معلومة

الإخراج والنفايات الأيضية؟

الإخراج والنفايات الأيضية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أعلم أن هناك فرقًا بين فضلات الجهاز الهضمي والنفايات الأيضية ، ولكن أيهما يسمى الإخراج؟ وماذا يسمى الآخر؟ شكرا!


الابتلاع هو طرد الطعام غير المهضوم والذي يحدث عادة عن طريق فتحة الشرج. على الرغم من أن الديدان المفلطحة يجب أن تستخدم فمها لأنها لا تملك فتحة الشرج. هذه هي المادة غير الأيضية.

الإخراج هو نقل أي مادة مستقلب إلى البيئة ، بما في ذلك البول أو ثاني أكسيد الكربون.


13) إفرازات في الإنسان

الإخراج هو إزالة المواد التالية:

  • مواد سامة
  • نفايات التمثيل الغذائي
  • المواد الزائدة من الكائنات الحية

يتم نزع الأمين من الأحماض الأمينية الزائدة في الكبد لتكوين الجليكوجين و اليوريا. تتم إزالة اليوريا من الأنسجة عن طريق الدم وطردها عن طريق الكلى.

  • الكبد & # 8211 يكسر الأحماض الأمينية الزائدة وينتج اليوريا.
  • الرئتين & # 8211 تخلص من CO2 و H2O عند الزفير.
  • الكلى & # 8211 يزيل اليوريا وغيرها من النفايات النيتروجينية من الدم ، وطرد المياه الزائدة والأملاح. الهرمونات والمخدرات.
  • الجلد & # 8211 يفقد الماء والملح واليوريا ولكن ليس العضو مطرح.

الكبد ودوره في انتاج البروتينات:

  • يلعب دورًا مهمًا في الاستيعاب (ممتص) أحماض أمينية.
  • يزيل الأحماض الأمينية من بلازما مجرى الدم ويبنيها إلى بروتينات.
  • البروتينات عبارة عن سلاسل طويلة من الأحماض الأمينية مرتبطة ببعضها البعض بواسطة روابط ببتيدية.

الهزال: إزالة الجزء المحتوي على النيتروجين من الأحماض الأمينية لتكوين اليوريا.

  • يتم أخذ البول من الكلى إلى مثانة بواسطة الحالب.
  • الإحليل هو الأنبوب الذي ينقل البول إلى خارج الجسم.
  • من المحتمل أن تكون بعض المركبات الناتجة عن التفاعلات في الجسم سامة إذا تراكمت تركيزاتها.
  • يذوب ثاني أكسيد الكربون في السوائل مثل سوائل الأنسجة وبلازما الدم لتكوين حمض الكربونيك. هذه الزيادة في الحموضة يمكن أن تؤثر على عمل الإنزيمات ويمكن أن تكون قاتلة.
  • تصنع الأمونيا في الكبد عند تكسير الأحماض الأمينية الزائدة. ومع ذلك ، فإن الأمونيا شديدة القلوية وسامة. يتم تحويله إلى يوريا وهي أقل سمية بكثير ، مما يجعلها طريقة آمنة لإفراز النيتروجين الزائد.

التركيب المجهري للكلى:

  • تتكون أنسجة الكلى من العديد من الشعيرات الدموية وأنابيب صغيرة تسمى الأنابيب الكلوية، متماسكة مع النسيج الضام.
  • ال القشرة هي المنطقة الخارجية المظلمة.
  • ال النخاع هي المنطقة الداخلية الأفتح.
  • ينقل الشريان الكلوي الدم إلى الكلية ، بينما ينقله الوريد الكلوي بعيدًا.
  • ينقل الحالب البول من الكلية إلى المثانة.
  • حيث يلتقي الحالب بالكلية توجد مساحة تسمى الحوض.
  • ينقسم الشريان الكلوي إلى عدد كبير جدًا من الشرايين والشعيرات الدموية ، معظمها في القشرة.
  • كل شريان يؤدي إلى أ الكبيبة. هذا هو شعري مقسم وملفوف بشكل متكرر ، مما يجعل عقدة من الأوعية.
  • كل الكبيبة محاطة بالكامل تقريبًا بعضو على شكل كوب يسمى أ كبسولة الكلىمما يؤدي إلى ملفوف النبيبات الكلوية.
  • هذا الأنبوب ، بعد سلسلة من الملفات والحلقات ، ينضم إلى أ جمع القناة، والذي يمر عبر النخاع لفتح الحوض.
  • أ نفرون هو الكبيبة المفردة بكبسولة كلوية ونبيب كلوي وشعيرات دموية.
  • يتسبب ضغط الدم في الكبيبة في تسرب جزء من بلازما الدم عبر جدران الشعيرات الدموية.
  • خلايا الدم الحمراء وبروتينات البلازما أكبر من أن تخرج من الشعيرات الدموية ، لذا فإن السائل الذي يتدفق من خلاله هو البلازما بدون البروتين.
  • وبالتالي يتكون السائل بشكل أساسي من الماء مع الأملاح الذائبة والجلوكوز واليوريا وحمض البوليك.
  • تسمى العملية التي يتم من خلالها تصفية السائل خارج الجسم عن طريق الكبيبة الترشيح الفائق.
  • يتجمع المرشح من الكبيبة في الكبسولة الكلوية ويتدفق إلى أسفل النبيبات الكلوية.
  • أثناء القيام بذلك ، تمتص الشعيرات الدموية التي تحيط بالنبيب مرة أخرى في الدم هذه المواد التي يحتاجها الجسم.
  • أولاً ، يتم إعادة امتصاص كل الجلوكوز مع الكثير من الماء.
  • ثم يتم أخذ بعض الأملاح مرة أخرى للحفاظ على التركيز الصحيح في الدم.
  • تسمى عملية امتصاص المواد التي يحتاجها الجسم إعادة امتصاص انتقائي.
  • تستمر الجزيئات التي لا يتم امتصاصها بشكل انتقائي على طول نبيب النيفرون مثل البول.

آلة غسيل الكلى (الكلى الصناعية):

غسيل الكلى هو علاج يقوم بتصفية الدم وتنقيته باستخدام آلة

  • تركيز جلوكوز مشابه للمستوى الطبيعي في الدم
  • تركيز أيونات مماثل لتلك الموجودة في بلازما الدم الطبيعية
  • لا يوريا

نظرًا لأن سائل غسيل الكلى لا يحتوي على يوريا ، فهناك تدرج تركيز كبير & # 8211 مما يعني أن اليوريا تتحرك عبر الغشاء المنفذ جزئيًا ، من الدم إلى سائل غسيل الكلى ، عن طريق الانتشار.

نظرًا لأن سائل غسيل الكلى يحتوي على تركيز جلوكوز يساوي مستوى السكر في الدم الطبيعي ، فإن هذا يمنع الحركة الصافية للجلوكوز عبر الغشاء نظرًا لعدم وجود تدرج تركيز.

نظرًا لأن سائل غسيل الكلى يحتوي على تركيز أيوني مشابه لتركيز بلازما الدم المثالي ، فإن حركة الأيونات عبر الغشاء تحدث فقط في حالة وجود خلل.


دور الكلى | أنسجة الكلى

مقدمة

يتضمن الإخراج فصل وإزالة الفضلات الأيضية من الجسم. تشارك العديد من الأعضاء في هذه العملية: الرئتين ، والخياشيم ، والجلد ، وما إلى ذلك. الكلى وقنواتها هي الأعضاء الرئيسية التي تعمل طوال الوقت وتشكل الجهاز الإخراجي.

بالإضافة إلى التخلص من النفايات الأيضية ، يعمل نظام الإخراج في الحفاظ على توازن مائي مناسب في الجسم: توازن الماء والأملاح غير العضوية والمواد الأخرى في البيئة الداخلية للكائن الحي. هناك فرق كبير في مشاكل توازن الماء التي تواجهها الفقاريات البحرية والمياه العذبة والبرية ، ومن اللافت للنظر أن كليتيها متشابهة بقدر ما هي.

تتكون كلية جميع الفقاريات من عقدة الأوعية الدموية ، إما الكبيبات أو الكبيبات ، وترتبط ارتباطًا وثيقًا بكتل الأنابيب الكلوية ( الأشكال 1(أ), 1(ب)، و 2 ). النبيب المفرد ، مع الأوعية الدموية المرتبطة به ، هو نيفرون.

شكل 1 . صور مجهرية لجزء من كلية كلب البحر الشوكي (سكوالوس أكانثياس). (أ) ثلاثة الكبيبات (المفرد ، الكبيبات) على اليمين محاطة بكتل من الأنابيب الكلوية. الشعيرات الدموية الدقيقة (غير مرئية) تغزو النسيج الضام الرخو بين الأنابيب. 10 ×. (ب) إحدى الكبيبات من (أ) محاطة بكبسولة كلوية (كبسولة بومان). تتكون الكبسولة من ظهارة حرشفية بسيطة تشبه البالون الذي تم دفعه من قبل الكبيبة بحيث يتم تغطية كل شعري بالطبقة الحشوية من الكبسولة الكلوية ويتم إحاطة الفراغ بالطبقة الجدارية. تملأ كتل الأنابيب الكلوية الحقل المتبقي. تظهر الشعيرات الدموية من حين لآخر بين الأنابيب 40 ×.

الشكل 2 . صور مجهرية لإظهار الحلقات الشعرية في الكريات الكلوية لأسماك المياه العذبة عن بعد (Carassius auratus gibelio) في الأعلى: صورة مجهرية للقسم تُظهر العقدة المتطورة من الشعيرات الدموية مع العديد من الحلقات ولومن براءة اختراع على نطاق واسع. AA ، شريان وارد مع الخلايا المجاورة للكبيبات (الأسهم). المقياس = 10 ميكرومتر. أسفل: مسح صورة مجهرية إلكترونية لسطح الحلقات الشعرية التي تحتوي على خلايا بودوسيت كروية تمتد من خلالها عمليات القدم الأولية والثانوية. المقياس = 10 ميكرومتر.

من Elger M و Hentschel H (1981) الكبيبة من teleost للمياه العذبة stentohaline ، Carassius auratus gibelioتتكيف مع المياه المالحة. مسح ونقل دراسة مجهرية الكترونية. بحوث الخلايا والأنسجة 220: 73–85 .


الإخراج والنفايات الأيضية؟ - مادة الاحياء

Audesirk / Audesirk: الحياة على الأرض الفصل 21: التغذية والهضم والإفراز

ما هي العناصر الغذائية التي تحتاجها الحيوانات؟

A. المغذيات الحيوانية تنقسم إلى خمس فئات رئيسية: الكربوهيدرات ، والدهون ، والبروتينات ، والمعادن ، والفيتامينات.

1. هذه العناصر الغذائية تمد الجسم باحتياجاته الأساسية: أ. الطاقة لتغذية الأيض الخلوي والأنشطة

ب. اللبنات الكيميائية ، مثل الأحماض الأمينية ، لبناء جزيئات معقدة فريدة لكل كائن حي

ج. المعادن والفيتامينات التي تشارك في مجموعة متنوعة من التفاعلات الأيضية.

1. الكربوهيدرات المعقدة هي المصدر الرئيسي للطاقة التي يدخلها الجسم. الحيوانات ، بما في ذلك البشر ، تخزن كربوهيدرات تسمى الجليكوجين (سلسلة شديدة التشعب من جزيئات الجلوكوز) في الكبد والعضلات. يتحلل هذا بعد ذلك إلى الجلوكوز ، المصدر الرئيسي للطاقة المتاحة للخلايا الفردية.

2. السكريات البسيطة لا تحتوي على الألياف أو الفيتامينات أو المعادن.

1. الفسفوليبيدات والكوليسترول من المكونات الهامة للأغشية. الدهون هي احتياطيات الطاقة وتوفر العزل والتبطين.

2. تشكل الدهون 40 في المائة من النظام الغذائي الأمريكي ، وينبغي أن تكون أقل من 30 في المائة.

3. يحتاج الجسم إلى القليل من الدهون المتعددة غير المشبعة لتزويده بالأحماض الدهنية الأساسية ، تلك التي لا يصنعها الجسم نفسه. البشر غير قادرين على تصنيع حمض اللينوليك ، وهو مطلوب لتخليق بعض الفوسفوليبيد ، لذلك نحن بحاجة للحصول على هذا الحمض الدهني الأساسي.

4. يستخدم الكوليسترول في تخليق الأحماض الصفراوية والهرمونات الجنسية ، ولكن الإفراط في استخدامه يسبب تلفًا في الدورة الدموية.

1. ينتج عن تكسير البروتين نفايات اليوريا التي يتم تصفيتها من الدم عن طريق الكلى. الأنظمة الغذائية المتخصصة التي يكون فيها البروتين مصدرًا رئيسيًا للطاقة تضع ضغطًا إضافيًا على الكلى. الدور الرئيسي للبروتين الغذائي هو مصدر للأحماض الأمينية لصنع جزيئات جديدة.

2. من بين عشرين نوعًا من الأحماض الأمينية المختلفة الموجودة في البروتينات ، تسعة منها ضرورية. أي يجب أن يوفره النظام الغذائي في أطعمة مثل اللحوم والحليب والبيض والذرة والفاصوليا وفول الصويا. نظرًا لأن العديد من البروتينات النباتية تعاني من نقص في بعض الأحماض الأمينية الأساسية ، يجب على الأفراد الذين يتبعون نظامًا غذائيًا نباتيًا أن يشملوا مجموعة متنوعة من النباتات التي لا توفر بروتيناتها معًا أي شيء ، أو قد يتعرضون لخطر نقص البروتين.

1. تتطلب الحيوانات مجموعة متنوعة من المعادن وهي جزيئات وعناصر صغيرة غير عضوية

2. يجب الحصول على المعادن من خلال النظام الغذائي سواء من الطعام أو مذابة في الماء.

3 - المعادن المطلوبة تشمل:

أ. Ca، Mg، P (العظام والأسنان)

ب. Na ، K (تقلص العضلات وتوصيل النبضات العصبية)

ج. Fe (إنتاج الهيموجلوبين)

د. أنا (وجدت في الهرمونات التي تنتجها الغدة الدرقية)

ه. كما يلزم وجود كميات ضئيلة من الزنك والنحاس والسيلينيوم.

1. يحتاج البشر إلى كميات صغيرة على الأقل من ثلاثة عشر جزيئًا عضويًا تسمى الفيتامينات للمساعدة في التمثيل الغذائي الخلوي.

2. الفيتامينات لا يمكن أن يصنعها الجسم (بكميات كافية) ويجب الحصول عليها من الغذاء.

3. يتم تصنيف الفيتامينات البشرية في فئتين: قابل للذوبان في الماء وقابل للذوبان في الدهون.

4. الفيتامينات القابلة للذوبان في الماء تشمل فيتامين ج وأحد عشر مركبًا مختلفًا يتكون منها مركب فيتامين ب الذي يذوب في الدم وتفرز عن طريق الكلى. تعمل هذه الفيتامينات عمومًا جنبًا إلى جنب مع الإنزيمات لتعزيز التفاعلات الكيميائية التي تزود الطاقة أو تصنع المواد.

