معلومة

هل تؤثر حاصرات قنوات البوتاسيوم على إمكانات غشاء الراحة؟

هل تؤثر حاصرات قنوات البوتاسيوم على إمكانات غشاء الراحة؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أقرأ عن سموم العقرب والسموم لفصلي الحيوي ويبدو أن لديهم مجموعة متنوعة من حاصرات قنوات البوتاسيوم. سأل أستاذي "ما هو تأثير هذا على الخلايا العصبية؟" وبطبيعة الحال ، خطرت ببالي شيئين

  1. قنوات البوتاسيوم ضرورية لإعادة الاستقطاب
  2. تشارك قنوات البوتاسيوم في التحكم في تدرج تركيز الخلية.

لقد وجدت أدلة في مقالات تدعم الادعاء الأول ، لكني لا أعرف الكثير عن الثاني.

هل تؤثر حاصرات قنوات البوتاسيوم على إمكانات غشاء الراحة؟ هل سيغيرون تدرج التركيز بشكل كبير؟


  1. تشارك قنوات البوتاسيوم في التحكم في تدرج تركيز الخلية.

أود إعادة صياغة هذا إلى "الصوديوم / البوتاسيوم مضخات تحديد تدرجات تركيز الصوديوم والبوتاسيوم عبر غشاء الخلية "البوتاسيوم القنوات لاتفعل.

لقد وجدت أدلة في مقالات تدعم الادعاء الأول ، لكني لا أعرف الكثير عن الثاني.

حق؛ لأن القنوات لا تنشئ تدرجات التركيز.

هل تؤثر حاصرات قنوات البوتاسيوم على إمكانات غشاء الراحة؟

إذا قاموا بحظر قنوات البوتاسيوم "المتسربة" في حالة الراحة ، فأنت تراهن. يتم تحديد إمكانات غشاء الراحة إلى حد كبير من خلال التوصيل الكهربائي عبر تلك القنوات. سيؤدي حظرها إلى إزالة استقطاب الخلية إلى حد كبير مقارنةً بالقيم الكامنة النموذجية لغشاء الراحة. ولكن هناك العديد من قنوات البوتاسيوم المختلفة. قد تفكر في منع قناة البوتاسيوم المعدلة المتأخرة ، والتي لا ينبغي أن تفعل الكثير على الإطلاق لتغيير إمكانات غشاء الراحة.

هل سيغيرون تدرج التركيز بشكل كبير؟

ربما لا ، لأنه على الرغم من أن الخلية ستفقد كمية أقل من البوتاسيوم من خلال هذا التوصيل ، فإن ما يهم أكثر لتدرج تركيز البوتاسيوم هو مضخات الصوديوم / البوتاسيوم.


اجابة قصيرة
يؤثر سم العقرب في الغالب على نشاط إطلاق الخلايا العصبية عن طريق تثبيط الشفاء.

خلفية
هناك حوالي 100 نوع فرعي من K.+ قنوات وحوالي 120 سم عقرب مختلفة معروفة. من بين هذه المجموعة من السموم ، تم اختبار الغالبية على القنوات المرتبطة بشاكر (الفصيلة الفرعية KV1.x). تم عرض بعض الببتيدات للعمل على Ca2+-تنشيط K.+ قنوات (KCa1.1 ، KCa3.1 ، KCa2.x. عائلة ما يسمى بسموم g-KTx خاصة بعائلة ether-a-go-go من K+ قنوات (KV11.x) (رودريغيز دي لا فيجا وبوساني ، 2004).

عائلة شاكر الفرعية وعائلة ether-a-go-go كلها قنوات ذات بوابات جهد وبالتالي تشارك بشكل وثيق في توليد إمكانات العمل (Coleman وآخرون. ، 1999 ؛ شيبرد وآخرون. ، 2007)] ؛ كاليفورنيا2+-تنشيط K.+ يتم تنشيط القنوات عند Ca2+ يدخل الخلية ، وهو حدث يرتبط عادةً بإمكانيات العمل أيضًا.

ومن ثم ، بناءً على هذه المعلومات ، استنتجت أن سم العقرب يمنع بشكل أساسي مرحلة عودة الاستقطاب للخلايا العصبية ، مما يعني أن الحد الأقصى لمعدل إطلاق النار سيتم تقليله بشكل كبير بسبب منع التعافي. يمكن للخلايا العصبية أن تطلق النار ، لكنها لن تكون قادرة على التعافي من إطلاق النار المستمر.

لا يرتبط سم العقرب بقوة بقنوات تسرب البوتاسيوم (عائلة KCNK). على الرغم من أن العائلات الأخرى قد تؤثر أيضًا على إمكانات غشاء الراحة ، إلا أن عائلة KNCK هي التي ترتبط في الغالب بتوليد إمكانات غشاء استراحة الخلية (كوهين وآخرون، 2009). ومن ثم ، فإن سم العقرب لن يؤثر على قدرة غشاء الراحة أكثر من اللازم.

