاف الترادفي. تشير نتائجنا إلى أن مستوى التعبير هو عامل مهم يؤثر على وجود أكواد الإيقاف الترادفي.

استنتاج

توضح دراستنا وجود أكواد التوقف الترادفية ، والتي تمثل واحدة من العديد من السمات الجينومية ذات المغزى التي تحركها قوى انتقائية ضعيفة نسبيًا.


لماذا يعد استخدام الكودون مهمًا؟

تعتمد الترجمة وتخليق البروتين على نقل الحمض النووي الريبي (الحمض النووي الريبي). ترتبط الحمض الريبي النووي النقال بالأحماض الأمينية وتوصيلها إلى الريبوسوم حيث يتم دمجها في سلسلة بولي ببتيد المتنامية. يحتوي جزء واحد من الحمض الريبي النووي النقال على المضاد ، وهو تسلسل ثلاثي نيوكليوتيدات مكمل لتسلسل الرنا المرسال. ترتبط نهاية 3 'من الحمض الريبي النووي النقال الحمض الأميني الذي يتوافق مع تسلسل الأنتيكودون. هذا يعني أن هناك 61 tRNAs ممكنًا. ومع ذلك ، قد لا تعبر الخلايا عن كل الـ 61 من هذه الحمض النووي الريبي ، ويمكن العثور على تلك التي يتم التعبير عنها على مستويات مختلفة جدًا (ماورو وتشابيل ، 2014). بسبب هذا الاختلاف في تعبير الحمض الريبي النووي النقال ، فإن الكودونات التي تشفر البروتين قد تؤثر على معدل الترجمة وبالتالي التعبير البروتيني. في الواقع ، أظهرت دراسات أن كفاءة الترجمة مرتبطة بتحيز الكودون عبر جميع الجينات الذاتية في بكتريا قولونية و S. cerevisiae (تولر وآخرون ، 2010).

الشكل 1: نظرة عامة على تخليق الببتيد. يتفاعل الريبوسوم مع mRNA و tRNAs المشحونة لبناء الببتيد. صورة من ماريانا رويز فياريال.

بحلول أواخر الثمانينيات ، أنشأ العلماء مؤشر تكيف الكودون (CAI) الذي يعتمد على تكرار استخدام الكودون في مرجع للجينات المعبر عنها بشكل كبير (Sharp and Li ، 1987). في عام 2000 ، أنشأ مختبر Ikemura استخدام Codon جدولة من قاعدة بيانات GenBank (CUTG) ، والتي توفر مجموعة بيانات إلكترونية لاستخدام الكودون لـ 257468 جينًا عبر 8792 كائنًا حيًا (ناكامورا وآخرون ، 2000).


علم الأحياء الفصل 17 الاختبارات

ج) الكائنات الحية المختلفة لها أنواع مختلفة من الأحماض الأمينية.

ب) الربط بعد النسخ

ج) الترجمة في حالة عدم وجود الريبوسوم

ب) يغير حمض أميني في البروتين المشفر.

ج) يغير إطار قراءة مرنا.

ب) يأخذ نقل الحمض النووي الريبي المعلومات من الحمض النووي مباشرة إلى الريبوسوم ، حيث يحدث تخليق البروتين.

ج) يتم نسخ Messenger RNA من جين واحد وينقل المعلومات من الحمض النووي في النواة إلى السيتوبلازم ، حيث يتم تخليق البروتين.

ب) تتم ترجمة الكودونات بواسطة الحمض النووي الريبي في حقيقيات النوى ، لكن الترجمة لا تتطلب جزيئات وسيطة مثل الحمض النووي الريبي في بدائيات النوى.

ج) عادةً ما تحتوي أكواد بدائية النواة على قواعد مختلفة عن تلك الموجودة في حقيقيات النوى.

ب) سيتم قطع النيوكليوتيدات الزائدة (ACCA) في الريبوسوم.

ج) سيصبح الغطاء 5 من الرنا المرسال مرتبطًا تساهميًا.

ب) هي آلية لزيادة معدل الترجمة.

ج) يزيد من معدل النسخ.