5. يمكن تخزين الفيتامينات القابلة للذوبان في الدهون A و D و E و K في دهون الجسم وقد تتراكم في الجسم بمرور الوقت. على وجه الخصوص ، يساعد فيتامين ك في تنظيم تخثر الدم ، ويستخدم فيتامين أ لإنتاج صبغة بصرية للعين. قد تكون الفيتامينات القابلة للذوبان في الدهون سامة إذا تم تناولها بجرعات عالية بشكل مفرط.

ج: أكل البشر الأوائل الفواكه والخضروات يأكل البشر اليوم أطعمة محملة بالدهون والسكر والملح.

ب- النسب الموصى بها في غذاء الإنسان هي:

1. الكربوهيدرات المعقدة: 58-60٪

2. البروتينات: 12-15٪

3. الدهون والدهون الأخرى: 20-25٪

ج- إن النظام الغذائي المتوازن يلبي عادة جميع متطلبات هذه المواد ، فإن الإفراط في تناولها يكون على الأقل مهدرًا ، وفي أسوأ الأحوال ضار.

A. الطاقة في العناصر الغذائية تقاس بالسعرات الحرارية. السعرات الحرارية هي كمية الطاقة المطلوبة لرفع درجة حرارة 1 جرام من الماء بمقدار 1 درجة مئوية. يتم قياس محتوى السعرات الحرارية في الأطعمة بوحدات السعرات الحرارية (1000 سعرة حرارية).

ب- للحفاظ على وزن مقبول ، يجب أن يوازن مدخول السعرات الحرارية ناتج الطاقة. يحرق جسم الإنسان أثناء الراحة 1550 سعرة حرارية في اليوم. التمرين يعزز متطلبات السعرات الحرارية بشكل كبير.

يمكن تقدير متطلبات السعرات الحرارية بضرب وزنك المرغوب في 10 (شخص غير نشط) ، أو 15 (نشط بشكل معتدل) ، أو 20 (نشط جدًا) ثم طرحه من 0 إلى 400 حسب العمر.

سن 25-34 اطرح صفرًا.

سن 35-44 اطرح 100

سن 45-54 اطرح 200.

سن 55-64 اطرح 300.

من 65 اطرح 400.

د- السمنة هي زيادة الدهون في الأنسجة الدهنية في الجسم بالتعريف ينطبق هذا المصطلح على الأشخاص الذين يزيد وزنهم عن 25 في المائة عن المثالي.

التغذية والتمثيل الغذائي العضوي

يتم خلط جزيئات المغذيات وتعديلها بمجرد امتصاصها.

بعد الأكل بوقت قصير ، يرتفع مستوى الكربوهيدرات ، بعضها يتحول إلى دهون للتخزين ، والبعض الآخر يتحول إلى جليكوجين في الكبد وأنسجة العضلات.

بين الوجبات ، يتم الحفاظ على مستويات الجلوكوز عن طريق انهيار احتياطيات الجليكوجين في الكبد ويتم تحويل الأحماض الأمينية إلى أحماض دهنية جلوكوز من الدهون يمكن استخدامها مباشرة من قبل الخلايا للحصول على الطاقة.

د- يعد الكبد عضوًا مهمًا في تحويل العناصر الغذائية وإزالة السموم من المواد الكيميائية.

1. الجهاز الهضمي عبارة عن مساحة أو أنبوب داخلي به مناطق متخصصة لنقل الأغذية ومعالجتها وتخزينها. أ. يحتوي الجهاز الهضمي غير المكتمل على فتحة واحدة.

ب. الجهاز الهضمي الكامل عبارة عن أنبوب به فتحتان ، مما يسمح للطعام بالتحرك في اتجاه واحد عبر التجويف.

2. يؤدي الجهاز الهضمي هذه الوظائف الخمس:

أ. الابتلاع: يجب إدخال الطعام إلى الجهاز الهضمي

ب. الانهيار الميكانيكي: يجب تقسيم الطعام إلى قطع وخلطه ونقله.

ج. الانهيار الكيميائي: يجب أن تتعرض جزيئات الطعام للإنزيمات والهرمونات التي تتسبب في تكسير الجزيئات الكبيرة إلى جزيئات أصغر قادرة على عبور بطانة الأمعاء.

د. الامتصاص: يجب أن تنتقل الجزيئات الصغيرة من الجهاز الهضمي إلى الدم واللمف.

ه. الإخراج هو طرد المخلفات غير المهضومة وغير الممتصة في نهاية القناة الهضمية.

1. الهضم داخل الخلايا: بمجرد أن تبتلعها الخلية ، يتم وضع الطعام في فجوة الطعام. تندمج فجوة الطعام لاحقًا مع الجسيمات الحالة ويتم تقسيم الطعام داخل الفجوة إلى جزيئات أصغر يمكن امتصاصها في سيتوبلازم الخلية.

2. الهضم خارج الخلية:

أ. التجويف الوعائي المعدي الموجود في الكائنات المجوفة ، مثل شقائق البحر ، والهيدرا ، وقنديل البحر هو شكل من أشكال الهضم خارج الخلية. يتم إحضار الطعام الذي يتم التقاطه عن طريق مخالب لاذعة إلى تجويف الأوعية الدموية في الجهاز الهضمي حيث تعمل الإنزيمات على تكسيره. تمتص الخلايا المبطنة للتجويف العناصر الغذائية وتبتلع جزيئات الطعام الصغيرة حيث يحدث مزيد من الهضم باستخدام الهضم داخل الخلايا. يتم طرد البقايا غير المهضومة في النهاية من خلال نفس الفتحة التي دخلت من خلالها.

ب. الهضم في الأنبوب: يمتلك البشر والفقاريات الأخرى قنوات هضمية أنبوبية بها عدة مقصورات يكون الطعام فيها فيزيائيًا أولاً ، ثم يتفكك كيميائيًا قبل أن تمتصه الخلايا الفردية. وبالتالي ، فإن الحيوانات التي لديها قنوات هضمية أنبوبية تستخدم عملية الهضم خارج الخلية لتحطيم طعامها.

3. يرتبط التخصص الإقليمي & # 146s بسلوك التغذية.

أ. المجترات (على سبيل المثال ، الأبقار) قد تأكل العشب باستمرار ولديها معدة متعددة لهضم السليلوز.

ب. تحتوي معدة المجترات على أربع حجرات. تطورت الحجرة الأولى ، الكرش ، إلى وعاء تخمير ضخم يتضمن العديد من أنواع البكتيريا والأهداب التي تزدهر في علاقة متبادلة المنفعة مع المجترات. تنتج هذه الكائنات الدقيقة السليلوز ، وهو الإنزيم الذي يكسر السليلوز إلى السكريات المكونة له.

ج. قد يكون للحيوانات ذات العادات الغذائية المتقطعة أعضاء للتخزين. أي السناجب

الجهاز الهضمي البشري (الجدول 29-6)

الفصل 21 القسم 3 / دليل المختبر الفصل 17.1

ج: يبلغ طول الجهاز الهضمي البشري أكثر من 20 قدمًا.

1. تشمل المناطق المتخصصة الفم والبلعوم والمريء والمعدة والأمعاء الدقيقة والقولون والمستقيم والشرج.

2. تشمل الغدد الملحقة الغدد اللعابية والكبد (مع المرارة) والبنكرياس.

الجهاز البولي والتوازن

A. حجم وتركيب السائل خارج الخلية ، والذي يتكون من السائل الخلالي المحيط بالخلايا الحية والدم في الأوعية ، يتم الاحتفاظ به ضمن النطاقات التي يمكن تحملها بواسطة الجهاز البولي.

يساعد الجهاز البولي في الثدييات في الحفاظ على التوازن بعدة طرق:

1. ينظم مستويات الأيونات في الدم مثل الصوديوم والبوتاسيوم والكلوريد والكالسيوم.

2. ينظم محتوى الماء في الدم

3. يحافظ على درجة الحموضة المناسبة للدم.

4. الاحتفاظ بالعناصر الغذائية الهامة مثل الجلوكوز والأحماض الأمينية في الدم.

5. يفرز هرمونات مثل الإريثروبويتين الذي يحفز إنتاج خلايا الدم الحمراء

6. يزيل النفايات الخلوية مثل اليوريا.

1. يتم الحصول على الماء من خلال عمليتين: أ. يحدث امتصاص الماء من السوائل والأطعمة الصلبة في الجهاز الهضمي.

ب. ينتج عن استقلاب العناصر الغذائية الماء كمنتج ثانوي.

2. يتم فقدان الماء من خلال أربع عمليات على الأقل:

أ. يتم إفراز الماء عن طريق الإخراج البولي.

ب. يحدث التبخر من أسطح الجهاز التنفسي ومن خلال الجلد.

ج. يحدث التعرق على سطح الجلد.

د. التخلص من الماء في البراز أمر طبيعي.

د- مكاسب وخسائر الذوبان

1. تضاف المذابات إلى البيئة الداخلية من خلال أربع عمليات: أ. يتم امتصاص العناصر الغذائية والأيونات المعدنية والأدوية والمضافات الغذائية عن طريق الجهاز الهضمي.

ب. يضيف إفراز الغدد الصماء هرمونات.

ج. يضع التنفس الأكسجين في الدم.

د. تساهم تفاعلات التمثيل الغذائي في نفايات المنتجات.

2. تُفقد الأيونات المعدنية والنفايات الأيضية بهذه الطرق الثلاث:

أ. يتخلص الإخراج البولي من الأمونيا (المكونة من الأحماض الأمينية) ، واليوريا (المتكونة في الكبد عن طريق الانضمام إلى اثنين من الأمونيا # 146) ، وحمض البوليك (من الأحماض النووية).

ب. يتخلص التنفس من ثاني أكسيد الكربون ، وهو أكثر نفايات التمثيل الغذائي وفرة.

ج. يؤدي التعرق إلى فقدان الأيونات المعدنية.

الجهاز البولي للثدييات

1. الكلى (2) ترشح مجموعة متنوعة من المواد من الدم.

أ. يتم إرجاع معظم المرشح إلى الدم ، وينتهي حوالي 1 في المائة في شكل بول.

ب. تنظم الكلى حجم وتركيزات السوائل خارج الخلية.

2. يتدفق البول من كل كلية عبر الحالب إلى المثانة البولية (للتخزين) ثم يخرج من الجسم عبر مجرى البول.

3. التبول هو رد فعل انعكاسي ولكن يمكن السيطرة عليه عن طريق الأعمال العصبية والعضلية.

هيكل ووظيفة الكلى

كل كلية عبارة عن هيكل على شكل حبة فاصوليا بحجم قبضة اليد.

1. غلاف صلب من النسيج الضام ، الكبسولة الكلوية ، يغطي كل كلية.

2.يوجد في الداخل منطقة قشرة خارجية تغطي منطقة النخاع.

3. النيفرون المكون من الشعيرات الدموية والنبيبات يقوم بترشيح الماء ويذوب من الدم ويعيد الكثير منه.

B. الوحدات الوظيفية للكلى النيفرون

1. يحدث الترشيح في الكبيبة ، وهي كرة من الشعيرات الدموية موضوعة في كبسولة بومان.

2. تجمع كبسولة بومان المرشح وتوجهه عبر أنابيب نيفرون المستمرة: الحلقة القريبة - & gt من قناة Henle - & gt القاصية - & gt.

3. تخرج الشعيرات الدموية من الكبيبة ، وتتقارب ، ثم تتفرع مرة أخرى إلى الشعيرات الدموية المحيطة بالنبيبات حول أنابيب النيفرون ، حيث تشارك في استعادة المياه والمواد المذابة الأساسية.

عمليات تكوين البول ، نظرة عامة

1. في عملية الترشيح ، تقوم قوى ضغط الدم بالترشيح من الشعيرات الدموية الكبيبية إلى كبسولة بومان ، ثم إلى الأنابيب القريبة.

أ. لا تستطيع خلايا الدم والبروتينات والمذابات الكبيرة الأخرى تمرير جدار الشعيرات الدموية إلى الكبسولة.

ب. يتم إجبار الماء والجلوكوز والصوديوم واليوريا على الخروج.

2. يحدث الامتصاص في الأجزاء الأنبوبية من النيفرون ، حيث يتحرك الماء والمواد المذابة عبر الجدار الأنبوبي ، خارج النيفرون ، وفي الشعيرات الدموية المحيطة.

3. ينقل الإفراز المواد من الشعيرات الدموية إلى جدران النيفرون.

أ. تفرز الشعيرات الدموية المحيطة بالنيفرون كميات زائدة من أيونات الهيدروجين وأيونات البوتاسيوم في أنابيب النيفرون.

ب. هذه العملية أيضًا تخلص الجسم من الأدوية وحمض البوليك ومنتجات تكسير الهيموجلوبين والنفايات الأخرى.

4. يمكن أن يتركز البول بسبب وجود تدرج تركيز تناضحي للأملاح واليوريا في السائل الخلالي المحيط بحلقة Henle.

أ. العوامل المؤثرة في الترشيح

1. يمكن للكلى معالجة حوالي 125 مل (حوالي 4 أونصات) من الدم كل دقيقة بسبب عاملين: أ. الشعيرات الدموية الكبيبية شديدة النفاذية للماء والمذابات الصغيرة.

ب. يدخل الدم الكبيبة تحت ضغط مرتفع ، وهذه الشرايين لها أقطار أوسع من معظم الشرايين.

2. معدل ترشيح الكلى لحجم معين من الدم يعتمد على تدفق الدم من خلالها ومعدل إعادة الامتصاص في الأنابيب العصبية التي تعمل بالضوابط الهرمونية.

إعادة امتصاص الماء والصوديوم

1. آليات داخل الكلى تنظم بعناية إفراز المواد والاحتفاظ بها على أساس المدخول والحاجة الجسدية. أ. يتم ضخ أيونات الصوديوم من الأنابيب القريبة (المرشح) إلى السائل الخلالي المحيط بالشعيرات الدموية حول الأنبوب.

ب. تتدفق كميات كبيرة من المياه بشكل سلبي أسفل التدرج الذي تم إنشاؤه.

ج. في الطرف النازل لحلقة هنلي ، يتحرك الماء للخارج بالتناضح ، ولكن في الجزء الصاعد يتم ضخ الصوديوم.

د. ينتج هذا التفاعل بين أطراف الحلقة تركيزًا ذائبًا عاليًا جدًا في الأجزاء العميقة من لب الكلى ويوصل بولًا مخففًا إلى حد ما إلى النبيبات البعيدة.

2. التعديلات التي يسببها الهرمون

أ. يُفرز الهرمون المضاد لإدرار البول (ADH) من الغدة النخامية الخلفية استجابةً لانخفاض في السائل خارج الخلوي يتسبب في أن تصبح الأنابيب البعيدة وقنوات التجميع منفذة للماء ، والتي تعود إلى الشعيرات الدموية مما يسمح بإعادة امتصاص المزيد من الماء من البول .