مراجع
- كولمان وآخرون., ي نيوروتشيم (1999); 73: 849-58
- رودريغيز دي لا فيجا وبوساني ، السمية (2004); 43: 865-875
- شيبرد وآخرون., نشرة الفصام; 33(6): 1263-9
- كوهين وآخرون., Eur Biophys J (2009); 39(1): 61-73


ماذا يحدث إذا تم حظر قنوات تسرب الصوديوم؟

المزيد من الجهد بوابات Na + القنوات يتم منعت في الخلايا منزوعة الاستقطاب. هذا الاستقطاب يعيد تعيين كل من بوابات التنشيط والتعطيل الخاصة بـ قناة صوديوم، مما يسمح للخلية بتوليد جهد عمل آخر (Na + القنوات لا يمكن فتحه إلا من الحالة المغلقة ، وليس من الحالة المعطلة).

قد يتساءل المرء أيضًا ، ما الذي يحدث لإمكانات غشاء الراحة للخلية إذا تم حظر قنوات تسرب K +؟ سيقلل من يستريح غشاء المحتملة، جعل زنزانة أقل سلبية (أو أكثر إيجابية). الجهد بوابات نا القنوات التي تسمح لـ نا تسريب داخل ال زنزانة، صناعة زنزانة أكثر إيجابية.

إلى جانب ذلك ، ما الذي يحدث لإمكانات العمل عند انسداد قنوات البوتاسيوم؟

الآثار المترتبة على إمكانات العمل الدور الأساسي لـ قنوات البوتاسيوم في القلب إمكانات العمل هو عودة استقطاب الخلايا. وبالتالي، الحجب هؤلاء القنوات يبطئ (يؤخر) عودة الاستقطاب ، مما يؤدي إلى زيادة في إمكانات العمل المدة وزيادة فترة الحران الفعالة (ERP).

هل توجد قنوات لتسرب الصوديوم؟

غشاء الخلية العصبية قابل للاختراق جزئيًا صوديوم الأيونات ، لذلك صوديوم الذرات ببطء تسريب في الخلايا العصبية من خلال قنوات تسرب الصوديوم. تريد الخلية الحفاظ على إمكانات غشاء الراحة السلبية ، لذلك لديها مضخة تضخ البوتاسيوم مرة أخرى إلى الخلية وتضخها صوديوم خارج الخلية في نفس الوقت.


الإثارة - تثبيط الصرع

36.5.2.5 Flupirtine

Flupirtine ، فتاحة قناة بوتاسيوم عصبية انتقائية ، تنشط قنوات KCNQ (قنوات K + الداخلية التي تنظمها البروتين G) وتثبت إمكانات غشاء الراحة. يعمل Flupirtine أيضًا عبر عداء مستقبل NMDA من خلال تعزيز Mg 2 + blockade (Kornhuber et al. ، 1999). تمت دراسة الخصائص المضادة للاختلاج للفلوبيرتين مؤخرًا فقط. أثبت Flupirtine نجاحه في قمع النوبات تمامًا في نموذج flurothyl لنوبات حديثي الولادة وفي منع النوبات الكهربية والسلوكية في نموذج SE الناجم عن حمض كينيك في الفئران P10 (Raol et al. ، 2009). مزيد من الدراسات ضرورية لتحديد الآثار طويلة المدى لعلاج flupirtine النوبات حديثي الولادة.


العلاج باستخدام flupirtine المنشط لقناة البوتاسيوم Kv7 مفيد في نموذجين مستقلين من الفئران لارتفاع ضغط الدم الرئوي

الخلفية والغرض: تساهم قنوات البوتاسيوم ذات الجهد الكهربائي (K (v)) في راحة الغشاء المحتمل في خلايا العضلات الملساء للشريان الرئوي ويتم تنظيمها في المرضى الذين يعانون من ارتفاع ضغط الدم الشرياني الرئوي (PAH) وقد تم اقتراح مساهمة من K (v) 7 قنوات مؤخرًا. لقد بحثنا في تأثير منشط القناة K (v) 7 ، flupirtine ، على PAH في نموذجين مستقلين للماوس: PAH الناجم عن نقص الأكسجة و PAH العفوي في الفئران التي تفرط في التعبير عن ناقل 5-HT (SERT (+) الفئران).