ب) الكودون الذي يحدد نفس الحمض الأميني مثل الكودون الأصلي

ج) استبدال الأحماض الأمينية الذي يغير البنية الثلاثية للبروتين

ب) الكود الجيني عالمي (نفس الشيء بالنسبة لجميع الكائنات الحية).

ج) الكود الجيني يختلف باختلاف مجالات الكائنات الحية.

ب) الخلايا بدائية النواة لها آليات معقدة لاستهداف البروتينات للعضيات الخلوية المناسبة.

ج) مطلوب معالجة مكثفة للحمض النووي الريبي قبل ترجمة النصوص بدائية النواة.

ب) يتم تصنيع البروتينات

ب) قراءة الكودون التالي من الرنا المرسال

ب) تملي الجينات إنتاج إنزيمات معينة ، والأفراد المصابون يعانون من عيوب وراثية تجعلهم يفتقرون إلى إنزيمات معينة.

ج) تصنع الإنزيمات من الحمض النووي ، ويفتقر الأفراد المصابون إلى بوليميراز الحمض النووي.

ب) يوفر مصدرًا للطاقة لإنهاء الترجمة.

ج) يطلق الريبوسوم من ER للسماح للببتيدات في العصارة الخلوية.

ب) ربط الأنتيكودون بالكودون وربط الأحماض الأمينية بـ tRNAs

ج) ربط الريبوسومات بالمرنا

ب) عديد ببتيد ينقصه حمض أميني

ب) يصل الريبوسوم إلى كودون توقف

ج) الاقتران الأساسي لميثيونين- tRNA المنشط إلى AUG من الرنا المرسال

ب) ينسخ بوليميراز الحمض النووي الريبي من خلال إشارة عديد الأدينيل ، مما يتسبب في ارتباط البروتينات بالنسخة وتقطيعها خالية من البوليميراز.

ج) ينسخ بوليميراز الحمض النووي الريبي من خلال تسلسل المنهي ، مما يتسبب في انفصال البوليميراز عن الحمض النووي وإطلاق النسخة.


RNA مقابل DNA

من المغري الخلط بين الحمض النووي الريبي والحمض النووي ، لكنهما مختلفان تمامًا ، ومن المهم فهم هذه الاختلافات. كلاهما مكون من نيوكليوتيدات ، وهي الوحدات الأساسية للأحماض النووية (مثل DNA و RNA). تحتوي هذه النيوكليوتيدات على مجموعة فوسفاتية وقاعدة نيتروجينية وريبوز سكر مكون من 5 كربون.

ولكن بدلاً من ريبوز الحمض النووي ، يستخدم الحمض النووي الريبي deoxyribose ، وهو نوع مختلف من السكر. أيضًا ، غالبًا ما يكون الحمض النووي الريبي (RNA) خيطًا منفردًا ، بينما يشتهر الحمض النووي بأنه مزدوج الشريطة. أخيرًا ، يحتوي الحمض النووي على الثايمين ، بينما يستخدم الحمض النووي الريبي اليوراسيل بدلاً منه.


4. إينوزين في الحمض الريبي النووي النقال

الحمض الريبي النووي النقال هو مترجم الشفرة الجينية أثناء تخليق البروتين وهي ضرورية لكفاءة الترجمة وإخلاصها [59]. تطوى الحمض النووي الريبي في بنية ثانوية من أوراق البرسيم وتتبنى بنية على شكل حرف L [60] حيث تشكل القواعد النووية في المواضع 34 و 35 و 36 المضاد الذي يتعرف على ثلاثة توائم كودون تكميلية في الرنا المرسال. لا تلتزم القواعد النووية في الموضع 34 بشكل صارم بقواعد Watson & # x02013Crick عند إقرانها بالقاعدة الثالثة من الكودونات (الاقتران المتذبذب) في الريبوسوم.

الأدينوزين في الموضع 34 (أ34) من الحمض النووي الريبي (tRNAs) بكثرة في البكتيريا وحقيقيات النوى ولكنها غائبة في العتائق [61]. أ34 في الحمض النووي الريبي (tRNAs) يتم تعديله عالميًا تقريبًا إلى إينوزين (I34) بواسطة deaminases الخاصة بـ tRNA [14،62،63،64،65،66]. أنا34 يقوي مزيدًا من مرونة التذبذب المتذبذب لـ anticodon ، كما أنا34- تتعرف الحمض النووي الريبي على الكودونات المترادفة A- أو C- أو U-end (الشكل 3) [67]. هذا يتناقض مع A.34-tRNAs ، التي تتعرف فقط بكفاءة على الكودونات U-end.