ب. عندما تنخفض مستويات الصوديوم ، ينخفض ​​حجم السائل خارج الخلية ، يؤدي ذلك إلى تحفيز بعض خلايا الكلى على إفراز الرينين ، الذي يعمل على قشرة الغدة الكظرية لإطلاق الألدوستيرون ، الذي يعزز امتصاص الصوديوم.

ج. عندما يرتفع تركيز المذاب في السائل خارج الخلية ، يستجيب مركز العطش في منطقة ما تحت المهاد عن طريق تقليل إنتاج اللعاب ، مما يسبب العطش.

ج- تنظيم ضغط الدم ومحتوى الأكسجين

1. هرمونان تفرزهما الكلى مهمان في تنظيم ضغط الدم وقدرة حمل الأكسجين في الدم مثل الرينين والإريثروبويتين.

2. عندما ينخفض ​​ضغط الدم ، تفرز الكلى الرينين في مجرى الدم. الرينين بمثابة إنزيم يحفز تكوين هرمون الأنجيوتنسين الثاني. يؤدي أنجيوتنسين بدوره إلى تقلص الشرايين لارتفاع ضغط الدم.

3. انقباض الشرايين التي تنقل الدم إلى الكلى يقلل أيضًا من معدل ترشيح الدم مما يؤدي إلى تقليل كمية المياه المراد إزالتها من الدم. يتسبب احتباس الماء في زيادة حجم الدم وبالتالي زيادة ضغط الدم.

4. استجابةً لانخفاض مستويات الأكسجين في الدم ، تفرز الكلى هرمون إرثروبويتين ثانٍ. ينتقل إرثروبويتين في الدم إلى النخاع العظمي حيث يحفز الإنتاج السريع لخلايا الدم الحمراء التي يتمثل دورها في نقل الأكسجين.

ج: يمكن أن يؤدي احتباس الصوديوم والماء الزائد إلى ارتفاع ضغط الدم.

ب- يمكن أن تترسب رواسب حمض اليوريك وأملاح الكالسيوم والنفايات الأخرى في الحوض الكلوي لتكوين حصوات الكلى. أوتش.

ج. هناك حاجة إلى آلات غسيل الكلى في حالة فقدان الضوابط العادية على حجم وتركيب السائل خارج الخلية.

1. في غسيل الكلى ، يتم توصيل الجهاز مباشرة بأوعية الدم لمدة أربع ساعات ، ثلاث مرات في الأسبوع.

2. في غسيل الكلى البريتوني ، يتم وضع السائل في تجويف بطن المريض ليكون بمثابة وسيط لغسيل الكلى ، ثم يتم تصريفه بعد فترة من الزمن.

الحفاظ على درجة حرارة الجسم الأساسية

تساعد العديد من الاستجابات الفسيولوجية والسلوكية المختلفة في الحفاظ على درجة حرارة الجسم الداخلية.

ب. درجات حرارة مناسبة للحياة

1. تظل الإنزيمات وظيفية في نطاق 0 إلى 40 درجة مئوية.

2. يحدث تمسخ أكثر من 41 درجة مئوية ، مما يجعل الإنزيم غير فعال.

3. قد لا تؤدي درجات الحرارة الأكثر برودة إلى تعطيل النشاط ، ولكنها تبطئه بمقدار النصف لكل انخفاض بمقدار 10 درجات.

1. الإشعاع هو اكتساب الحرارة من بعض المصادر ، أو فقدان الحرارة من الجسم إلى المناطق المحيطة اعتمادًا على درجات حرارة البيئة.

2. التوصيل هو نقل الحرارة من جسم إلى آخر عندما يكونون على اتصال مباشر ، كما هو الحال عندما يجلس الإنسان على الخرسانة الباردة (أو الساخنة!).

3. الحمل الحراري هو نقل الحرارة عن طريق مائع متحرك مثل الهواء أو الماء.

4. التبخر هو عملية تتغير فيها مادة مسخنة من الحالة السائلة إلى الحالة الغازية ، مع فقدان الحرارة إلى البيئة المحيطة.

تصنيف الحيوانات على أساس درجة الحرارة

1. تكتسب الحيوانات ذات معدلات التمثيل الغذائي المنخفضة الحرارة من البيئة.

2. تقوم الحرارة الخارجية ، مثل السحالي ، بإجراء تعديلات على درجات الحرارة الخارجية المتغيرة فيما نسميه تنظيم درجة الحرارة السلوكية.

1. تولد الحرارة الماصة للحرارة من النشاط الأيضي وأيضًا تمارس التحكم في الحفاظ على الحرارة وتبديدها.

2. تحتوي المواد الماصة للحرارة على تكيفات مثل الريش أو الفراء أو الدهون لتقليل فقد الحرارة ، كما تقوم أيضًا بتعديل سلوكها عن طريق التحرك تحت الأرض أثناء حرارة النهار ، على سبيل المثال.

تولد الحرارة المتغيرة ، مثل الطائر الطنان ، حرارة الجسم خلال فترات نشاطها ولكنها تشبه الحرارة الخارجية في أوقات الخمول.

D. مقارنة الاستراتيجيات الحرارية

1. تتمتع Ectotherms بميزة في المناطق الاستوائية حيث لا يتعين عليها إنفاق الكثير من الطاقة للحفاظ على درجة حرارة الجسم.

2. تتمتع Endotherms بميزة في الظروف المعتدلة إلى الباردة.

تنظيم درجة الحرارة في الثدييات

A. الردود على الإجهاد البارد

1. تستجيب الثدييات للبرد عن طريق تضييق العضلات الملساء في الأوعية الدموية للجلد (تضيق الأوعية المحيطية) ، مما يؤخر فقدان الحرارة.

2. في الاستجابة الحركية ، يصبح الشعر أو الريش أكثر انتصابًا لتكوين طبقة من الهواء الساكن تقلل من فقد الحرارة بالحمل الحراري والإشعاعي.

3. الهزات الإيقاعية (الارتعاش) هي استجابة شائعة للبرد ولكنها ليست فعالة لفترة طويلة وتأتي بتكلفة استقلابية عالية.

4. يمكن أن تنتج الثدييات السباتية حرارة غير مسببة للتحفيز الهرموني لنسيج دهني بني خاص.

5. انخفاض حرارة الجسم هو حالة تنخفض فيها درجة الحرارة الأساسية عن المعدل الطبيعي وقد يؤدي إلى تلف في الدماغ وموت قضمة الصقيع هو موت الخلايا الموضعي بسبب التجميد.

B. الردود على الإجهاد الحراري

1. توسع الأوعية المحيطية هو توسيع أقطار الأوعية الدموية للسماح بوصول كميات أكبر من الدم إلى الجلد وتبديد الحرارة.

2. فقدان الحرارة التبخيري عن طريق التعرق هو آلية تبريد شائعة وواضحة.

3. يتم استخدام اللهاث من قبل الحيوانات التي لديها قدرة قليلة جدًا على التعرق.

4. ارتفاع الحرارة هو ارتفاع في درجة الحرارة الأساسية ، مع آثار مدمرة.

1. أثناء الحمى ، يقوم الوطاء بإعادة ضبط "منظم الحرارة" في الجسم إلى درجة حرارة أساسية مؤقتة جديدة. أ. في بداية الحمى ، ينخفض ​​فقدان الحرارة ويزيد إنتاج الحرارة من شعور الشخص بالبرودة.

ب. عندما تنفجر الحمى ، يزداد توسع الأوعية المحيطية والتعرق حيث يحاول الجسم خفض درجة الحرارة الأساسية إلى وضعها الطبيعي.

2. يبدو أن الزيادة المضبوطة في درجة حرارة الجسم (ضمن حدود) أثناء الحمى تعزز الاستجابة المناعية للجسم.

حقوق النشر 2000 لستيفن ورمسلي
تم التحديث الأخير في 5 يناير 2000 بواسطة ستيفن ورمسلي


خلايا اللهب من Planaria و Nephridia of Worms

مع تطور الأنظمة متعددة الخلايا لتصبح لديها أنظمة عضوية تقسم احتياجات التمثيل الغذائي للجسم ، تطورت الأعضاء الفردية لأداء وظيفة الإخراج. Planaria هي ديدان مفلطحة تعيش في المياه العذبة. يتكون نظام الإخراج الخاص بهم من أنبوبين متصلين بنظام مجاري متفرعة للغاية. تسمى الخلايا الموجودة في الأنابيب خلايا اللهب (أو بروتونفيريديا ) لأن لديهم مجموعة من الأهداب تشبه اللهب الخافت عند رؤيتها تحت المجهر ، كما هو موضح في الشكل 22.10 أ . تدفع الأهداب الفضلات إلى أسفل الأنابيب وخارج الجسم من خلال المسام المطروحة التي تفتح على سطح أهداب الجسم أيضًا سحب الماء من السائل الخلالي ، مما يسمح بالترشيح. يتم استرداد أي نواتج قيمة عن طريق إعادة الامتصاص. تم العثور على خلايا اللهب في الديدان المفلطحة ، بما في ذلك الديدان الشريطية الطفيلية والنباتات التي تعيش بحرية. كما أنها تحافظ على التوازن الأسموزي للكائن الحي.

الشكل 22.10. في نظام الإخراج لـ (أ) بلاناريا ، تدفع أهداب خلايا اللهب النفايات من خلال أنبوب يتكون من خلية أنبوبية. ترتبط الأنابيب النُبيباتية في هياكل متفرعة تؤدي إلى مسام تقع على طول جوانب الجسم. يفرز المرشح من خلال هذه المسام. في (ب) الحلقات مثل ديدان الأرض ، سائل ترشيح نيفريديا من اللولب ، أو تجويف الجسم. ضرب الأهداب عند فتحة nephridium سحب الماء من اللولب إلى أنبوب صغير. عندما يمر المرشح أسفل الأنابيب ، يتم امتصاص العناصر الغذائية والمواد المذابة الأخرى بواسطة الشعيرات الدموية. يتم تخزين السوائل المفلترة التي تحتوي على النيتروجين والنفايات الأخرى في المثانة ثم يتم إفرازها من خلال ثقب في جانب الجسم.

ديدان الأرض (الحلقات) لها هياكل مطرح أكثر تطوراً تسمى نيفريديا ، موضح في الشكل 22.10 ب . يوجد زوج من nephridia في كل جزء من دودة الأرض. إنها تشبه خلايا اللهب من حيث أن لديها أنبوب صغير به أهداب. يحدث الإفراز من خلال مسام تسمى نيفريديوبور . إنها أكثر تطورًا من خلايا اللهب من حيث أن لديها نظامًا لإعادة الامتصاص الأنبوبي بواسطة شبكة شعرية قبل الإخراج.


مناقشة

كان هدفنا هو توصيف التعديلات الأيضية الرئيسية في السبات أثناء الصيام لفترات طويلة في ظل ظروف الحرارة العادية ، وتقييم الآثار الموسمية المحتملة. تُظهر هذه الدراسة أن طيور الخشب تستخدم استراتيجية مزدوجة للتعامل مع الصيام الطبيعي: (1) أنها تخفض معدل الأيض بسرعة (ما لم تكن تعمل بالفعل بمعدلات منخفضة للغاية كما في الربيع) ، مما قد يقلل من إنفاق الطاقة إلى أدنى مستوى لا يزال متوافقًا مع الحياة الطبيعية للحرارة ، و (2) يعيدون تنظيم نمط اختيار الوقود الخاص بهم لتجنيب احتياطيات محدودة من البروتينات.

الاكتئاب الناجم عن الصيام

في حالة التغذية ، يكون معدل الأيض أعلى بكثير في الصيف منه في الربيع (+ 35٪ انظر الجدول 1) ، وتتسق هذه الملاحظة مع القياسات المنشورة على طيور الخشب والمارموط بعد الامتصاص (Bailey، 1965 Körtner and Heldmaier، 1995 Rawson et al. ، 1998). بعد الاستيقاظ الربيعي ، يبدو معدل الأيض الأساسي المنخفض أمرًا بالغ الأهمية للبقاء على قيد الحياة لفترة الصيام الطبيعي الحراري التي تتبع عادةً 5 أشهر من السبات (Davis، 1967 Hamilton، 1934 Snyder et al.، 1961). أثناء الصيام ، تم استخدام الاكتئاب الأيضي فقط في الصيف (انخفاض بنسبة 25٪ في الخامسا2 أكثر من أسبوعين الشكل 2) ، ولم يحدث في الربيع. تشير هذه الملاحظة إلى الاحتمال المثير للاهتمام أن الأيض القاعدى الحرارى له حد أدنى. إن احتمالية وجود حد أدنى من معدل الأيض الأساسي للثدييات ذات درجة الحرارة الطبيعية مدعوم بحقيقة أن حطاب الخشب في الصيف والربيع يصلان إلى نفس معدل إنفاق الطاقة بعد 14 يومًا من الصيام ، على الرغم من اختلاف معدلات ما قبل الصيام اختلافًا كبيرًا. توفر القياسات التي أجريت على الأرانب دعمًا إضافيًا لنفس المفهوم لأن هذا النوع يبدأ بمعدل استقلاب أعلى بكثير بعد الامتصاص من خشب الربيع أو الصيف ، لكنه يظهر اكتئابًا أيضيًا أقوى أثناء الصيام (-32٪ في 7 أيام فقط). الانخفاض السريع في إنفاق الطاقة الذي تظهره الأرانب غير كافٍ لتعويض معدل الأيض العالي بعد الامتصاص (الجدول 1 ، الشكل 2 أ) ، وبالتالي ، يكون فقدان كتلة الجسم أسرع بكثير في الأرانب (-15٪ في 7 يومًا) مقارنةً بالطيور الخشبية (-13٪ في 14 يومًا) (الشكل 1). لهذا السبب ، كان لا بد من إنهاء تجارب الأرانب بعد أسبوع واحد (وفقًا للحد الذي حددته لجنة رعاية الحيوانات لدينا) ، ولم نتمكن من تحديد ما إذا كانت فترة الصيام الأطول ستؤدي في النهاية إلى خفض معدل التمثيل الغذائي للأرانب إلى المستويات الأدنى. لوحظ في woodchucks. في كلا النوعين ، كان الاكتئاب الأيضي مصحوبًا بانخفاض طفيف ولكنه مهم في درجة حرارة الجسم (الشكل 3) ، كما لوحظ سابقًا في الأنواع الأخرى بما في ذلك الفئران (Ma and Foster ، 1986). مثل الربيع ، يبدو أن الثدييات الأخرى ذات معدلات الأيض القاعدية المنخفضة بشكل طبيعي تفتقر إلى القدرة على اكتئاب التمثيل الغذائي أثناء الصيام. تجارب على أبوسوم فرجينيا ديدلفيس فيرجينيانا، جرابي بحجم جسم مشابه (3-4 كجم) ، كشف أن هذا النوع الليلي يصل إلى أدنى معدل استقلاب له وهو 200 ميكرولتر O2 كجم -1 دقيقة -1 (أو 4.5 مل O2 كجم -1 دقيقة -1) أثناء النوم أثناء النهار (انظر الشكل 1 في ويبر وأوكونور ، 2000). هذا الحد الأدنى لمعدل ما بعد الامتصاص مطابق لأدنى قيمة لوحظت هنا في woodchucks (الشكل 2 أ) ولا يستطيع حيوان الأبوسوم في فرجينيا خفض معدل الأيض بشكل أكبر استجابة للصيام (Weber and O'Connor، 2000).