المنهج التجريبي: تم تقييم ضغط البطين الأيمن في الجسم الحي في الفئران التي عولجت بشكل مزمن بالفلوبيرتين (30 مجم / كجم (-1). يوم (-1)). في تجارب منفصلة في المختبر ، تم تركيب الشرايين الرئوية من الفئران غير المعالجة في جهاز تخطيط عضوي سلكي. تم قياس الاسترخاء للإعطاء الحاد للفلوبيرتين والتقلصات لعقاقير حظر قناة K (v) ، بما في ذلك K (v) 7 قناة مانع linopirdine ،.

النتائج الرئيسية: في الفئران البرية (WT) ، أدى نقص الأكسجة إلى زيادة ضغط البطين الأيمن وإعادة تشكيل الأوعية الدموية الرئوية وتضخم البطين الأيمن. تم تخفيف هذه التأثيرات بواسطة flupirtine ، مما أدى أيضًا إلى إضعاف مؤشرات PAH في الفئران SERT (+). في التجارب في المختبر ، تسبب flupirtine في استجابة ارتخاء قوية في الشرايين من الفئران WT و SERT (+) غير المعالجة. تم عكس الاسترخاء تمامًا بواسطة linopirdine ، الذي أدى إلى تقلص الشرايين الرئوية للفأر بقوة بينما لم تفعل حاصرات قنوات K (v) الأخرى.

الاستنتاجات والآثار: خفف Flupirtine بشكل كبير من تطور PAH الناجم عن نقص الأكسجة المزمن في الفئران وعكس PAH في الفئران SERT (+) ، على ما يبدو عبر تنشيط قناة K (v) 7. توفر هذه النتائج أول دليل مباشر على أن الأدوية التي تنشط قنوات K (v) 7 قد تكون مفيدة في علاج الهيدروكربونات العطرية متعددة الحلقات مع المسببات المرضية المختلفة.


آثار فتاحات قنوات البوتاسيوم ومضاداتها على الخلايا العصبية الزرقاء في الفئران.

1. تم الحصول على التسجيلات داخل الخلايا من إعداد شريحة جسرية من دماغ الفئران التي تحتوي على الموضع الأزرق (LC). أدت فتحتان لقنوات البوتاسيوم (K (ATP)) الحساسة لـ ATP ، RO 31-6930 (10 ميكرو مول) و cromakalim (100 ميكرو مول) إلى تقليل التفريغ التلقائي لإمكانات العمل دون تغيير السعة أو المدة. لم يغير أي من المركبين إمكانات غشاء الراحة. 2. من بين اثنين من حاصرات قنوات K (ATP) ، أدى tolbutamide (300 microM) إلى زيادة معدل إطلاق النار ، بينما كان glibenclamide (3 microM) يميل فقط إلى القيام بذلك. بالإضافة إلى ذلك ، فإن كلا المركبين يعاكسان تأثير 31-6930 ريال عماني (10 ميكرو مول). لم يغير جليبنكلاميد (3 ميكرومتر) ولا تولبوتاميد (300 ميكرومتر) إمكانات غشاء الراحة. 3. تيترودوتوكسين (0.5 ميكرو مولار) يحد من الحرق ، لكنه لم يؤثر على العمل المثبط لـ RO 31-6930 (10 ميكرو مول). مضاد الأحماض الأمينية المثير ، حمض كينورينيك (500 ميكرومتر) ، لم يغير التفريغ العفوي لإمكانيات الفعل. 4. التحولات الصغيرة (2-4 مللي فولت) لإمكانات الغشاء عن طريق الحقن الحالية المفرطة أو المزيلة للاستقطاب انخفضت بشكل ملحوظ وزادت من معدل إطلاق النار ، على التوالي. 5. نورادرينالين (100 ميكرومتر) يفرط في استقطاب الخلايا ويقلل من مقاومة المدخلات. هذا التأثير لم يتعارض مع جليبنكلاميد (3 ميكرومتر) أو تولبوتاميد (300 ميكرومتر). ألغى Ba2 + (2 ملي مولار) ، وهو مانع لكل من قنوات البوتاسيوم الحساسة للـ ATP وداخلها ، تأثيرات 31-6930 ريال عماني (10 ميكرو مول) والنورادرينالين (100 ميكرو مولار). 6. تشير هذه البيانات إلى أن قنوات K (ATP) موجودة على الخلايا العصبية النورادرينالية LC ، ولكنها غير مقترنة بمستقبلات alpha 2-adrenoceptors.