الاقتران بقاعدة الإينوزين. (أ) Inosine معدّل tRNA Ala مع أزواج قاعدة anticodon IGC مع كودوناته المترادفة GCA و GCC و GCU. (ب) الرابطة الهيدروجينية للأينوزين مع الأدينوزين والسيتوزين واليوراسيل.

في تفاعل مكافئ وظيفيًا ، يمكن تعديل uridines في الموضع 34 من tRNAs بواسطة uridine methyltransferases الخاص بـ tRNA لتشكيل xo 5 U34. يمكّن هذا التعديل الحمض الريبي النووي النقال (tRNAs) من الزوج الأساسي مع أكواد A- أو G- أو U-end. تعد طبيعة التعديل المفضل في الموضع 34 من الحمض النووي الريبي سمة مميزة للكائنات البدائية والبكتيرية وحقيقية النواة ، وتوسع I34 في حقيقيات النوى كان له تأثير مهم في إنشاء مجموعات جينات الحمض النووي الريبي حقيقية النواة واستخدام الكودون الجينومي العام [68]. تفتقر الأركيا إلى كل من A.34- و أنت34-تعديلات قاعدة الحمض النووي الريبي ، في حين أن U واسعة النطاق34 المثيلة هي خاصية بارزة من الحمض النووي الريبي البكتيرية [68].

في البكتيريا ، يكون تكوين أنا34 في الحمض الريبي النووي النقال يتم تحفيزه بواسطة إنزيم متماثل: إنزيم نزع الأمين الخاص بالـ tRNA (TadA) [14]. تحتوي معظم البكتيريا على نوع A واحد34 الركيزة لـ TadA: tRNA Arg مع anticodon ACG. ومع ذلك ، فإن العديد من الأنواع البكتيرية تعبر عن أكثر من ألف واحد34-الحمض الريبي النووي النقال. على سبيل المثال، Oenococcus oeni (الثبات) يحتوي على أربعة أ34-tRNAs مشابهة لـ Arg و Leu و Thr و Ser. ومن المثير للاهتمام ، في هذا النوع أنا34 تم اكتشافه في tRNAs cognate لـ Arg و Leu ولكن ليس في A34 tRNAs لـ Thr و Ser ، مما يشير إلى أن توسع ركائز الحمض الريبي النووي النقال التي تم تعديلها بواسطة نزع الأمين tRNA يبدأ على الأرجح بظهور A غير معدل34ركائز -tRNA [65]. TadA هو إنزيم أساسي في الإشريكية القولونية، وهي حقيقة تنسب إلى أهمية أنا34- أرج في الترجمة [14]. بالاتفاق مع هذا ، فإن تلك الأنواع البكتيرية التي تفتقر إلى A.34الجينات -tRNA تفتقر أيضًا إلى TadA [65،69،70،71]. في هذه الأنواع ، تعوض مستقبلات الحمض الريبي النووي الريبي الأخرى عن نقص A34-جينات الحمض النووي الريبي. وظيفة ثانية لنزع الأمين المعتمد على TadA في بكتريا قولونية تمت مناقشته لاحقًا في هذه المخطوطة [72].

في حقيقيات النوى ، الوضع المتعلق بـ I34- الحمض النووي الريبي أكثر تعقيدًا مما هو عليه في البكتيريا ، لأن أدينوزين ديميناز حقيقي النواة الذي يعمل على الحمض النووي الريبي (ADAT) يزيل أمين A34 في العديد من الحمض الريبي النووي النقال (سبعة tRNAs في بعض الفطريات والنباتات ، وثمانية tRNAs في معظم الأنواع المميزة جيدًا) [73]. كان ظهور ADAT حقيقي النواة مصحوبًا بتخصيب جيني دراماتيكي في A.34- جينات الحمض الريبي النووي النقال (68،73،74،75).