العمليتان الرئيسيتان اللتان تستهلكان ATP اللتان تمثلان معدل الأيض الأساسي هما ضخ الأيونات عبر الغشاء وتخليق البروتين (Rolfe and Brown ، 1997). من المتصور أن الثدييات لا يمكنها إلا أن تقلل من تنظيم هذه العمليات الأساسية إلى الحد الأدنى ، حيث تتعرض الحياة الحرارية الطبيعية للخطر. على سبيل المثال ، يمكن تحقيق خفض تكلفة ضخ الأيونات عن طريق تقليل تسرب الأيونات من الأغشية من خلال التغييرات في درجة تشبع الفوسفوليبيد (Hulbert and Else، 2000). ومع ذلك ، فإن تعديل تشبع الفسفوليبيد سيؤثر أيضًا على العديد من وظائف الأغشية المهمة الأخرى من خلال التغييرات في السيولة الكلية (مثل حساسية الأنسولين) ، وقد لا يكون هذا الاضطراب واسع النطاق متوافقًا مع حياة الثدييات عند درجة حرارة -37 درجة مئوية. هناك طريقة أخرى لتقليل إنفاق الطاقة أثناء الصيام وهي تقليل تسرب البروتون في الميتوكوندريا ، وهي عملية تفصل بين استهلاك الأكسجين وبين فسفرة ADP. تظهر دراستان حديثتان أن الصيام وتقييد السعرات الحرارية لا يؤثران على تسرب البروتون (Bézaire et al. ، 2001 Ramsay et al. ، 2004) ، بينما تشير دراسة أخرى إلى انخفاض تسرب البروتون. عبر الآليات المعقدة التي تختلف باختلاف مدة تقييد السعرات الحرارية (Bevilacqua et al. ، 2004). من الواضح أن الوجود المحتمل للحد الأدنى من معدل الأيض الحراري الطبيعي في ماصات الحرارة ، والقيود الميكانيكية لنقطة ضبطه المحددة ، تستدعي مزيدًا من التحقيق.

التغييرات في اختيار الوقود: تجنيب البروتين

بالإضافة إلى الاكتئاب الأيضي ، فإن الصيام لفترات طويلة له تأثيرات مهمة على اختيار الوقود. في تجاربنا ، حدثت التغييرات الرئيسية الناتجة عن الحرمان من الطعام في غضون يومين ، وبالتالي ، تم تجميع جميع القيم التي تم قياسها بعد هذا الوقت لكل مجموعة من الحيوانات (الشكل 4). في كلا النوعين ، تم استبدال الاستخدام السائد للكربوهيدرات التي عادةً ما تدعم استقلاب الطاقة في حالة ما بعد الامتصاص (المرحلة الأولى) باستخدام نسبة عالية من الدهون (المرحلة الثانية) مع استمرار الصيام (الشكل 4). ومع ذلك ، لوحظت الاختلافات الأكثر وضوحًا في اختيار الوقود فيما يتعلق بتوفير البروتين. في الربيع ، كان لدى Woodchucks أقل معدل لأكسدة البروتين الصافي ، ربما لأن نمط اختيار الوقود الخاص بهم يعكس حالة السبات بشكل أكبر مما كان عليه في الصيف. في حالة التغذية ، شكلت البروتينات 8٪ فقط من معدل الأيض في خشب الربيع ، بينما وصلت إلى 17٪الخامسا2 في الصيف ، وبقيمة عالية 28٪الخامسا2 في الأرانب (الشكل 4 أ). كل المجموعات لديها القدرة على خفض المعدلات المطلقة والنسبية لأكسدة البروتين الصافي استجابة للصيام. بعد أكثر من 3 أيام بدون طعام ، انخفضت مساهمة البروتينات إلى 5٪الخامسا2 في الربيع woodchucks ، 6٪الخامسا2 في الصيف و 20٪الخامسا2 في الأرانب. لذلك ، يُظهر الخشب قدرة فائقة على تجنيب البروتين (ينعكس أيضًا من خلال معدلات استهلاك المياه وإنتاج البول الأقل بكثير من الأرانب انظر الشكل 6) ، خاصة خلال فصل الصيف. في هذا الوقت من العام ، لا يمكنهم فقط تقليل المعدل الإجمالي لإنفاق الطاقة للتعامل مع الصيام ، ولكن أيضًا تقليل اعتمادهم على البروتينات بشكل كبير. تساعد استراتيجية التمثيل الغذائي هذه في الحفاظ على كتلة العضلات وقد لوحظت في أنواع أخرى تتكيف مع الصيام لفترات طويلة. عادة ما يتأقلم تكاثر الفقمة البالغة وجراء الفقمة بعد الفطام لعدة أسابيع بدون طعام عن طريق تقليل معدل الأيض إلى ∼45٪ من القيم الطبيعية في الحيوانات التي تتغذى عليها واعتمادها على البروتينات حتى 6٪ الخامسا2(Nørdoy et al. ، 1993 ، 1990 Worthy and Lavigne ، 1987). ومع ذلك ، يمكن العثور على أقصى سعة لتوفير البروتين في الدببة. خلال فصل الصيف ، يمنع ركود حزمة الجليد الدببة القطبية يو ماريتيموس من صيد الفقمة ويبدو أنها تقلل أكسدة البروتين إلى 1٪ الخامسا2 استجابة للصيام (أتكينسون وآخرون ، 1996 نيلسون ، 1987). الدببة السوداء أورسوس أمريكانوس ودببة أشيب U. arctos خفض درجة حرارة الجسم بضع درجات ومعدل الأيض بنسبة 30٪ أثناء "السبات الزائف" ، والذي يمكن أن يستمر لمدة تصل إلى 6 أشهر (واتس وآخرون ، 1981). خلال هذا الوقت ، لم يتم إفراز أي نفايات نيتروجين (Barboza et al. ، 1997 Nelson ، 1973 ، 1980 Nelson et al. ، 1973) وتم استدعاء آليتين محتملتين لشرح هذه الملاحظة: (1) تثبيط كامل لأكسدة البروتين و / أو (2) إعادة تدوير منتجات نفايات النيتروجين. تظهر التجارب الأحدث التي تم فيها أخذ عينات من خزعات العضلات في بداية ونهاية الشتاء أن تحلل البروتين في الدببة السباتية هو في الواقع مهم ولكنه منخفض (Tinker et al. ، 1998).لذلك ، لديهم القدرة على إعادة تدوير النيتروجين لأنه لا تتراكم أي نفايات أثناء السبات.


كلمات لتعرف

الهرمون المضاد لإدرار البول: مادة كيميائية تفرزها الغدة النخامية تنظم كمية الماء التي تفرزها الكلى.

غسيل الكلى: عملية فصل الفضلات عن الدم بالمرور عبر غشاء نصف نافذ.

نفرون: وحدة ترشيح الكلى.

اليوريا: مركب كيميائي من الكربون والهيدروجين والنيتروجين والأكسجين ينتج كنفايات بواسطة الخلايا التي تكسر البروتين.

الحالب: أنبوب ينقل البول من الكلية إلى المثانة البولية.

الإحليل: قناة مؤدية من المثانة البولية إلى خارج الجسم يتم من خلالها إخراج البول.

يُطلق على السائل المحتوي على الفضلات الذي يبقى في النيفرون البول. يتكون البول من 95 في المائة من الماء ، حيث يتم إذابة الفضلات. يحمل زوج من الأنابيب يسمى الحالبان البول من الكلى إلى المثانة البولية. يبلغ طول كل حالب حوالي 16 إلى 18 بوصة (40 إلى 45 سم). المثانة عبارة عن كيس عضلي مجوف يقع في الحوض ينهار عندما يفرغ ، ولكنه على شكل كمثرى وينتفخ عند الامتلاء. يمكن أن تحتوي المثانة عند الشخص البالغ على أكثر من كوبين (0.6 لتر) من البول. تفرغ المثانة البول في مجرى البول ، وهي قناة تؤدي إلى خارج الجسم. في الذكور ، يبلغ طول مجرى البول حوالي 8 بوصات (20 سم). في الإناث ، يبلغ طولها أقل من بوصتين (5 سم). تتحكم العضلة العاصرة حول مجرى البول عند قاعدة المثانة في تدفق البول بين الاثنين.

يتم التحكم في حجم البول المُفرَز عن طريق الهرمون المضاد لإدرار البول (ADH) ، الذي تفرزه الغدة النخامية (غدة صغيرة تقع في قاعدة الجمجمة). إذا تعرق الفرد كثيرًا أو فشل في شرب كمية كافية من الماء ، فإن الخلايا العصبية الخاصة في منطقة ما تحت المهاد (منطقة من الدماغ تتحكم في درجة حرارة الجسم والجوع والعطش) تكتشف انخفاض تركيز الماء في الدم. ثم يقومون بإرسال إشارة إلى الغدة النخامية لإطلاق هرمون (ADH) في الدم ، حيث تنتقل إلى الكلى. مع وجود هرمون ADH ، تعيد الكلى امتصاص المزيد من الماء من البول وإعادته إلى الدم. وهكذا ينخفض ​​حجم البول. من ناحية أخرى ، إذا تناول الفرد الكثير من الماء ، فإن إنتاج هرمون ADH ينخفض. لا تعيد الكلى امتصاص الكثير من الماء ، ويزداد حجم البول. يمنع الكحول إنتاج الهرمون المضاد لإدرار البول وبالتالي يزيد من إنتاج البول.


أساليب

متوسطة وسلالات

تم سرد جميع السلالات المستخدمة في هذه الدراسة في جدول S1. جميع تسميات الخميرة تتبع الاصطلاح القياسي. بالنسبة لجميع التجارب ، تم أولاً ضرب سلالات الخميرة المجمدة المخزنة عند درجة حرارة -80 درجة مئوية على ألواح YPD (10 جم / لتر مستخلص الخميرة ، 20 جم / لتر ببتون ، 20 جم / لتر جلوكوز + 2٪ أجار) ونمت عند 30 درجة مئوية لـ حوالي 48 ساعة ، تم تلقيح مستعمرة واحدة منها في 3 مل من YPD ونمت طوال الليل عند 30 درجة مئوية مع التحريض. أجريت جميع التجارب في غضون 5 أيام من توليد الثقافة بين عشية وضحاها. يحتوي متوسط ​​الحد الأدنى (SD) على 6.7 جم / لتر قاعدة نيتروجين خميرة ديفكو بدون أحماض أمينية ولكن مع كبريتات الأمونيوم (Thermo Fisher Scientific ، Waltham ، MA ، الولايات المتحدة الأمريكية) و 20 جم / لتر D- الجلوكوز ، باستثناء أثناء تجارب الحد من الجلوكوز ، حيث تم استخدام مستويات أقل من الجلوكوز على النحو المحدد. يتكون وسط تجويع الجلوكوز (S) فقط من 6.7 جم / لتر قاعدة نيتروجين خميرة ديفكو بدون أحماض أمينية ولكن مع كبريتات الأمونيوم. يحتوي وسط تجويع النيتروجين (SD-N) على 1.7 جم / لتر قاعدة نيتروجين خميرة ديفكو بدون أحماض أمينية أو كبريتات الأمونيوم و 20 جم / لتر جلوكوز D. اعتمادًا على الضمور العضوي للإجهاد ، تم تكميل SD مع ليسين (164.3 ميكرومتر) ، أو كبريتات الأدينين (108.6 ميكرومتر) [74] ، أو كبريتات عضوية (134 ميكرومتر) بحيث يمكن أن تنمو الخلايا بشكل كبير.

تم بناء السلالات إما عن طريق تقاطعات الخميرة أو عن طريق إعادة التركيب المتماثل [74،75]. تم تنفيذ الصلبان عن طريق تزاوج سلالات الوالدين ، وسحب ثنائي الصبغة ، والتشريح ، والتشريح الرباعي ، والاختيار على لوحات مناسبة. كمثال على حذف الجينات ، فإن bcy1شيد Δ سلالة (WY2527) بواسطة PCR تضخيم الجينات المقاومة KanMX من البلازميد (WSB26 [76]) باستخدام بادئات WSO671 (TACAACAAGCAGATTATTTTCAAAAGACAACAGTAAGAATAAACGcagctgaagcttcgtacgc) وWSO672 (GAGAAAGGAAATTCATGTGGATTTAAGATCGCTTCCCCTTTTTACataggccactagtggatctg)، مع التماثل الزوج 45 قاعدة (الأحرف الكبيرة) إلى المنبع ومنطقة المصب من BCY1 الجين ، على التوالي. ال ليز - تم بعد ذلك تحويل السلالة WY2490 باستخدام منتج PCR ، وتم اختيار المحولات على لوحة G418. تم تأكيد الحذف الناجح عبر فحص PCR باستخدام جهاز تمهيدي في اتجاه التيار BCY1 الجين (WSO673 TATACTGTGCTCGGATTCCG) مقترنًا بدليل داخلي لكاسيت KanMX المضخم (WSO161 ctaaatgtacggcgacagt).

تطور

تم وصف تطور زراعة المحاصيل في دراسة سابقة [32]. لإحياء مزرعة ، تم أخذ حوالي 20 ميكرولتر من العينة المجمدة باستخدام ملعقة معدنية معقمة ، وتم تخفيفها حوالي 10 أضعاف في SD ، والسماح لها بالنمو لتعكر معتدل لمدة 1-2 أيام. تم توسيع الاستزراع عن طريق إضافة 3 مل من SD. تطورت ليز - تم عزل الحيوانات المستنسخة عن طريق طلاء زراعة جوز الهند على أجار الوسائط الغنية (YPD) مع مادة hygromycin B.

لتطور الزراعة الأحادية ، تم استخدام أوعية ناظم كيميائي (S14 Fig) (طرق ، "Chemostats و turbidostats"). لإنشاء بيئة معقمة ، تم إجراء التجميع الأولي في صواني الأوتوكلاف ، مع تثبيت الأوعية في رفوف الأنبوب. تم تحضير ستة خزانات بإضافة 810 مل ماء لكل زجاجة. تم تحضير ستة أوعية عن طريق إضافة قضيب تحريك 10 ملم و 20 مل من وسائط النمو (SD + 21 ميكرومتر ليسين) لكل وعاء. تم إرفاق أنابيب توصيل الوسائط بين الخزانات والأوعية من خلال سدادات مطاطية ، وتم ربط أنابيب النفايات بكل ذراع تدفق خارجي ، مع نهاية غير متصلة مغطاة برقائق مثبتة في مكانها بواسطة شريط الأوتوكلاف. تم وضع أنبوب طرد مركزي بسعة 1.5 مل فوق إبرة أخذ العينات وتم تثبيته في مكانه بواسطة شريط الأوتوكلاف. كما تم تغليف منافذ الأنابيب بورق الألمنيوم. تم وزن كل خزان مع الأنابيب المرفقة به ، وتعقيم المجموعة بأكملها ، ثم وزن كل خزان مرة أخرى. تم حساب الماء المفقود وإضافته مرة أخرى. في ظل ظروف معقمة ، تمت إضافة 90 مل من 10 × SD ومخزون ليسين إلى كل خزان للوصول إلى تركيز ليسين نهائي يبلغ 21 ميكرومتر. ثم تم تأمين الأوعية في الأوعية المتشعبة الناظم الكيميائي ، والخزانات الموضوعة على المقاييس ، والأنابيب الملولبة في المضخات.