المواد والأساليب

التعبير في بويضات X. laevis

X. laevis تم تحضير البويضات وحقنها وإزالتها ، كما هو موضح سابقًا (21 ، 22). تم تحضير الحمض النووي الريبي المشفر متعدد الأدينيلات (cRNA) للبروتين المشفر بواسطة الجين Tb927.1.4450 (TbK1) والبروتين المشفر بواسطة الجين Tb927.9.4820 (TbK2) في المختبر باستخدام مجموعة mMESSAGE mMACHINE (Ambion ، أوستن ، تكساس ، الولايات المتحدة الأمريكية). تم حقن البويضات بمحلول 50 nl يحتوي على cRNA ، وترميز لـ TbK1 أو TbK2 أو خليط 1: 1 من كليهما (0.2 ميكروغرام / ميكرولتر لكل منهما) ثم تم تحضينها في محلول Barth المعدل [10 ملي مولار HEPES ، درجة الحموضة 7.5 ، 88 ملي مول كلوريد الصوديوم ، 1 ملي KC1 ، 2.4 ملي مولار ناهكو3، 0.82 ملي MgSO4، 0.34 ملي مولار الكالسيوم (NO3)2، 0.41 ملي كلوريد الكالسيوم2، 100 وحدة / مل بنسلين ، 100 ميكروغرام / مل ستربتومايسين] عند 18 درجة مئوية لمدة 3 أيام قبل القياسات.

التوصيف الوظيفي في بويضات X. laevis

تم إجراء القياسات الحالية باستخدام Oocyte Clamp OC-725 (Warner Instruments ، Hamden ، CT ، الولايات المتحدة الأمريكية) مضخم الجهد ثنائي القطب. تمت ترقيم التيارات عند 10 كيلو هرتز باستخدام MacLab / 200 (AD Instruments ، Spechbach ، ألمانيا).

تم إجراء تجارب الفيزيولوجيا الكهربية بقدرة قابلية تبلغ -40 مللي فولت. بتردد 1 هرتز ، تم تطبيق خطوات الجهد المنفصل لمدة 300 مللي ثانية إلى إمكانات تتراوح من -120 إلى +40 مللي فولت في خطوات 10 مللي فولت. احتوى وسط التروية على 90 ملي مول كلوريد الصوديوم ، 1 ملي مولار KC1،1 ملي مول كلوريد الصوديوم2، 1 ملي كاكل2، و 5 ملي مولار Na-HEPES (الرقم الهيدروجيني 7.4). تم وضع محلول التروية (6 مل / دقيقة) من خلال أنبوب شعري زجاجي بقطر داخلي 1.35 مم ، تم وضع فمه

0.5 مم من سطح البويضة (23). عندما تم استخدام البوتاسيوم باعتباره الكاتيون الرئيسي ، احتوى الوسط على 91 ملي مولار KC1،1 ملي MgCl2، 1 ملي كاكل2، و 5 ملي K-HEPES (الرقم الهيدروجيني 7.4). لتحديد الانتقائية الأيونية للقناة ، وسيط إضافي مع نتم استخدام -methyl- d -glucamine (NMDG) باعتباره كاتيون رئيسي. احتوت هذه الوسيلة على 90 ملي مولار NMDG ، 1 ملي مول كلوريد ، 1 ملي مول كلوريد2، 1 ملي كاكل2، و 5 ملي K-HEPES (الرقم الهيدروجيني 7.4).

لتحديد انتقائية الأيونات ، تم استخدام معادلة Goldman-Hodgkin-Katz (24 ، 25) على النحو التالي: هنا = -89mV = 58.8mV- سجل ((صنا· [ناخارج] + صك· [كخارج] + صسجل تجاري [Clفي]) / خ) ، [ناخارج] = 92.5 مم ، [K.خارج] = 1 ملم هك = -24 مللي فولت = 58.8 مللي فولت · سجل ((صنا· [ناخارج] + صك· [كخارج] + صسجل تجاري [Clفي]) / خ) ، [ناخارج] = 0 مم ، [كخارج] = 93.5 ملم هNMDG ∗ = -96 مللي فولت = 58.8 مللي فولت · سجل ((صنا· [ناخارج] + صك· [كخارج] + صNMDG ∗ [NMDGخارج] + صجي ∗ [Clفي]) / خ) ، [ناخارج] = 0 مم ، [كخارج] = 3.5 ملم ، [NMDGخارج] = 90 ملم. [Clفي] تم تحديده على أنه 30 ملي مولار من إمكانات الانعكاس للبويضات التي تعبر عن GABA المؤتلف المنشط لكلوريد GABA الانتقائيأ القنوات. صNMDG كان من المفترض أن يكون ضئيلاً. صك/ صنا عندئذٍ يمكن حسابها على أنها 22. في بويضات التحكم المحقونة بالماء ، هنا, هك، و هNMDG كانت في المتوسط ​​-21 و -9 و -36 بالسيارات على التوالي. صك/ صنا يمكن حسابها على أنها 2.2 في هذه الحالة. نظرًا لأن الغشاء يحتوي ، بالإضافة إلى TbK1 / TbK2 الموصلات الذاتية مع هذه الانتقائية المنخفضة ، فإن انتقائية الأيونات البالغة 22 للتيار بوساطة TbK1 / TbK2 هي أقل من الواقع.