AdATs حقيقية النواة هي إنزيمات غير متجانسة تطورت من تكرار البكتيريا تادا الجين. تُعرف الوحدة الفرعية التحفيزية باسم ADAT2 ، بينما يُطلق على شريكها في ربط الحمض النووي الريبي اسم ADAT3. تم فقدان الغلوتامات المحفوظة التي تنقل البروتونات ، والتي تعتبر ضرورية للنشاط التحفيزي لـ ADAT2 ، أثناء تطور ADAT3 ، مما جعل هذه الوحدة الفرعية غير نشطة تحفيزيًا [76،77]. دراسة حديثة عن التركيب البلوري لـ ADAT2 / 3 من خميرة الخميرة يقترح أن البقايا موجبة الشحنة في المنطقة الطرفية N من ADAT3 قد تلعب دورًا في التعرف على الركيزة [78].

من غير الواضح كيف تطورت ADAT لتوسيع خصوصية الركيزة الخاصة بها للعديد من tRNAs. في المثقبية البروسية، بالإضافة إلى أ34 التعديل في الحمض النووي الريبي ، ينفذ ADAT2 / 3 تحرير C-to-U في الحمض النووي أحادي الجديلة [79] ونفس الإنزيم ضروري لتحرير C-to-U في tRNA Thr [80]. في هذا النوع ، يتطلب التعرف على الركيزة بواسطة ADAT نطاق KR يحتوي على امتدادات من Arg و Lys في المحطة C لـ ADAT2 [81].

في الفطريات ، انخفاض مستويات أنا34-tRNAs القبض على دورة الخلية من شيزوساكارومايس بومب، وحذف الإنزيم مميت S. cerevisiae [82]. تعديل Inosine في tRNA Arg of نبات الأرابيدوبسيس thaliana تعمل البلاستيدات الخضراء على تحسين كفاءة ترجمة جينوم العضية & # x02019s [83]. يعتبر نشاط ADAT ، في الواقع ، ضروريًا في جميع أنواع حقيقيات النوى المختبرة [21،66،79،82] ، وهو أمر متوقع نظرًا لحقيقة أن معظم الجينومات حقيقية النواة تفتقر إلى ترميز الجينات للعديد من G34-ترناس. لذلك ، يعد التحرير A-to-I مطلوبًا للتعويض عن نقص G34- الحمض النووي الريبي (الحمض النووي الريبي) المطلوب خلاف ذلك لفك كودونات C المنتهية [74]. في البكتيريا ، من ناحية أخرى ، فإن G34-توفر جزيئات الحمض النووي الريبي (الحمض النووي الريبي) بكثرة لأن بدائيات النوى لم تتبنى أنا34 كحل عام لترجمة الكودونات C (الشكل 4). ومن المثير للاهتمام أن G34- ثبت أن الحمض النووي الريبي سامة للخلايا حقيقية النواة لأنها عرضة للحث على سوء الترميز في سياق أنظمة الترجمة حقيقية النواة [84].

تنوع الركيزة لنزع الأمين الخاص بالـ tRNA. في البكتيريا ، حمض الحمض الريبي النووي النقال Arg ACG هو راسخ أ34 الركيزة ل TadA homodimeric. * Inosine المعدل tRNA Leu AAG يوجد أيضًا في عدد قليل من بدائيات النوى مثل O. oeni [65]. في حقيقيات النوى ، متنوعة A34 تعمل الحمض النووي الريبي (tRNAs) كركائز لـ ADAT2 / 3 غير المتجانسة حيث يكون عدد سكان G34 الحمض الريبي النووي النقال محدود. توسع A34 تطور تنوع الحمض النووي الريبي (tRNA) بشكل مشترك مع خصوصية الركيزة المتعددة في ADATs. (المضادات محاصر ، والأحماض الأمينية المقابلة لها حرف واحد مختصر).

يعد تكوين الكودون وبنية الحمض النووي الريبي من العوامل المهمة التي تؤثر على معدلات الترجمة ، كما أن تجميع الكودونات النادرة (الكودونات التي تحتوي على عدد قليل من النسخ من الحمض النووي الريبوزي المتماثل) في مناطق الرنا المرسال تحد من معدل الترجمة [85،86]. وبالتالي ، فإن ترجمة الجينات الغنية بالكودونات الحساسة لـ ADAT (الكودونات التي ترجمها I.34-tRNAs: قد تستفيد الأحماض الأمينية T و A و P و S و L و I و V و R ، المشار إليها فيما يلي بـ TAPSLIVR) من زيادة قدرة فك التشفير لـ tRNAs المعدلة بالجينوزين [64،87،88]. بالاتفاق مع هذا التوقع ، فإن الخلايا الجذعية الجنينية ذاتية التجديد التي تعبر عن عدد كبير من الجينات المخصبة في الكودونات الحساسة لـ ADAT تعرض مستويات ADAT2 محسنة [89].