متوارث أو متطور ليز - نمت الحيوانات المستنسخة في 50 مل SD + 164 ميكرومتر ليسين لمدة 20 ساعة تقريبًا قبل التلقيح. قبل كل تجربة ، تم تتبع النمو لضمان نمو الخلايا على النحو الأمثل (حوالي 1.6 ساعة من الوقت المضاعف). عندما تصل الخلايا إلى كثافة تقارب 0.2 OD600، تم غسل الخلايا 3 مرات في SD وتم تلقيحها في وعاء ناظم كيميائي مملوء مسبقًا بـ SD + 21 ميكرومتر ليسين. بعد هذه الخطوة ، تم تشغيل مضخات ناظم كيميائي في وقت مضاعف محدد في حزمة برامج LabView المخصصة. احتوت كل وعاء ناظم كيميائي تقريبًا على حجم تشغيل 43 مل وتم ضبطه على وقت مضاعفة الهدف (على سبيل المثال ، لمضاعفة 7 ساعات ، يكون معدل التدفق 43 × ln2/7 = 4.25 مل / ساعة تقريبًا). قمنا بتطوير 3 خطوط بمضاعفة 7 ساعات و 3 خطوط بمضاعفة 11 ساعة. مع 21 ميكرومتر ليسين في الخزان ، كانت كثافة خلية الحالة المستقرة المستهدفة 7 × 10 6 / مل. في الواقع ، تراوحت كثافة الخلايا الحية بين 4 × 10 6 / مل و 1.2 × 10 7 / مل. بشكل دوري ، تم حصاد 4 مل من المادة الطافية وتوزيعها في أنبوب مخروطي معقم 15 مل. بعد ذلك ، تمت إزالة 300 ميكرولتر من عينة الخلية هذه وحفظها على الجليد لتحليل قياس التدفق الخلوي. تم ترشيح 3.7 مل المتبقية من المادة الطافية من خلال مرشح نايلون 0.22 ميكرومتر إلى قسامات سعة 500 ميكرولتر وتم تجميدها عند درجة حرارة -80 درجة مئوية. تم أخذ عينات من كل ناظم كيميائي وفقًا لتسلسل محدد مسبقًا. لتجارب استخلاص المستقلب ، تمت إزالة سدادة وعاء منظم كيميائي ، وحصدت خلايا من 20 مل من العينة (طرق ، "استخلاص المستقلب)". بسبب كسر عقم الوعاء الدموي ، سيكون هذا بمثابة نهاية لتجربة ناظم كيميائي.

تمت إعادة تعبئة خزان المغذيات عند الضرورة عن طريق حقن الوسائط من خلال مرشح معقم 0.2 ميكرومتر مركب على حقنة 60 مل. لأخذ العينات بشكل معقم ، تم رفع أنبوب التغطية الموجود على إبرة أخذ العينات بعناية ، وتم إرفاق حقنة معقمة سعة 5 مل بالإبرة. تم مسح الإبرة بعد ذلك باستخدام 95٪ من الإيثانول ودفعها ببطء إلى الأسفل بحيث يكون الطرف على الأقل 10 مم تقريبًا تحت مستوى السائل. تم سحب عينة 5 مل في المحقنة ، وسحب الإبرة فوق سطح السائل ، وسحب 1 مل إضافي من الهواء من خلالها لمسح الإبرة من بقايا السائل. ثم تم فصل المحقنة ، ووضع الغطاء مرة أخرى على الإبرة. تم إخراج العينات في أنابيب استزراع معقمة مقاس 13 مم للتجميد وتحديد التدفق الخلوي لكثافة الخلايا الحية. في كلتا تجربتي التطور ، تم تجميد العينات في جزء واحد 20٪ طرهالوز في محلول فوسفات الصوديوم 50 ملي مولار (درجة الحموضة 6.0) + جزء واحد من YPD. تم تبريد العينات عند 4 درجات مئوية لمدة 15 دقيقة قبل تجميدها عند -80 درجة مئوية.

تم وصف تسلسل الجينوم الكامل وتحليل البيانات بالتفصيل في [32].

قياس تردد auxotroph

تم إحياء الثقافات المجمدة (نقطتان زمنيتان من 3 تجارب لتطور الزراعة الأحادية و 3 تجارب لتطور زراعة المحاصيل) ، وتم عزل الحيوانات المستنسخة وفحصها من أجل زيادة التغذية. لقد قمنا بإحياء العينات المجمدة عن طريق طلاء العينات مباشرة على YPD (الزراعة الأحادية) أو YPD + hygromycin (الزراعة المزروعة للاختيار ضد سلالة الشريك). نمت الصفائح عند 30 درجة مئوية لمدة 2-4 أيام تقريبًا حتى أصبحت جميع الطوائف مرئية بسهولة للقطف. لاحظنا مجموعة متنوعة من أحجام المستعمرات وقمنا بفحص المستعمرات الكبيرة والصغيرة الحجم عندما كان كلاهما موجودًا. قمنا بحساب المستعمرات الكبيرة والصغيرة لتقدير نسبة الخلايا المكونة للمستعمرات الكبيرة / الصغيرة في السكان ، ثم قمنا بضرب هذا الكسر في جزء من auxotrophs التي لوحظت في كل فئة حجم مستعمرة للحصول على تقدير تردد auxotroph السكاني الكامل. للكشف عن الضمور العضوي ، تم تلقيح مستعمرات كاملة في 150 ميكرولتر من SD ، تم تخفيف 10 ميكرولتر منها إلى 150 ميكرولتر SD في ألواح ميكروترية وحضنت طوال الليل لاستنفاد مرحل الكبريت العضوي أو تخزين الكبريت العضوي الخلوي. في حالة بعض المستعمرات الصغيرة ، لم يتم إجراء أي تخفيف لأن كثافة الخلايا الملقحة كانت منخفضة بالفعل بدرجة كافية ، بناءً على قياسات OD. بعد ذلك ، تم تخفيف 10-30 ميكرولتر في حجم نهائي قدره 150 ميكرولتر لكل من SD + 164 ميكرومتر ليسين ، SD + 164 ميكرومتر ليسين + 134 ميكرومتر ميثيونين ، و YPD ، بهدف OD بحوالي 0.005-0.03 بناءً على القراءة الأولية بواسطة 96-جيدا لوحة OD600 قراءة لوحة الجوع. ثم تم تحضين الصفائح لمدة 48 + ساعة لتنمو الثقافات إلى التشبع ، وتعكر الثقافة (OD600) باستخدام قارئ لوحة 96 بئر. مراقبة الآبار المعروفة ليزorgS - (WY1604) و ليز - تم تضمين (WY2226) في الفحص كعناصر تحكم. الآبار التي نمت في SD + lysine + methionine و YPD ولكنها فشلت في النمو في SD + lysine تم تسجيلها على أنها ليزorgS − .

المجهر مضان

تم وصف تجارب الفحص المجهري الإسفار وتحليل البيانات بالتفصيل في مكان آخر [27]. باختصار ، يتم توصيل المجهر بكاميرا CCD مبردة من أجل التألق والتصوير الضوئي المنقول. يحتوي المجهر على غرفة يمكن التحكم في درجة حرارتها عند 30 درجة مئوية. تم تجهيز المجهر بمكعبات مرشح آلية قابلة للتحويل قادرة على اكتشاف مجموعة متنوعة من الفلوروفورات. كما أن لديها مراحل آلية للسماح بالتركيز التلقائي z والمسح الضوئي المنتظم للمواقع في آبار الصفيحة الدقيقة. يتم الحصول على الصور باستخدام برنامج LabVIEW الداخلي ، والذي يتضمن التركيز التلقائي في مجال مشرق وتعديل التعريض التلقائي أثناء التصوير الفلوري لتجنب التشبع. أظهر التحليل السابق [27] أنه إذا كان التألق لكل خلية ثابتًا بمرور الوقت ، فإن مقاييس شدة التألق المطروح في الخلفية تتناسب مع كثافة الخلايا الحية ، وانخفاض شدة التألق يرتبط جيدًا بموت الخلية.

للتجارب في الشكل 2 والشكل S2 ، WY2490 (ليز -) و WY2527 (ليزbcy1 -) بين عشية وضحاها إلى مرحلة أسية في SD + 164 ميكرومتر ليسين ، وغسلها 3 مرات في وسط S ، وتجويع لمدة 3 ساعات عند 30 درجة مئوية في أنابيب اختبار 13 مم نظيفة في المصنع إما في SD (ليسين الجوع) أو S ( ليسين والجوع الكربوني). للتصوير ، تم تلقيح ما يقرب من 10000 خلية / بئر في كل بئر من لوحة 96 بئر في الوسط المقابل (تم إجراء علاج الراباميسين في SD + 1 ميكرومتر رابامايسين). تم تصوير لوحة microtiter بشكل دوري (حوالي 1-2 ساعة) تحت هدف 10 × في مجهر مضان مقلوب Nikon Eclipse TE-2000U (نيكون ، طوكيو ، اليابان) باستخدام مكعب مرشح ET DsRed (المثير: ET545 / 30x ، باعث: ET620 / 60m ، مزدوج اللون: T570LP). تم اتباع بروتوكول مماثل للتجارب في الشكل 6 و S9 و S10 و S11 ، مع ملاحظة الأنماط الجينية وظروف الجوع في أساطير الشكل المقابل.

الكيموستاتس و تربيدوستاتس

نمت الخلايا في ظل ظروف خاضعة للرقابة باستخدام جهاز زراعة مستمر مصنوع حسب الطلب (S14A Fig) ، مع 6 قنوات (S14C Fig) يمكن تشغيل كل منها بشكل مستقل كمنظم كيميائي أو كيميائي. عند تشغيلها كقناة كيميائية ، توفر القناة بيئة غذائية محدودة حيث يظل معدل النمو ثابتًا. عند تشغيلها كمحرك عكسي ، تحافظ القناة على كثافة خلية ثابتة بينما تنمو الخلايا بإمدادات وفيرة من العناصر الغذائية. بالنسبة لبروتوكولات نمو الخلايا في هذه الأجهزة ، راجع طرق "التطور".

يتكون جهاز الزراعة المستمر من 6 أوعية مفاعل (شكل S14A ، ظهر) ، كل منها بحجم 43 مل تقريبًا (S14E الشكل) محددًا بارتفاع أنبوب التدفق (S14C الشكل). غطت سدادة مطاطية مزودة بأنبوب تدفق وإبرة أخذ العينات الجزء العلوي من كل وعاء (S14C الشكل). تم وضع الأوعية في إطار تثبيت من الألومنيوم مع 6 أوعية (S14A الشكل ، ظهر) ، كل منها مزود بمحرك مغناطيسي متكامل (مصنوع من مروحة وحدة المعالجة المركزية) وكاشف ضوئي LED-phototransistor لقياسات OD. تم تثبيت الأوعية في الأوعية بواسطة حلقات ضغط قابلة للتعديل. مرت إبرة أخذ العينات عبر طول قصير من الأنابيب المطاطية PharMed (الشكل S14C). تم تثبيت الأنبوب في مكانه عن طريق إدخال أنبوب زجاجي في السدادة. تُستخدم روابط Zip لتحقيق إحكام مناسب ، مما يسمح بحركة إبرة أخذ العينات أثناء تطبيق احتكاك كافٍ للحفاظ على موضعها. تتدفق النفايات عن طريق الجاذبية إلى وعاء نفايات أسفل الجهاز من خلال أنابيب قطرها الداخلي 0.375 بوصة (Cole Parmer C-Flex) متصلة بذراع التدفق الخارجي. تم تغذية وسائط المغذيات لكل وعاء من خزان مستقل بواسطة مضخة تمعجية (Welco WPM1 ، تعمل في 7V DC Welco ، طوكيو ، اليابان). يتكون أنبوب توصيل الوسائط من قسمين من القطر الخارجي العام 2 مم ، وأنابيب PTFE ذات القطر الداخلي 1 مم ، متصلة عن طريق الإدخال في طرفي قسم 17 سم من أنابيب PharMed AY242409 (Saint-Gobain ، Courbevoie ، فرنسا) التي تم إدخالها في المضخة التمعجية (S14B الشكل). تم تنشيط المضخة وإلغاء تنشيطها بواسطة برنامج LabView المخصص من خلال صندوق ترحيل (Pencom Design ، UB-RLY-ISO-EXT-LR Trumbauersville ، PA ، الولايات المتحدة الأمريكية). اعتمادًا على ما إذا كانت قناة معينة في وضع منظم كيميائي أو وضع turbidostat ، يتحكم برنامج LabView في المضخة بطرق مختلفة (على سبيل المثال ، معدل تخفيف ثابت في منظم كيميائي ، أو التخفيف إلى تعكر محدد في نظام التوربيدوستات). تم تسجيل بيانات OD ومعدل التدفق لأي من وضعي التشغيل. في كلتا الحالتين ، يمكن استخدام معدل التدفق لحساب معدل النمو. كانت خزانات الوسائط (الشكل S14A ، الأمامية) عبارة عن قوارير زجاجية سعة 1 لتر مغطاة بسدادات مطاطية ذات فتحة واحدة ، وتم استخدام جزء من الأنابيب الزجاجية ككمية لمنع تجعد أنابيب PTFE وللحفاظ على نهاية أنابيب PTFE ملامسة للثقب. قاع الخزان. تم وضع كل خزان على ميزان رقمي (Ohaus SPX2201 Parsippany ، NJ ، الولايات المتحدة الأمريكية) بواجهة رقمية (واجهة Ohaus Scout RS232) لقياس الحجم (الوزن) المتبقي في الخزان في أي وقت معين.

عندما تكون في وضع التوربيدوستات ، تم الحفاظ على متوسط ​​التعكر المستمر. على وجه التحديد ، تم تنشيط المضخة عندما يكون OD المقاس أعلى من نقطة الضبط ويتم إلغاء تنشيطه عندما يكون OD أقل من نقطة التحديد. تم قياس OD باستخدام 940 نانومتر LED (Ledtech UT188X-81-940 ، مدفوع بتيار 50 مللي أمبير في تايوان وتايوان) والترانزستور الضوئي (Ledtech LT959X-91-0125). تم اختبار واختيار كل زوج ترانزستور ضوئي LED لقياسات OD متسقة. تم وضع الصمام والترانزستور الضوئي عن طريق ثقوب متصاعدة على الإطار المعدني من الألومنيوم ، على الجانبين المتقابلين لوعاء المفاعل ، على بعد 4 سم من قاع الوعاء. تم توصيل كل ترانزستور ضوئي بدائرة op-amp (LM324) تعمل كتيار لمحول الجهد والمخزن المؤقت (S14B الشكل). يوفر محول DC-DC المعزول مصدر جهد منظم للإلكترونيات. تم ترقيم جهد الخرج من دائرة الكاشف الضوئي باستخدام DAQ (National Instruments USB-6009 أوستن ، تكساس ، الولايات المتحدة الأمريكية) وقراءته بواسطة برنامج LabView لقياس OD. قام برنامج LabView بتخزين متوسط ​​شدة الضوء I.0 خلال أول دقيقتين بعد بدء القناة كقيمة "فارغة". تم قياس شدة الضوء ، I ، كل 30 ثانية تقريبًا ، وكان OD = سجل10(أنا / أنا0) تم حساب.