إسكات الجينات بوساطة RNAi

تم تنظيم التعبير عن TbK1 و TbK2 بواسطة RNAi باستخدام بنية حلقة جذعية تحتوي على بوروميسين (لـ PCF) أو جينات مقاومة الفلوميسين (لـ BSF). تم اختيار تسلسل الجينات لـ RNAi باستخدام RNAit ، وهي خوارزمية تنبؤ مصممة لمنع التداخل المحتمل وبالتالي التأثيرات غير المستهدفة (26).

مع التمهيدي الأمامي GCCCAAGCTTGATCCTTTCAGTCTCACGCCTTCCT والبادئ العكسي CTGCTCTAGTCGAGCCGAATGTCGTAGGGGAA ، تم تضخيم جزء 425 نقطة أساس تغطي النيوكليوتيدات 2321-2746 من TbK1 بواسطة PCR واستنساخه في المتجهات المستهدفة. بالنسبة إلى TbK2 ، تم تضخيم جزء 502 نقطة أساس ، بما في ذلك النيوكليوتيدات 60-562 من الجين ، باستخدام التمهيدي الأمامي GCCCAAGCTTGATCCCTTCCGAAATTGTTTGATG والبادئ العكسي CTGCTCTAGACTCGAGTATACCAACACACGTGAGA واستنساخه في المتجهات المستهدفة. بالنسبة لترنسفكأيشن PCF ، تم اختيار plasmid pALC14 (هدية لطيفة من André Schneider ، جامعة برن ، سويسرا) ، وبالنسبة لـ BSF ، تم استخدام المتجه pMS14v5 (27). تم إنشاء البلازميد pMS14v5 عن طريق الهضم المقيد لمنطقة الحلقة الجذعية من البلازميد pALC14 (28) باستخدام هينdIII و باممرحبًا ، متبوعًا بربط الحلقة الجذعية في الموضع المقابل للناقل pLEW100v5bld (29) ، مما يسمح بالتعبير الذي يحفزه التتراسيكلين عن الحمض النووي الريبي لدبوس الشعر تحت مروج الرنا الريباسي. قبل تعداء T. بروسي الخلايا ، تم خطي DNA البلازميد مع لاأنا واستخلصت مع الفينول والكلوروفورم.

تعداء المثقبيات مستقرة واختيار الحيوانات المستنسخة

T. بروسي تمت زراعة 29-13 خلية PCF (30) إلى مرحلة منتصف البلوغ (0.5-0.8 × 10 7 خلايا / مل) في وسط استنبات لـ PCF (SDM-79 BioConcept ، Allschwil ، سويسرا) ، مكملة بـ 10 ٪ (حجم / حجم) جنيني مصل بقري (FBS LuBioScience GmbH ، لوسيرن ، سويسرا) عند 27 درجة مئوية. تم حصاد الخلايا (4-5 × 10 7) بالطرد المركزي عند 1250 ز لمدة 10 دقائق ، تغسل مرة واحدة في المخزن المؤقت (132 ملي كلوريد الصوديوم ، 8 ملي مولار KC1 ، 8 ملي مولار الصوديوم2HPO41.5 مم KH2ص4، 0.5 ملي أسيتات المغنيسيوم ، 0.09 ملي أسيتات الكالسيوم ، درجة الحموضة 7.0) ، معلق في 450 ميكرولتر من نفس المخزن المؤقت ، ويخلط مع 15 ميكروغرام بلازميد خطي. تم إجراء Electroporation باستخدام نظام BTX Electroporation 600 (مختبرات Axon ، بادن ، سويسرا) مع نبضة واحدة (جهد شحن 1.5 كيلو فولت ، مقاومة 2.5 كيلو فولت ، توقيت السعة 25 مللي أمبير ، وتوقيت مقاومة 186) باستخدام كفيت نبضي 0.2 سم ( مختبرات بيو راد إيه جي ، كريسير ، سويسرا). تم تلقيح الخلايا الكهربية على الفور في 10 مل SDM-79 تحتوي على 10 ٪ من FBS المعطل بالحرارة. تم الحصول على الحيوانات المستنسخة عن طريق التخفيف المحدود في 24 طبقًا جيدًا في SDM-79 تحتوي على وسط مكيف بنسبة 20 ٪ في وجود 2 ميكروغرام / مل من بوروميسين للاختيار. تم اختبار الحيوانات المستنسخة المقاومة للمضادات الحيوية لوجود التركيبات المقدمة بواسطة تفاعل البوليميراز المتسلسل. تم إحداث RNAi عن طريق إضافة 1 ميكروغرام / مل من التتراسيكلين إلى مزارع الطفيليات. تم استزراع سلالة مجرى الدم الوالدية NYsm (30) في وسط استزراع لوسط BSF (HMI-9) ، مكملًا بـ 10 ٪ (حجم / حجم) معطل بالحرارة FBS و 1 ميكروغرام / مل G418 إلى مرحلة منتصف البلوغ (0.5-0.8 × 10 6 خلايا / مل). بعد ذلك ، تم حصاد 4-5 × 10 7 خلايا بالطرد المركزي ، وغسلها ، وتعليقها في محلول منظم (90 ملي مولار الصوديوم.2HPO4، 5 ملي بوكل ، 0.15 ملي كلوريد الكالسيوم2، 50 ملي HEPES ، الرقم الهيدروجيني 7.3) و 15 ميكروغرام بلازميد خطي. تم إجراء Electroporation مع البرنامج Z-001 في Amaxa Nucleofector 2b (Lonza ، Visp ، سويسرا). تم الحصول على الحيوانات المستنسخة عن طريق التخفيف المحدود في 24 لوحًا جيدًا في HMI-9 تحتوي على 10٪ FBS في وجود 1 ميكروغرام / مل من فلوميسين للاختيار. تم اختبار الحيوانات المستنسخة المقاومة للمضادات الحيوية لوجود التركيبات المقدمة بواسطة تفاعل البوليميراز المتسلسل. تم اختيار الشروط لكل من عمليات العدوى وفقًا لبروتوكول منشور سابقًا (31).