بشكل عام ، يتم إثراء البروتينات حقيقية النواة بدرجة عالية في تسلسل البروتين مع تمدد الأحماض الأمينية الحساسة لـ ADAT عند مقارنتها بالبروتينات البكتيرية (

التخصيب بأربعة أضعاف) [90] ، وتكوين الكودون لترميز النصوص للبروتينات الغنية بـ TAPSLIVR متحيز لصالح I34- الكودونات المعتمدة على الحمض النووي الريبي (

70٪ تخصيب) [90]. وبالتالي ، فإن حقيقيات النوى (التي تستخدم بشكل تفضيلي أنا34-tRNAs لفك تشفير TAPSLIVR ، الشكل 4) تعرض تركيبة بروتينية مختلفة من حيث البروتينات الغنية بالأحماض الأمينية TAPSLIVR مقارنة بالأنواع البكتيرية ، كما يتم إثراء نسخها في الكودونات التي تتطلب هذا التعديل [65،90،91]. لقد اقترحنا أن الإينوزين في الموضع 34 من الحمض الريبي النووي النقال يمثل سمة تطورية خاصة بحقيقيات النوى تم اختيارها لأنها تساهم في توسيع التعقيد البروتيني [92].

ومن المثير للاهتمام ، أنا34- الحمض النووي الريبي عرضة للانقسام الداخلي بواسطة نوكلياز داخلي V ، وهو ريبونوكلياز شديد الحفظ ، والذي يشق جزيئات الحمض النووي الريبي (الحمض النووي الريبوزي) المعدلة بالجين في مضادها [26]. يمكن أن تؤدي ظروف الإجهاد مثل الأكسدة والجوع إلى انقسام الحمض النووي الريبي في حلقاتها المضادة للكودون ، وتلعب الأجزاء الناتجة عددًا من الأدوار التنظيمية التي لم يتم استكشافها بعد [93،94،95].

بالإضافة إلى أنا34، يتم تعديل الأدينوزين في الموضعين 37 و 57 إلى أشكال ميثلة من إينوزين (الشكل 5) [96]. ميثيل إينوزين 37 (م 1 أنا37) موجود فقط في حقيقيات النوى tRNA Ala ويتم تشكيله من خلال عملية من خطوتين تتطلب ، أولاً ، نزع أميناز ADAT1 الخاص بـ tRNA ، وثانيًا ، tRNA methyltransferase 5 (Trm5) [97،98]. يُعتقد أن ميثيل إينوزين 37 يمنع التحولات الإطارية المترجمة ويحسن دقة الترجمة [76،97]. ميثيل إينوزين 57 (م 1 أنا57 او م 1 ايم57 [99]) في archaeal tRNA Ile ، ووظيفته ، حتى الآن ، غير واضحة [100].

تحرير A-to-I في tRNAs. يمكن تعديل الأدينوزين في المواضع 34 و 37 و 57 من الحمض الريبي النووي النقال إلى إينوزينات. ال34من أنا34 لوحظ التعديل في البكتيريا وحقيقيات النوى ويتم تحفيزه بواسطة الإنزيمات TadA و ADAT2 / 3 ، على التوالي. ADAT1 يحفز أ37من أنا37 تعديل في حقيقيات النواة tRNA Ala. أنا57 وقد لوحظ تعديل في الحمض الريبي النووي النقال الأثري. يتم تعديل الأدينوزين في الموضعين 37 و 57 إلى أشكال ميثلة من الإينوزين.