عندما تكون في وضع ناظم كيميائي ، معدل تدفق متوسط ​​ثابت F من المتوسط ​​في السفينة تم الحفاظ عليها. على عكس إعدادنا الكيميائي السابق [77] ، هنا ، تم تحقيق معدل تدفق ثابت عبر مقياس (Ohaus SPX2201) يزن باستمرار الخزان المرتبط به ، وتم الحصول على القراءة من خلال واجهة RS232 (Ohaus Scout RS232). القراءة الأولية للمقياس ، ممبدئي، تم تسجيله عند تنشيط قناة ناظم كيميائي أو إعادة تعيينها. تم استخدام هذا مع قراءة المقياس الحالية متيار لحساب الحجم الإجمالي الذي يتم ضخه من الخزان إلى الوعاء بمقدار 1 مل /ز × (متيارممبدئي). تم حساب الحجم المستهدف الذي يجب أن يتم نقله من الخزان إلى السفينة في الوقت الحالي وفقًا لمعدل التدفق المحدد مسبقًا. إذا كان الحجم الإجمالي أقل من الهدف ، تم تنشيط المضخة ، وإلا تم تعطيل المضخة. قدم هذا متوسط ​​معدل التدفق الصحيح. تم اختيار معدل التدفق لوقت المضاعفة المطلوب ، F = ln(2) × الخامس/تيد، أين الخامس هو حجم السفينة و تيد الوقت المضاعف. تم حساب أحجام الوعاء بوزن وعاء فارغ ثم وزنه مرة أخرى عند ملئه إلى نقطة الامتداد (S14E الشكل) ، مما يعطي متوسط ​​قيمة 43 مل. تم تحديد معدلات التدفق الفردية باستخدام أحجام الأوعية الفردية. قياسات الحجم مقيدة بالحد الأدنى لحجم قطرة أنبوب النفايات الذي يبلغ حوالي 0.5 مل ، وهو مقيد بالتوتر السطحي. تم تسجيل قراءات النطاق ، مما يوفر مقياسًا لمعدل التدفق (S14D الشكل).

المقايسات الحيوية

تعتمد معظم الاختبارات الحيوية على العائد. WY1604 (ميت 10 -) عادة ما تكون بمثابة سلالة اختبار ما لم يتم تحديد خلاف ذلك في تجربة (انظر S5 الشكل والجدول S1) ، ولكن التحضير لجميع الاختبارات الحيوية القائمة على العائد كان هو نفسه.نمت السلالات لمدة 16 ساعة تقريبًا في 3 مل SD ، مع إضافة أي مكملات مطلوبة. خلال هذا الوقت ، تم تتبع معدل النمو للتأكد من أن الخلايا تتضاعف كما هو متوقع (1.6- إلى 3 ساعات تتضاعف حسب السلالة / الحالة). بعد هذا الوقت ، تم إعطاء الخلايا 3-5 غسالات مع 3 مل SD + 164 ميكرومتر ليسين (بدون أي مكملات من الكبريت العضوي) وتم تجويعها لمدة 3 ساعات على الأقل عند 30 درجة مئوية في 3 مل SD + 164 ميكرومتر ليسين لاستنفاد الاحتياطيات الخلوية من الكبريت العضوي . تم إجراء التجويع في أنبوب اختبار 13 مم نظيف في المصنع لمنع التلوث غير المقصود بالمغذيات. أخيرًا ، تم تلقيح ما يقرب من 1000 خلية / بئر في صفيحة ذات قاع مسطح 96 بئر في حجم نهائي قدره 150 ميكرولتر إما من معيار مستقلب أو طاف كيميائي ، مكمل بـ SD + 164 ميكرومتر ليسين. لكل سلالة مساعدة ، تم استخدام SD + 164 ميكرومتر ليسين مكملًا بتركيزات مختلفة معروفة من الجلوتاثيون لإنشاء منحنى قياسي يرتبط بتركيز الكبريت العضوي (من حيث مكافئ fmole GSH) إلى التعكر النهائي (S5 الشكل). ثم تم استخدام العكارة التي تم تحقيقها في مادة طافية لاستنتاج تركيز الكبريت العضوي في المادة الطافية. تم تغليف الصفائح ببارافيلم لمنع التبخر واحتضانها عند 30 درجة مئوية لمدة 2-3 أيام. قمنا بإعادة تعليق الخلايا باستخدام Teleshake Thermo Fisher Scientific Teleshake (الإعداد رقم 5 لمدة دقيقة واحدة تقريبًا) وقراءة ثقافة التعكر باستخدام قارئ لوحة BioTek Synergy MX (Winooski ، VT ، الولايات المتحدة الأمريكية).

في اختبار حيوي قائم على المعدل (S4B الشكل) ، تم إنتاج سلالة الخميرة الموسومة بعلامات mCherry للكبريت العضوي (WY2035) مسبقًا في SD + 164 ميكرومتر ليسين + 134 ميكرومتر ميثيونين ، وتم تتبع معدل النمو بالكثافة الضوئية لضمان نمو الخلية متوقع. بعد ذلك ، تم غسل الخلايا 3 مرات في SD + 164 ميكرومتر ليسين (تفتقر إلى مكملات الكبريت العضوي) وتم تجويعها لمدة 3 ساعات على الأقل في أنابيب اختبار 13 مم نظيفة في المصنع. تم قياس OD مرة أخرى ، وتم تلقيح الخلايا لما يقرب من 1000 خلية / بئر في لوحة 96 بئر بحجم إجمالي 300 ميكرولتر. تم ملء البئر إما بكميات معروفة من الكبريت العضوي (الميثيونين أو الجلوتاثيون) أو المواد الطافية المحصودة ، وكلاهما مكمل في SD + 164 ميكرومتر ليسين. تم قياس اللوحة ذات 96 بئر بنفس الطريقة الموضحة سابقًا في قسم "الفحص المجهري الفلوري".

تم حساب معدل النمو الأقصى عن طريق قياس منحدر ln(كثافة طبيعية) ضد الزمن. لكل نافذة منزلقة مكونة من 4 نقاط زمنية ، يتم حساب الميل ، وإذا تجاوز الحد الأقصى الحالي للانحدار للبئر ، يتم اختياره كحد أقصى جديد. للتأكد من عدم حدوث أي تقدير عندما تكون المستقلبات الأخرى مثل الجلوكوز محدودة ، قمنا بتقييد التحليل على البيانات عند 25٪ شدة قصوى للتأكد من أن الخلايا لديها ما لا يقل عن مضاعفتين بعد ذلك عندما تنمو نظريًا إلى الحد الأقصى. بالنسبة للمقايسات الحيوية القائمة على المعدل ، تم استخدام معدلات النمو القصوى لتقدير الحجم التقريبي للمكانة.

التدفق الخلوي

يمكن العثور على الوصف التفصيلي في مكان آخر [30]. تم قياس التركيبات السكانية عن طريق قياس التدفق الخلوي باستخدام DxP10 (Cytek ، Fremont ، CA ، الولايات المتحدة الأمريكية). تمت إضافة خرزات فلورية ذات تركيز معروف (كما هو محدد بواسطة مقياس الكريات الدموية) لتحديد كثافة الخلايا. تم استخدام تخفيف نهائي 1: 20000 من ToPro3 (مجسات جزيئية T-3605 يوجين ، أوريغون ، الولايات المتحدة الأمريكية) لكل عينة لتحديد كثافة الخلايا الحية والميتة. أظهر التحليل باستخدام برنامج FlowJo تكتلاً واضحًا للخلايا الحية والميتة في قناة ToPro3 RedFL1 ، مع وجود الخلايا الميتة التي تحتوي على إشارة RedFL1 تبلغ & gt10 3. لم تكن كثافة الخلايا الميتة عادةً أعلى من 10٪ في جميع الظروف المختبرة.

استخراج المستقلب

تم تكييف استخراج المستقلب لتقدير الكبريت العضوي داخل الخلايا من [78]. باختصار ، تم حصاد 20 مل من مجموعات ناظم كيميائي باستخدام ماصات 25 مل يمكن التخلص منها وتم ترشيحها بالمكنسة الكهربائية بسرعة على مرشحات نايلون ماجنا 0.45 ميكرون (GVS Life Sciences ، Sanford ، ME ، الولايات المتحدة الأمريكية). باستخدام ملقط منظف بالإيثانول ، تم غمر المرشح بسرعة في 3 مل من خليط الاستخلاص المثلج والثلج - 40٪ (حجم / حجم) أسيتونيتريل ، 40٪ (حجم / حجم) ميثانول ، و 20٪ (حجم / حجم) ماء مقطر - محتجز في أنبوب معقم للطرد المركزي سعة 5 مل. كانت جميع الكواشف من الدرجة HPLC ، وتم تصنيع جميع مخاليط الاستخلاص طازجة قبل كل عملية استخلاص. تم تغطية أنبوب الطرد المركزي ودوامة بسرعة لإخراج جميع الخلايا ، وتم التخلص من غشاء المرشح. استغرقت العملية بأكملها أقل من 25 ثانية ، وكان الوقت بين المجموعات التي يتم ترشيحها وغمرها في المخزن المؤقت للاستخراج أقل من 10 ثوانٍ. بعد حصاد جميع التجمعات ، تم تجميد المستخلصات عند درجة حرارة -80 درجة مئوية أو في النيتروجين السائل حتى تصبح صلبة ، ونقلها إلى الجليد ، والسماح لها بالذوبان. بعد ذوبان العينات ، تم تحضينها على الجليد لمدة 10 دقائق وتدويرها مرة واحدة كل 3 دقائق تقريبًا ثم إعادتها إلى -80 درجة مئوية لإعادة التجميد (دورة "تجميد-تذويب" واحدة). بعد 3 دورات من التجميد-الذوبان ، تم حصاد 1.5 مل من العينة ونقلها إلى أنبوب الطرد المركزي الصغير الجديد 1.5 مل وطرده عند 13000 دورة في الدقيقة لمدة دقيقتين عند 4 درجات مئوية لتكوير حطام الخلية. تمت إزالة المستخلص ، وتم استخلاص حبيبات الخلية المتبقية مرة أخرى باستخدام 1.5 مل من خليط الاستخلاص ولفها. كانت النتيجة النهائية 3 مل من المستقلبات المستخرجة التي تم تخزينها عند درجة حرارة -80 درجة مئوية وتحليلها بواسطة HPLC بعد أقل من 48 ساعة من الاستخراج. بالنسبة للمقايسات الحيوية ، تم تخفيف هذا المستخلص 10 أضعاف في ماء معقم أو SD. للتحقق من أن غالبية المستقلبات قد تم استخلاصها ، تمت إضافة 100 ميكرولتر من المخزن المؤقت للاستخراج الطازج إلى حطام الخلية الذي تم جمعه ، وتدويره بقوة ، وجمعه بالطرد المركزي. تم تحليل هذا "المستخلص الثاني" 100 ميكرولتر أيضًا من أجل الجلوتاثيون بواسطة HPLC. في المتوسط ​​، كانت كمية الجلوتاثيون في المستخلص الثاني & lt2٪ من الكمية المستخرجة مبدئيًا في الاستخلاص 3 مل.

تم استخدام بروتوكول معدل ل ادي - مستخلصات الخلايا. لقد تحققنا بشكل مستقل من أن البروتوكولين أدى إلى نتائج مماثلة في ميت 10 المقايسة الحيوية القائمة على العائد (بيانات S5). ادي - تم ترشيح مزارع الكيموستات على أغشية نيتروسليلوز 0.45 ميكرومتر (Bio-Rad ، Hercules ، CA ، الولايات المتحدة الأمريكية) ، وأعيد تعليقها في خليط الاستخلاص ، وتم تجميدها في النيتروجين السائل. تم إذابة العينات عند درجة حرارة -20 درجة مئوية لمدة 30 دقيقة ، مع دوامة كل 5 دقائق. تم تكوير حطام الخلية بالطرد المركزي عند 13000 دورة في الدقيقة لمدة 10 دقائق عند 4 درجات مئوية. بعد نقل المادة الطافية إلى أنبوب جديد ، تم استخلاص الحبيبات بنصف الحجم الأصلي من خليط الاستخلاص ، وتم دمج المواد الطافية من جولتي الاستخراج. تم تجفيف خليط الاستخلاص باستخدام إعداد درجة حرارة منخفضة على فراغ سرعة ، وتم إعادة تعليق المكونات المجففة في ماء مقطر معقم.

من إجمالي كمية المستقلبات في العينة والعدد الإجمالي للخلايا المستخدمة لاستخراج المستقلبات ، يمكننا حساب متوسط ​​كمية المستقلب لكل خلية.

القياس الكمي للكيمياء التحليلية لـ GSH و GSXs

تم اشتقاق الجلوتاثيون المخفض باستخدام مسبار خاص بالثيول تم وصفه لأول مرة بواسطة [79] ، يُسمى Thiol Probe IV (EMD Millipore ، Burlington ، MA ، الولايات المتحدة الأمريكية) لعمل اقتران الجلوتاثيون الفلوري. يتفاعل المركب بسهولة مع الثيول الحر ، وإن كان بمعدلات مختلفة. لتقدير الجلوتاثيون ، تمت إضافة 270 ميكرولتر من العينة أو معيار GSH في SD إلى 30 ميكرولتر من المخزن المؤقت HEPES 833 مم (الرقم الهيدروجيني 7.8). تم إجراء ذلك لرفع درجة الحموضة في العينة إلى المستوى الأساسي ، مما يسهل التفاعل. بعد ذلك ، تمت إضافة المسبار (المذاب في DMSO والمخزن في 50 ميكرولتر في قسامات عند درجة حرارة -20 درجة مئوية) ، إلى تركيز نهائي قدره 100 ميكرومتر ، وهو ما يزيد عن الجلوتاثيون بمقدار 10 أضعاف على الأقل. تم إجراء التفاعل عند درجة حرارة الغرفة في الظلام (المسبار حساس للضوء) في لوح به 96 بئر لمدة 20 دقيقة. بعد ذلك ، تمت إضافة 8.4 ميكرولتر من 2 مولار من حمض الهيدروكلوريك لإخماد التفاعل بسرعة عن طريق خفض الرقم الهيدروجيني إلى ما يقرب من 2. وهذا أيضًا يثبّت اقتران الفلورسنت. تمت إضافة العينة بأكملها بعد ذلك إلى إدخال فئة نقطة مسحوب صغير الحجم سعة 250 ميكرولتر (Agilent الجزء رقم: 5183-2085 سانتا كلارا ، كاليفورنيا ، الولايات المتحدة الأمريكية) لتسهيل الوصول إلى إبرة أخذ العينات الأوتوماتيكية. تم بعد ذلك إدخال الحجم الصغير مع العينة داخل قنينة أخذ العينات الأوتوماتيكية ذات اللون البني الداكن سعة 1.5 مل (رقم جزء شيمادزو: 228-45450-91 كيوتو ، اليابان) وتم تغطيتها بغطاء لولبي جديد مقاس 9 مم مع حاجز PTFE (رقم جزء شيمادزو: 228-45454-91).