عزل الحمض النووي الريبي والكمي RT-PCR

تم استخراج إجمالي الحمض النووي الريبي من ثقافات RNAi المستحثة وغير المستحثة في نقاط زمنية مختلفة ، وفقًا لبروتوكول الشركة المصنعة باستخدام مجموعة SV Total RNA Extraction Kit (Promega ، Madison WI ، الولايات المتحدة الأمريكية). تم قياس تركيز ونقاوة الحمض النووي الريبي باستخدام مقياس الطيف الضوئي (NanoDrop 1000 Thermo Fisher Scientific ، Wilmington ، DE ، الولايات المتحدة الأمريكية) ، وتعرض 10 ميكروغرام من الحمض النووي الريبي الإجمالي لكل نقطة زمنية إلى علاج DNase I ثانٍ (روش ، بازل ، سويسرا). بعد ذلك ، تمت تنقية الحمض النووي الريبي عن طريق استخراج الفينول / الكلوروفورم والترسيب اللاحق. تم تحديد تركيز الحمض النووي الريبي مرة أخرى باستخدام مقياس الطيف الضوئي (NanoDrop 1000 Thermo Fisher Scientific) ، واستخدم 2 ميكروغرام إجمالي RNA للنسخ العكسي باستخدام الاشعال العشوائي باستخدام مجموعة النسخ العكسي cDNA عالية السعة (النظم البيولوجية التطبيقية ، تقنيات الحياة ، بيزلي ، المتحدة. مملكة). تم تخفيف cDNA الناتج إلى التركيزات المرغوبة وتم تحليله بواسطة PCR الكمي (qPCR) باستخدام Fast SYBR Green Kit (النظم الحيوية التطبيقية ، تقنيات الحياة) ، وفقًا لتعليمات الشركة المصنعة. كما تم التحقق من صحة الرقابة الداخلية ، تم قياس مستويات التعبير Tb11.01.1950 بالتوازي (32). تم تصميم البادئات المحددة لكل هدف باستخدام أداة Primer3Plus (33). كانت البادئات الأمامية والخلفية المستخدمة في TbK1 هي ATGATGGGTCGTTGCTTCTC و ATACAACGATTCCGGTGAGC ، على التوالي. بالنسبة لـ TbK2 ، كان التمهيدي الأمامي المستخدم هو TCCACTGTTTGAGATGCAG ، وكان التمهيدي العكسي ATCCTATGCGGGTGAGTTG. بالنسبة إلى Tb11.01.1950 ، استخدمنا البادئات التي تم نشرها بواسطة Brenndörfer و Boshart (32) تم تحليل كل عينة في ثلاث نسخ ، وتم حساب متوسط ​​دورة العتبة (CT) لكل عينة. تم تحديد مستويات التعبير النسبي للجينات المستهدفة بطريقة 2 -CT (34).