تسبب الطفرات في الإنزيمات المعدلة للـ tRNA حالات سريرية خطيرة لدى البشر [63،101] ، بما في ذلك تنكس الخلايا العصبية [102]. تسبب الطفرات النقطية في ADAT3 ، البروتين الشريك لـ ADAT غير المتجانسة ، إعاقة ذهنية وحول [103،104،105،106،107] ، وقد ثبت أن تكرار 8 نقاط أساس في جين ADAT3 يسبب إعاقة ذهنية خفيفة [108].


سؤال بخصوص وقف كودون - علم الأحياء

يستخدم الكود الجيني للترجمة من mRNA إلى بروتين. كل كودون مكون من ثلاثة أحرف يشفر إما حمض أميني أو يخبر الريبوسوم بإيقاف الترجمة. تتم قراءة الكودون في اتجاه 5 إلى 3 درجات. على سبيل المثال ، ترميز UGG لـ Trp (Tryptophan).

1. بالنظر إلى خيط المعنى التالي لتسلسل الحمض النووي ، قم بنسخه إلى mRNA ، مع توضيح اتجاه mRNA [أي 3 'و 5' ينتهي]. ثم قم بترجمة هذا التسلسل إلى بروتين [يشير إلى ترميني amino و carboxy ، تأكد من التحقق من وجود إطار قراءة مفتوح أيضًا.]

5 'ججاتكجاتجكككتتااجاجتتاكاتاتجكتجاجكجتتااككككجغا 3

2. لقد قمت للتو بتسلسل جزء قصير من الحمض النووي. أنت ترغب في تحليل تسلسل الحمض النووي هذا لتحديد ما إذا كان يمكن ترميز البروتين.

5 'TCAATGTAACGCGCTACCCGGAGCTCTGGCCCAAATTTCATCCACT 3'

1. ابحث عن أطول إطار قراءة مفتوح (ORF). تذكر ، هناك ستة احتمالات.

2. تسمية أي خصلة على الحمض النووي ستكون خصلة الإحساس ، والتي ستكون عديمة المعنى عندما يتم نسخ هذا الحمض النووي.

3. انسخ ORF هذا إلى mRNA ، مشيرًا إلى نهايتي 5 'و 3'.

4. ترجم هذا mRNA إلى أحماض أمينية ، مشيرا إلى النهايات الأمينية (N) والكربوكسي (C).


اتجاه إشارة polyA المتأخر SV40 - (21 مارس 2006)

لدي سؤال بخصوص اتجاه إشارة SV40 المتأخرة polyA. هل يعرف أحد ما إذا كانت إشارة polyA تعمل في كلا الاتجاهين؟ دعنا نقول في هذا السياق:

تكون إشارة SV40 polyA في الاتجاه الصحيح للنسخة 1 وتنهي النسخ بكفاءة. ولكن هل تم إنهاء نسخ النص 2 (نسخة مضادة للمعنى) على الإطلاق ، أو ربما بكفاءة أقل؟ هل يمكن أن يوفر النص 2 RNA مضادًا للنسخة 1 ، مما يؤدي إلى تداخل RNA؟

هل لديكم أي مراجع لهذه المشكلة ، لأنني لا أجد بعضها؟

أهلا
ليس لدي الوقت الحالي للتحقق ، لكني أعتقد أن إشارة بولي مخصصة لخيط واحد فقط. الدليل الأول هو أن الإجماع AATAAA هو بمعنى واحد فقط على هذا التسلسل.
من خلال الميزات التي لدي ، تبدأ إشارة poly a SV40 في كودون & quotstop & quot.
وأعتقد أنه من الضروري أيضًا الحصول على كودون توقف جيد بالمعنى الآخر.

هذا هو التسلسل الذي لدي لـ polyA:
تجاججا
1801 TCAATTCTCT AGAGCTCGCT GATCAGCCTC GACTGTGCCT TCTAGTTGCC

1851 أجككاتكتجت تجتتجككك تكككككجتجك كتككتجاك كتججاغت

1901 GCCACTCCCA CTGTCCTTTC CTAATAAAAT GAGGAAATTG CATCGCATTG

1951 TCTGAGTAGG TGTCATTCTA TTCTGGGGG TGGGGTGGGG CAGGACAGCA

2001 AGGGGAGGA TTGGGAAGAC AATAGCAGGC ATGCTGGGGA TGCGGTGGGC

XhoI
2051 TCTATGGCTT CTGAGGCGGA AAGAACCAGC TGGG

بقدر ما أتذكر ، فإن إشارة polyA المبكرة والمتأخرة قريبة جدًا من بعضها (عدد قليل من أزواج القاعدة) ولكن في الاتجاه المعاكس. لذلك إذا كنت تستخدم إشارة poly A المتأخرة ، فستكون إشارة poly-A المبكرة موجودة في الاتجاه المعاكس والعكس صحيح.