تم فصل الجلوتاثيون المشتق وتحديده باستخدام كروماتوجرافيا الطور العكسي. تم حقن 10 ميكرولتر من خليط التفاعل في عمود Synergi 4-ميكرومتر Hydro-RP 80-LC ، 150 × 4.6 مم (ظاهرة ، الجزء رقم: 00F-4375-E0 Torrance ، CA ، الولايات المتحدة الأمريكية) ، مزودة بخراطيش SecurityGuard AQ C18 4 x 3.00 mm ID (Phenomenex، Part No: AJO-7511) في حامل خرطوشة SecurityGuard (Phenomenex ، الجزء رقم: KJ0-4282). تم استبدال SecurityGuard (العمود الأولي) بشكل دوري كلما تجاوزت قراءة الضغط مواصفات الشركة المصنعة. تمت إزالة الجلوتاثيون من العمود بتدرج طور متحرك لمياه Millipore المفلترة (محلول A) وأسيتونيتريل (المحلول B ، درجة HPLC). تم ترشيح مياه Millipore من خلال مرشح 0.22 ميكرومتر قبل الاستخدام. بالإضافة إلى ذلك ، قبل كل تشغيل ، تمت موازنة العمود لمدة 30 دقيقة مع 1٪ محلول ب. اتبعت النسبة المئوية للحل ب البرنامج التالي لكل حقنة: 0 دقيقة 1٪ ، 10 دقيقة 14٪ ، 10.01 دقيقة 1٪ ، و 15 دقيقة 1٪ ، تقابل زيادة تدريجية إلى 14٪ محلول ب خلال 10 دقائق ، متبوعة بإعادة موازنة مع محلول 1٪ ب. تم الحفاظ على العمود عند درجة حرارة تشغيل 25 درجة مئوية في فرن Nexera X2 CTO-20A ( شيمادزو). كان معدل التدفق 1 مل / دقيقة. في ظل هذه الظروف ، يتم التخلص من الجلوتاثيون في حوالي 7 دقائق ، مع اختلاف طفيف في التشغيل. تم الكشف عن الجلوتاثيون الفلوري عن طريق الإثارة عند 400 نانومتر والانبعاث عند 465 نانومتر. بعد كل شوط ، تم غسل العمود وتخزينه حسب تعليمات الشركة المصنعة.

تم إجراء تحليل بيانات HPLC باستخدام لغة R الإحصائية مع برنامج مكتوب خصيصًا لانتقاء الذروة ، وتصحيح خط الأساس ، والتخطيط ، وتقدير المنطقة ، وهو متاح مجانًا في

تم شحن المواد المتفجرة طوال الليل على جليد جاف إلى مختبر رابينوفيتز في جامعة برينستون. تم الحصول على مركب النظير المستقر [2-13 C ، 15 N] GSH من مختبرات كامبريدج للنظائر المشعة. تم الحصول على مياه HPLC وميثانول وأسيتونيتريل من Thermo Fisher Scientific. تم إذابة العينة الطافية في درجة حرارة الغرفة وتم نقل 30 ميكرولتر من المادة الطافية مع 5 ميكرولتر من 10 ميكرومتر من 2 إلى 13 درجة مئوية + 15 N المسمى GSH في أنبوب طرد مركزي سعة 1.5 مل. تم تشغيل العينات إما مباشرة لقياس GSH فقط أو معالجتها أولاً بالفوسفين (2-carboxyethyl) (TCEP) لتقليل GSX إلى GSH قبل قياس إجمالي GSH. بالنسبة لتلك العينات مع علاج TCEP ، تمت إضافة 5 ميكرولتر من 60 جم ​​/ لتر محلول TCEP (كاشف مختزل) إلى العينة. تم تدوير الخليط الناتج واحتضانه لمدة 20 دقيقة عند درجة حرارة الغرفة. بعد ذلك ، 10 ميكرولتر من 15٪ NH4HCO3 (w / v) لتحييد الرقم الهيدروجيني للمذيب. تم تجفيف المحلول تحت N.2 تدفق ، معلق في مذيب 50 ميكرولتر 40:40:20 (ميثانول / أسيتونيتريل / ماء) ، وحفظه عند 4 درجات مئوية في جهاز أخذ العينات التلقائي.

تم تحليل العينات باستخدام مطياف الكتلة Q Exactive Plus إلى جانب نظام Vanquish UHPLC (Thermo Fisher Scientific). تم تحقيق فصل LC باستخدام عمود XBridge BEH Amide (2.1 مم × 150 مم ، 2.5 ميكرومتر حجم الجسيمات ، 130-حجم المسام ووترز ، ميلفورد ، ماساتشوستس ، الولايات المتحدة الأمريكية) باستخدام تدرج من المذيب A (20 ملي أسيتات الأمونيوم + 20 ملي مولار هيدروكسيد الأمونيوم في 95: 5 ماء / أسيتونيتريل [الرقم الهيدروجيني 9.45]) والمذيب ب (أسيتونتريل). كان معدل التدفق 150 ميكرولتر / دقيقة. كان التدرج 0 دقيقة ، 90٪ ب 2 دقيقة ، 90٪ ب 5 دقائق ، 50٪ ب 10 دقائق ، 0٪ ب 13.5 دقيقة ، 0٪ ب 15 دقيقة ، 90٪ ب 20 دقيقة ، 90٪ ب. 25 درجة مئوية ، وكان حجم الحقن 10 ميكرولتر. معلمات مطياف الكتلة هي وضع الأيونات الموجبة ، دقة 140000 عند m / z 200 ، نطاق المسح m / z 290–650 ، هدف AGC 3E6 ، أقصى وقت للحقن 200 مللي ثانية. تم تحقيق الكميات لتركيزات GSH في العينات من خلال مقارنة مناطق الذروة من الجلوتاثيون بتلك الموجودة في 13 C-GSH. تم تحليل البيانات باستخدام برنامج MAVEN [80].

مسابقة

لتحديد تكرارات المنافسة المتعددة بنسب سلالة أولية متعددة ، استخدمنا نظام الزراعة لتقليد البيئة المحدودة ليسين ، خاصةً لأن الطفرات المماثلة في الكيموستات المزروعة بالزراعة الأحادية والليسين المحدود باللايسين تعني أن البيئات كانت متشابهة. للقيام بذلك ، تم تطوير WY1340 (السلالة التي تتطلب البيورين / إطلاق الليسين في خلفية RM11) إلى المرحلة الأسية بين عشية وضحاها في SD + 134 ميكرومتر من الأدينين ، وغسلها 3 مرات باستخدام SD لإزالة الأدينين ، وتم تجويعها لمدة 24 ساعة لاستنفاد الفجوة. تخزين. خلال هذه الجوع ، WY2072 / 2073 (BFP ميت 10المستنسخات المتطورة) و WY2429 (mCherry MET10استنساخ متطور) طوال الليل في SD + 134 ميكرومتر ميثيونين إلى المرحلة الأسية وغسلها 3 مرات باستخدام SD لإزالة الميثيونين الزائد والليسين. يفرط كل من WY2072 / 3 و WY2429 في إنتاج وإفراز هيبوكسانثين والذي يمكن أن يدعم نمو سلالة الشريك WY1340. بعد ذلك ، تم خلط WY2072 / 3 و WY2429 بنسب 1: 100 و 1:10 و 1: 1 و 10: 1 إلى OD النهائي600 من 0.1. تمت إضافة هذا الخليط من السكان بعد ذلك 1: 1 مع WY1340 إلى OD النهائي600 من 0.03. تم اعتبار هذا الجيل 0. تمت مراقبة النمو السكاني عن طريق قياس الكثافة الضوئية بمرور الوقت وتم تخفيفه بشكل دوري إلى OD600 0.03 (OD600 لم يكن أكبر من 0.45 أبدًا لضمان عدم تقييد أي مستقلبات إضافية من SD). OD600 تم استخدام البيانات لإعادة حساب الأجيال الإجمالية في التجربة. بشكل دوري ، تم أخذ عينات من 100 ميكرولتر من الثقافة لقياس التدفق الخلوي لتتبع نسب الإجهاد. أجريت التجارب حتى استقرت نسبة الإجهاد.

فحص الالتهام الذاتي

تم قياس أنشطة الالتهام الذاتي باستخدام مقايسة الانقسام GFP-Atg8 [28]. سلالات الخميرة مع ura3 الحذف في ليز - و ليزالتقى 17 - تم إنشاء الخلفية عبر تقاطعات وتحويلها باستخدام بلازميد GFP-Atg8 (Addgene 49425 Watertown ، MA ، الولايات المتحدة الأمريكية) لتوليد السلالتين المستخدمتين في فحوصات الالتهام الذاتي — WY2520 (ليز -) و WY2521 (ليزorgS -). يعبر هذا البلازميد عن ATG8 بعلامة GFP N-terminal تحت المروج الداخلي في ناقل pRS416 مع URA3 علامة الاختيار [81]. لكل تجربة ، تم وضع خطوط WY2520 و WY2521 على ألواح SC-Ura [74] من المخزونات المجمدة ونمت ليالي مشبعة من مستعمرات مفردة في وسط SC-Ura. تم تلقيح ثقافات حجمها 25-50 مل من الليل في SD + 164 ميكرومتر ليسين (WY2520) أو SD + 164 ميكرومتر ليسين + 134 ميكرومتر GSH (WY2521) في قوارير مخروطية ونمت لمدة 18-20 ساعة عند 30 درجة مئوية إلى a. كثافة الخلية المرغوبة. وفقًا للبروتوكولات المنشورة ، هدفت التجارب الأولية إلى OD من 0.7-1.0 للمجاعة. ومع ذلك ، لاحظنا أن كثافات الخلايا العالية يمكن أن تؤدي إلى انقسام GFP-Atg8 أعلى حتى في الخلايا غير المنحرفة. وهكذا ، في التجارب اللاحقة ، بدأت الجوع في OD في حدود 0.2-0.6. تم تكوير الخلايا في أنابيب صقر سعة 50 مل وغسلها ثلاث مرات في ماء معقم ملي كيو. بعد الغسل ، تم تعليق الخلايا في وسط التجويع المفضل (انظر التفاصيل أدناه) في أنابيب نظيفة في المصنع عند OD من 0.1-0.2. بالنسبة للظروف التي لم توقف فيها الخلايا النمو عند الجوع (تجويع الكبريت العضوي بشكل أساسي) ، تم تخفيف الثقافات بشكل دوري لتقليل تأثير قيود المغذيات الثانوية التي تسببها كثافات الخلايا العالية. لتحليل الدورة الزمنية ، تم إجراء التجويع في ثقافات 10 مل في أنابيب 18 مم ، وتم سحب 2 مل من الثقافة للتحليل في 24 و 48 و 72 ساعة من بدء الجوع. بالنسبة للمقايسات بأخذ عينات نقطة زمنية واحدة ، تم إجراء التجويع في ثقافات 3 مل في أنابيب 13 مم. ليز - تم تجويع الخلايا لمدة 4 أو 8 ساعات ، مع ملاحظة نتائج مماثلة لكلا العلاجين. ليزorgS - تم تجويع الخلايا لمدة 72 ساعة بعد أن أظهر تحليل الدورة الزمنية أن تأثير تجويع الكبريت العضوي لم يكن واضحًا إلا بعد 48 ساعة في مقايسة الانقسام GFP-Atg8.

يتم وصف وسائط الجوع للعلاجات المختلفة هنا. ل ليز - الخلايا ، تم إجراء تجويع ليسين في تجويع النيتروجين المتوسط ​​SD في وسط SD-N إما مكمل بـ 164 ميكرومتر ليسين (تجويع النيتروجين فقط) أو يفتقر إليه (تجويع مزدوج لليسين والنيتروجين). ل ليزorgS - تم إجراء تجويع مزدوج لليسين والكبريت العضوي في وسط SD ، وتم تجويع ليسين في SD + 134 ميكرومتر GSH ، وتم تجويع الكبريت العضوي في SD + 164 ميكرومتر ليسين.

تم تحضير العينة على النحو المقترح في [82] مع تعديلات طفيفة. تم تكوير الخلايا من 2-4 مل من المستنبت في أنبوب الطرد المركزي الدقيق عند 5000 × ز لمدة 3 دقائق. تم تجميد كريات الخلايا في النيتروجين السائل وتخزينها في درجة حرارة -20 درجة مئوية حتى تم جمع جميع العينات للتجربة. بالنسبة لتحلل الخلايا ، تم إعادة تعليق الحبيبات في 1 مل من حمض ثلاثي كلورو أسيتيك المثلج بنسبة 10٪ وتركها لتقف في قالب معدني بارد على الجليد لمدة 30-40 دقيقة. تم تكوير البروتينات عند 16000 × ز لمدة 1 دقيقة عند 4 درجات مئوية. تم إعادة تعليق الكريات في 1 مل من الأسيتون البارد عن طريق دوامة وحمّام صوتنة وتكوير مرة أخرى عن طريق الطرد المركزي. تم تكرار غسل الأسيتون مرة واحدة وتم السماح للكريات بالتجفيف بالهواء لمدة 5 دقائق قبل إعادة التعليق في المخزن المؤقت لعينة SDS-PAGE (0.1 M Tris-HCl [pH 7.5] ، 2٪ w / v SDS ، 10٪ v / v glycerol ، 20 مم DTT). بناءً على OD الذي تم قياسه في وقت جمع العينة ، تم تعديل حجم المخزن المؤقت للعينة للوصول إلى خلايا قابلة للمقارنة / ميكرولتر في كل عينة. تمت إضافة خرز زجاجي مغسول بالحمض (425-600 ميكرومتر Sigma G8771 Sigma-Aldrich ، سانت لويس ، ميزوري ، الولايات المتحدة الأمريكية) إلى كل أنبوب ، أي ما يعادل تقريبًا نصف حجم العينة ، وأعيد تعليق الحبيبات بضرب حبة لمدة 35 ثانية. بعد الطرد المركزي لمدة 20 دقيقة للسماح باستقرار الرغوة ، تم تسخين العينات في قالب معدني 95 درجة مئوية لمدة 10 دقائق. بعد 3 دقائق من الطرد المركزي عند 5000 × ز، تم تشغيل العينات على هلام أكريلاميد 12.5٪ لمدة 50 دقيقة بتيار ثابت 30 مللي أمبير. تم نقل النطاقات إلى غشاء PVDF 0.2 ميكرومتر (Bio-Rad Trans-blot 162–0184) باستخدام بروتوكول نقل رطب بجهد ثابت 60 فولت لمدة ساعتين في الغرفة الباردة. من أجل التكتل المناعي ، تم تحضين الغشاء طوال الليل عند 4 درجات مئوية مع مادة أولية أحادية النسيلة مضادة لـ GFP (JL-8 Clontech 632381 Clontech ، Takara Bio ، Mountain View ، CA ، الولايات المتحدة الأمريكية) عند تخفيف 1: 5000 ، تليها غرفة لمدة 45 دقيقة حضانة درجة الحرارة مع الفجل الحار - بيروكسيديز - مضاد للفأر الثانوي (GE Healthcare Lifesciences [المعروفة الآن باسم Cytiva] Marlborough ، MA ، الولايات المتحدة الأمريكية) عند تخفيف 1: 10000. تم الكشف عن الأجسام المضادة باستخدام الركيزة SuperSignal West Dura Chemiluminescent (Thermo Fisher Scientific). تم استخدام المكون الإضافي Gel Analyzer المثبت مسبقًا على ImageJ لتقدير النطاقات.