التدفق الخلوي

تم تحضين خلايا مجرى الدم (عينة 8 × 10 5 / لتر) عند 37 درجة مئوية في 30 ملي مولار ن- [tris (hydroxyrnethyl) rnethylyl] -2-aminoethanesulfonic acid buffer ، 118 ملي مولار كلوريد الصوديوم ، 5 ملي مولار NaHCO3، 5 ملي بوكل ، 1.2 ملي مجكل2، و 10 ملي جلسرين ، درجة الحموضة 7.4 ، لمدة 90 دقيقة. بعد ذلك ، أجريت تجارب قياس التدفق الخلوي. بعد إضافة مكرر- (حمض 1.3-ثنائي بيوتيل باربيتوريك) تريميثين [DiBAC4(3) Invitrogen ، مجسات جزيئية ، يوجين ، أوريغون ، الولايات المتحدة الأمريكية] بتركيز نهائي قدره 20 نانومتر ، تم تحديد التألق القاعدي ، متبوعًا بزيادة متتالية في التركيز الكلي لـ KCl أو NaCl بمقدار 5 ، 10 ، 20 ، 40 ملي مولار في كلتا الحالتين ، وقياس بعد كل إضافة. أخيرًا ، تمت إضافة gramicidin (Sigma-Aldrich Chemie GmbH ، Buchs SG ، سويسرا) إلى تركيز نهائي قدره 1 ميكرومتر. تم تحضين العينات لمدة 5 دقائق عند 37 درجة مئوية ، وتم تحديد التألق مرة أخرى. لا يمكن إجراء معايرة لإمكانات الغشاء التي تستخدم الأيونوفور انتقائي البوتاسيوم فالينوميسين ، حيث تبين أن حامل الأيون هذا يتفاعل مع مركبات أوكسونول (35). لكل قياس ، تم تحليل ما لا يقل عن 10000 خلية. تم تحليل البيانات باستخدام برنامج FlowJo (TreeStar ، Ashland ، OR ، USA). تم إجراء التحليل الإحصائي باستخدام ANOVA أحادي الجانب مع Bonferroni آخر مخصص اختبار.


كيف وماذا تحجب حاصرات قنوات البوتاسيوم والكالسيوم؟

قد يسمع العديد من المرضى أن الدواء الذي يصفه لهم الطبيب هو حاصرات قنوات الصوديوم أو حاصرات بيتا أو حاصرات قنوات البوتاسيوم أو حاصرات قنوات الكالسيوم دون إخبارهم بالفرق أو لماذا أو كيف تعمل بشكل جيد. قد يتساءل المرضى. هل بيتا هي رسالة أخوي التي عادت لتطاردني بعد كل هذه السنوات؟ كما هو موضح في المدونة السابقة وسيتم تمثيلها بشكل أكبر في هذه المدونة ، فإن الصوديوم و "بيتا" والبوتاسيوم والكالسيوم ليست جزيئات صغيرة شريرة لتخرج قلبك. إنها جوانب حيوية جدًا لوظائفك الجسدية ولكنها قد تصبح مفرطة التحفيز في بعض الأحيان ، مما يؤدي إلى عدم انتظام ضربات القلب وتصبح حاصرات القنوات غير التقليدية هذه فقط ما يطلبه الطبيب. في المدونة السابقة ، قمت بمراجعة حاصرات قنوات الصوديوم والبيتا. سأناقش هنا حاصرات قنوات البوتاسيوم والكالسيوم.

الفئة الثالثة: حاصرات قنوات البوتاسيوم
إمكانات العمل والدور الذي يلعبه البوتاسيوم في إمكانات العمل
تذكر جهود العمل التي تمت مناقشتها مع قنوات الصوديوم؟ تبدأ بداية جهد الفعل بإزالة استقطاب غشاء الخلية عندما يندفع الصوديوم للداخل. وتبدأ الخلية في إعادة الاستقطاب عندما يغادر البوتاسيوم الخلية ، وإن لم يكن بالسرعة التي يندفع بها الصوديوم إلى الداخل. وهذا الاستقطاب يعيد غشاء الخلية إلى أسفل إلى أسفل. المزيد من الراحة السلبية المحتملة.

ما هي كتل مانع قناة البوتاسيوم وما هي المواد المستخدمة في العلاج
ترتبط حاصرات قنوات البوتاسيوم بقنوات البوتاسيوم المسؤولة عن إعادة استقطاب غشاء الخلية. يؤدي حظر هذه القنوات إلى إبطاء (تأخير) عودة الاستقطاب ، مما يؤدي إلى زيادة مدة العمل المحتملة وزيادة فترة المقاومة الفعالة. تعني الزيادة في فترة الانكسار أن الفترة الزمنية التي تكون فيها الخلية غير مهتزة وبالتالي لا يمكنها تلقي إمكانية عمل أخرى تكون مطولة. في مخطط كهربية القلب ، يؤدي هذا التأخير في إزالة الاستقطاب إلى زيادة فترة QT.