شكرا لمساعدتك.
أعتقد أنني يجب أن أتصل ببروميغا وأسألهم. في حالتي الخاصة ، أحتاج إلى معرفة ما إذا كانت إشارة polyA لمتجهات pGL3 ثنائية الاتجاه.


أغسطس في بدائيات النوى

في الخلايا بدائية النواة ، مثل الخلايا البكتيرية ، رموز AUG لـ N-formyl methionine ، بدلاً من الميثيونين ، ولا يكفي بدء الترجمة بمفردها. لذلك ، نجد أنه يتبعه تسلسل Shine-Dalgarno ، والذي يساعد في محاذاة mRNA مع الريبوسومات لتوجيه الجزيئات بشكل صحيح للترجمة. ال تسلسل Shine-Dalgarno تم العثور على حوالي 10 نيوكليوتيدات في المنبع من كودون البداية. الطريقة التي يتم التعرف عليها هي من خلال تسلسل محدد على جزيء RNA الريبوسومي (rRNA) المكمل لتسلسل Shine-Dalgarno. بمجرد أن يلتصق الرنا الريباسي بالتسلسل ، فإنه يحفز الحمض الريبي النووي النقال لإحضار الحمض الأميني N-formyl methionine إلى AUG. أخيرًا ، بالإضافة إلى AUG ، تمتلك بدائيات النوى أكواد بدء أخرى GUG ، والتي ترمز إلى valine ، و UUG ، والتي ترمز إلى leucine.


أساليب

مصادر البيانات والتجميع

حصلنا على بيانات RNA-seq لـ 19 نوعًا من الأنواع الهدبية MMETSP من iMicrobe (http://data.imicrobe.us/) ، جنبًا إلى جنب مع أربعة ملفات أرشيف قراءة متسلسلة (SRA) من (Feng et al. 2015) وملف SRA واحد من (Kodama et al. 2014). تم تحويل ملفات SRA إلى fastq باستخدام FASTQ-DUMP. استخدمنا قراءات RNA-seq إلى الأمام لتجميع نسخة من novo باستخدام إصدار Trinity r20140413p1 (Grabherr et al. 2011) لكل نوع. تم جدولة ملخص التجميعات في الجدول 1.

وقف كثافات كودون وترددات الاستبدال

أجرينا محاذاة زوجية لمركب الرنا المرسال المترجم من الناحية النظرية باستخدام BLASTX 2.2.31 المستقل لكل نسخة مقابل قاعدة بيانات تسلسل البروتين المرجعي NCBI (RefSeq) مع ه- القيمة من 10 إلى 30 كحد أدنى للتشابه الكبير في تسلسل الزيارات النصية الفردية. للإشارة إلى كل كودون توقف على حدة ، أجرينا إعادة تعيين زائفة لاثنين من كودونات التوقف إلى الأحماض الأمينية مع كودون التوقف المتبقي المترجم على أنه حمض أميني غير معروف ، يُشار إليه بعلامة "*". في المجموع ، أجرينا ثلاث محاذاة لكل نوع من الأنواع التي تم تحليلها ، واحدة لكل كودون توقف. تم إخراج المحاذاة بتنسيق الخيار 2 "لا توجد هويات مثبتة على استعلام". أزلنا المحاذاة حيث كانت الضربات تنشأ من أنواع الميتوكوندريا والبكتيريا لتقليل التلوث من النصوص المجمعة غير المقصودة. من هذا الإخراج ، تمكنا من حساب كثافة أكواد الإيقاف في كل تسلسل استعلام ، بناءً على التردد في المحاذاة الزوجية وطول حجم المحاذاة ، كما هو موضح في الشكل 1.


شاهد الفيديو: Marlene Verhoef - reaksie op vraag oor wat gebeur in klasse waar daar nie tolke is (شهر فبراير 2023).