وظائف الجهاز البولي


ينتج الجهاز البولي البول وينقله إلى خارج الجسم.نظرًا لأن الكلى تنتج البول ، فإنها تقوم بأربع وظائف: إفراز الفضلات الأيضية ، والحفاظ على توازن الماء والملح ، والحفاظ على التوازن الحمضي القاعدي ، وإفراز الهرمونات.

إخراج المخلفات الأيضية
تفرز الكلى النفايات الأيضية ، ولا سيما النفايات النيتروجينية. اليوريا هي المنتج النهائي النيتروجيني لعملية التمثيل الغذائي في البشر ، ولكن البشر يفرزون أيضًا بعض الأمونيوم والكرياتينين وحمض اليوريك. اليوريا هو منتج ثانوي لعملية التمثيل الغذائي للأحماض الأمينية. يؤدي تكسير الأحماض الأمينية في الكبد إلى إطلاق الأمونيا ، التي يجمعها الكبد مع ثاني أكسيد الكربون لإنتاج اليوريا. الأمونيا شديدة السمية للخلايا ، لكن اليوريا أقل سمية بكثير. نظرًا لأنه أقل سمية ، يلزم كمية أقل من الماء لإفراز اليوريا. فوسفات الكرياتين هو جزيء احتياطي فوسفات عالي الطاقة في العضلات. ينتج عن الانهيار الأيضي لفوسفات الكرياتين الكرياتينين. ينتج عن تكسر النيوكليوتيدات ، مثل تلك التي تحتوي على الأدينين والثيمين حمض البوليك. حمض اليوريك غير قابل للذوبان إلى حد ما. في حالة وجود الكثير من حمض اليوريك في الدم ، تتشكل البلورات وترسب. تتجمع بلورات حمض اليوريك أحيانًا في المفاصل ، مما ينتج عنه مرض مؤلم يسمى النقرس.

الحفاظ على توازن الماء والملح
تتمثل الوظيفة الرئيسية للكلى في الحفاظ على توازن الماء والملح المناسب في الدم. كما سنرى ، يرتبط حجم الدم ارتباطًا وثيقًا بتوازن الملح في الجسم. كما تعلم ، فإن الأملاح ، مثل كلوريد الصوديوم ، لديها القدرة على إحداث التناضح ، وانتشار الماء - في هذه الحالة ، في الدم. كلما زادت نسبة الأملاح في الدم ، زاد حجم الدم وزاد ضغط الدم. بهذه الطريقة ، تشارك الكلى في تنظيم ضغط الدم. تحافظ الكلى أيضًا على المستوى المناسب للأيونات الأخرى (الإلكتروليتات) ، مثل أيونات البوتاسيوم (K +) وأيونات البيكربونات (HCO3 -) وأيونات الكالسيوم (Ca 2 +) في الدم.

الكلى
ال الكلى هي أعضاء مقترنة تقع بالقرب من الجزء الصغير من الظهر في منطقة أسفل الظهر على جانبي العمود الفقري. تقع في المنخفضات على عضلات الظهر العميقة تحت الصفاق ، حيث تتلقى بعض الحماية من القفص الصدري السفلي. عادة ما يتم تثبيت كل كلية في مكانها بواسطة نسيج ضام ، يسمى اللفافة الكلوية. تلتصق كتل الأنسجة الدهنية بكل كلية. يمكن أن تؤدي الضربة الحادة في الظهر إلى إزاحة الكلية ، والتي تسمى بعد ذلك بـ الكلية العائمة. الكلى على شكل حبة الفول ولونها بني محمر. يتم تغطية الأعضاء ذات حجم قبضة اليد بكبسولة صلبة من النسيج الضام الليفي ، تسمى كبسولة كلوية. الجانب المقعر من الكلى لديه اكتئاب يسمى نقير حيث أ الشريان الكلوي يدخل و الوريد الكلوي وخروج الحالب من الكلية.

الحالب
ال الحالب تمتد من الكلى إلى المثانة ، وهي أنابيب عضلية صغيرة يبلغ طولها حوالي 25 سم وقطرها 5 ملم. ينزل كل منهما خلف الصفاق الجداري ، من نقير الكلية ، ليدخل المثانة إلى الخلف عند سطحها السفلي. يتكون جدار الحالب من ثلاث طبقات. الطبقة الداخلية عبارة عن غشاء مخاطي (غشاء مخاطي) ، وتتكون الطبقة الوسطى من عضلة ملساء ، والطبقة الخارجية عبارة عن طبقة ليفية من النسيج الضام. تؤدي الانقباضات التمعجية إلى دخول البول إلى المثانة حتى لو كان الشخص مستلقيًا. يدخل البول إلى المثانة على شكل دفعات تحدث بمعدل واحد إلى خمسة في الدقيقة.

مثاني بولية
ال مثاني بولية يقع في تجويف الحوض ، أسفل الصفاق الجداري وخلف ارتفاق العانة. في الذكور ، يكون أمام المستقيم مباشرة عند الإناث ، وهو أمام المهبل وأدنى من الرحم. وتتمثل مهمتها في تخزين البول حتى يخرج من الجسم. للمثانة ثلاث فتحات - اثنتان للحالب وواحدة لمجرى البول ، والتي تستنزف المثانة. ال تريغون هي منطقة مثلثة ناعمة في قاعدة المثانة تحددها هذه الفتحات الثلاث (الشكل 16.2) . بشكل جماعي ، تسمى الطبقات العضلية لجدار المثانة عضلة النافصة. يحتوي الجدار على طبقة وسطى من الألياف الدائرية وطبقتين من العضلات الطولية ، ويمكن أن تتمدد. تصبح ظهارة الغشاء المخاطي الانتقالية أرق ، وتسمى طيات في الغشاء المخاطي رجعي تختفي مع تضخم المثانة. للمثانة ميزات أخرى تسمح لها بالاحتفاظ بالبول. بعد دخول البول إلى المثانة من الحالب ، تعمل الثنيات الصغيرة من الغشاء المخاطي للمثانة كصمام لمنع التدفق العكسي. تم العثور على اثنين من المصرات على مقربة من مكان خروج مجرى البول من المثانة. تحدث العضلة العاصرة الداخلية حول فتحة مجرى البول. تتكون العضلة العاصرة الخارجية أدنى من العضلة العاصرة الداخلية من عضلات هيكلية يمكن السيطرة عليها طواعية.

الإحليل
ال الإحليل عبارة عن أنبوب صغير يمتد من المثانة البولية إلى فتحة خارجية. يختلف طول الإحليل عند الإناث عن الذكور. في الإناث ، يبلغ طول مجرى البول حوالي 4 سم فقط. طول مجرى البول القصير للأنثى يجعل الغزو البكتيري أسهل ويساعد في تفسير سبب كون الإناث أكثر عرضة للإصابة بعدوى المسالك البولية من الذكور. عند الذكور ، يبلغ متوسط ​​مجرى البول 20 سم عندما يكون القضيب رخوًا (عرجًا ، غير منتصب). عندما يغادر مجرى البول المثانة البولية للذكور ، يتم تطويقها بغدة البروستاتا. في الرجال الأكبر سنًا ، يمكن أن يحد تضخم غدة البروستاتا من التبول. يمكن لإجراء جراحي عادةً تصحيح الحالة واستعادة التدفق الطبيعي للبول. في الإناث ، الجهاز التناسلي والبولي غير متصلين. عند الذكور ، يحمل مجرى البول البول أثناء التبول والحيوانات المنوية أثناء القذف. هذه الوظيفة المزدوجة للإحليل عند الذكور لا تغير مسار البول.

التبول
عندما تمتلئ المثانة البولية إلى حوالي 250 مل بالبول ، ترسل مستقبلات التمدد نبضات عصبية حسية إلى النخاع الشوكي. بعد ذلك ، تتسبب نبضات العصب الحركي من الحبل الشوكي في تقلص المثانة البولية واسترخاء العضلة العاصرة بحيث يؤدي التبول ، ويسمى أيضًا التبول ممكن (الشكل 16.2) . في الأطفال الأكبر سنًا والبالغين ، يتحكم الدماغ في هذا المنعكس ، مما يؤخر التبول حتى الوقت المناسب.

الحفاظ على التوازن الحمضي القاعدي
تنظم الكلى توازن الدم الحمضي القاعدي. لكي يظل الشخص بصحة جيدة ، يجب أن يكون الرقم الهيدروجيني للدم حوالي 7.4. تراقب الكلى وتتحكم في درجة حموضة الدم ، بشكل رئيسي عن طريق إفراز أيونات الهيدروجين (H +) وإعادة امتصاص أيونات البيكربونات (HCO 3 -) حسب الحاجة للحفاظ على درجة الحموضة في الدم عند حوالي 7.4. عادةً ما يكون الرقم الهيدروجيني للبول 6 أو أقل لأن نظامنا الغذائي يحتوي غالبًا على الأطعمة الحمضية.

إفراز الهرمونات
تساعد الكلى جهاز الغدد الصماء في إفراز الهرمونات. تفرز الكلى مادة الرينين ، وهي مادة تؤدي إلى إفراز هرمون الألدوستيرون من قشرة الغدة الكظرية ، وهي الجزء الخارجي من الغدد الكظرية التي تقع فوق الكلى. يعزز الألدوستيرون إعادة امتصاص أيونات الصوديوم (Na +) بواسطة الكلى. عندما تنخفض قدرة الدم على حمل الأكسجين ، تفرز الكلى الهرمون إرثروبويتين ، الذي يحفز إنتاج خلايا الدم الحمراء. تساعد الكلى أيضًا على تنشيط فيتامين د من الجلد. فيتامين د هو مقدمة لهرمون الكالسيتريول ، الذي يعزز امتصاص الكالسيوم (Ca 2 +) من الجهاز الهضمي.

أعضاء الجهاز البولي
يتكون الجهاز البولي من الكلى والحالب والمثانة والإحليل. الشكل 16.1 يُظهر هذه الأعضاء ويتتبع مسار البول أيضًا.


حلول عمل منظم للسؤال

1. صِف 3 طرق يضر فيها التدخين الرئتين

  • يحتوي القطران المترسب في الرئتين على مواد مسرطنة ويزيد من خطر الإصابة بسرطان الرئة
  • أول أكسيد الكربون الموجود في الدخان يزيد من ترسب الدهون ، إذا كان تجويف الشرايين يضيق في الشرايين التاجية ويقلل من إمداد الدم ، مما يؤدي إلى نوبة قلبية
  • تسبب المهيجات السعال. قد يؤدي السعال العنيف المطول إلى انتفاخ الرئة حيث تتكسر الجدران السنخية

حجم الغاز المنتج في حقنة (سم 3)

(ب) من النتائج الواردة في الجدول 1 ، اقترح أي السكر سيكون ركيزة تنفسية أفضل للخميرة.

(ج) اقترح سبب وجود اختلاف في معدل التنفس عند إعطاء الخميرة سكريات مختلفة في التجربة.

(د) تسليط الضوء على أي بيانات غير طبيعية في النتائج.

(هـ) قم بتسمية خطأ محتمل في هذه التجربة واقترح تحسينًا أو حلًا.

(ب) الجلوكوز. يعطي كمية أكبر من غاز ثاني أكسيد الكربون من السكروز في نفس الفترة الزمنية ، مما يشير إلى أنه يمكن استخدامه بسرعة أكبر.

(ج) المادة الخام المستخدمة في التنفس هي الجلوكوز. السكروز هو ثنائي السكاريد ويجب أن يتحلل أولاً إلى جلوكوز قبل استخدامه في التنفس. لذلك ، فإن معدل التنفس باستخدام السكروز أقل من معدل التنفس للجلوكوز.

(د) القراءة عند 5 دقائق لتكرار 1 من الجلوكوز. إنها أعلى بكثير من قراءة التكرار 2.

(هـ) قد لا يتم تسجيل بعض ثاني أكسيد الكربون المنطلق حيث يمكن ضغط الهواء باستخدام datalogger بدلاً من ذلك. ثاني أكسيد الكربون قابل للذوبان بشكل طفيف في الماء وقد يذوب في الخليط باستخدام مؤشر هيدروجين كربونات بدلاً من ذلك.

3. يوضح الشكل 2 تأثير حمض اللاكتيك على كمية الأكسجين التي تطلقها خلايا الدم الحمراء لتنفس خلايا العضلات بنشاط.

(أ) اشرح سبب تكوين حمض اللاكتيك أثناء نشاط عضلي قوي.

(ب) بالإشارة إلى الشكل. 2 ، اشرح كيف يؤثر التركيز المتزايد لحمض اللاكتيك على إطلاق الأكسجين لخلايا العضلات.

(ج) كيف يزيل الجسم حمض اللاكتيك؟

(أ) أثناء النشاط العضلي القوي ، لا يكفي التنفس الهوائي وحده لتلبية الطلب المتزايد على الطاقة. يحدث التنفس اللاهوائي في خلايا العضلات لتكملة الطاقة من التنفس الهوائي. ينتج التنفس اللاهوائي في خلايا العضلات حمض اللاكتيك.

(ب) عندما يكون هناك زيادة في تركيز حمض اللاكتيك ، تنخفض النسبة المئوية للأوكسي هيموغلوبين في الدم. يشير هذا إلى أنه يتم إطلاق المزيد من الأكسجين من الهيموجلوبين إلى خلايا العضلات.

(ج) يزيل الجسم حمض اللاكتيك إما عن طريق الأكسدة لإنتاج الطاقة ، أو التحويل إلى الجلوكوز في الكبد.

4 ا. ما هي أعراض انتفاخ الرئة؟

4 ب. اذكر سبب انتفاخ الرئة

4 ا. صعوبة في التنفس ، أزيز ، ضيق في التنفس

5. اشرح أهمية كل مما يلي فيما يتعلق بوظيفتها في التنفس


شاهد الفيديو: د. وائل صفوت يوضح أهمية و فائدة غسيل القولون (شهر فبراير 2023).