من خلال جعل الخلية أقل إثارة ، فإن حاصرات قنوات البوتاسيوم فعالة جدًا في علاج تسرع القلب. ومن المعروف أيضًا أنها تعالج انتظام ضربات القلب فوق البطيني والبطين والرجفان الأذيني والرفرفة الأذينية.

أمثلة على حاصرات قنوات البوتاسيوم وآثارها الجانبية
أميودارون ، درونيدارون ، بريتليوم ، إيبوتيليد ، دوفيتيليد

الآثار الجانبية لحاصرات قنوات البوتاسيوم هي إنتاج نوع من تسرع القلب البطيني ، وبطء القلب والحصار الأذيني البطيني أو خلل العقدة الجيبية الأذينية. تحدث مع طبيبك والصيدلي لمعرفة الدواء المناسب لك. ولا تنس تقييم العقار على www.RateaDrug.com لإعلام الآخرين بالتجارب التي مررت بها مع دواء معين!

الفئة الرابعة: حاصرات قنوات الكالسيوم
ما هي قنوات الكالسيوم وأين وجدت
قنوات الكالسيوم هي خلايا تعرف باسم "الخلايا المثيرة" الحساسة للنبضات الكهربائية. مثل قنوات الصوديوم والبوتاسيوم ، عندما تتلقى البروتينات الإشارة الصحيحة ، تفتح القناة ، مما يسمح للكالسيوم بالتدفق عبر القناة. يمكن أن تحفز الشحنة الصغيرة التي يحملها أيون الكالسيوم تقلصات العضلات أو إفراز الهرمونات أو إطلاق ناقل عصبي. لذلك ، توجد قنوات الكالسيوم في العضلات والخلايا الدبقية والخلايا العصبية.

ما الذي يحجب قناة الكالسيوم وما الذي يتم استخدامه للعلاج
تعمل حاصرات قنوات الكالسيوم على توسيع الشرايين في القلب ، مما يقلل من ضغط الدم في الشرايين مما يؤدي إلى قدرة القلب على ضخ الدم بسهولة أكبر. بشكل أساسي ، تنخفض حاجة القلب إلى الأكسجين لضخ القلب لأنه لا يحتاج إلى الضخ كثيرًا.

غالبًا ما تستخدم حاصرات قنوات الكالسيوم لارتفاع ضغط الدم وألم الصدر (بسبب نقص الأكسجين في القلب) وعدم انتظام ضربات القلب مثل الرجفان الأذيني وتسرع القلب فوق البطيني. يمكن استخدامها بعد نوبة قلبية لمريض ليس مرشحًا جيدًا لحاصرات بيتا. لسوء الحظ ، لم تثبت حاصرات قنوات الكالسيوم أنها تمنع النوبات القلبية في المستقبل.

أمثلة على حاصرات قنوات الكالسيوم وآثارها الجانبية
أملوديبين ، ديلتيازيم (العلامة التجارية = كارديزيم) ، فيلوديبين ، نيفيديبين ، نيكارديبين ، نيموديبين ، نيسولديبين ، فيراباميل


محتويات

لقد ثبت أن السموم الشجرية تمنع أنواعًا فرعية معينة من قنوات البوتاسيوم ذات الجهد الكهربائي (K +) في الأنسجة العصبية. [ بحاجة لمصدر ] في الجهاز العصبي ، تتحكم قنوات K + الموصلة بالجهد في استثارة الأعصاب والعضلات عن طريق التحكم في إمكانات غشاء الراحة وعن طريق إعادة استقطاب الغشاء أثناء إمكانات الفعل. لقد ثبت أن السم الديندروتوكسين يربط عقد رانفييه بالخلايا العصبية الحركية [1] ويمنع نشاط قنوات البوتاسيوم هذه. وبهذه الطريقة ، يطيل الديندروتوكسين مدة إمكانات الفعل ويزيد من إفراز الأسيتيل كولين عند التقاطع العصبي العضلي ، مما قد يؤدي إلى فرط استثارة العضلات وأعراض متشنجة.

بروتينات 7 كيلو دالتون تتكون من سلسلة ببتيد واحدة من حوالي 57-60 حمضًا أمينيًا. تم عزل العديد من متماثلات alpha-dendrotoxin ، وكلها تمتلك تسلسلًا مختلفًا قليلاً. ومع ذلك ، فإن البنية الجزيئية والتشكيل القابل للطي لهذه البروتينات متشابهة جدًا. تمتلك السموم الشجرية سمومًا قصيرة جدًا 310- حلزون بالقرب من الطرف N للببتيد ، بينما يحدث حلزون ألفا ثنائي الدوران بالقرب من الطرف C. تحتل ورقة β ثنائية الشريطة المضادة للتوازي الجزء المركزي من التركيب الجزيئي. يرتبط هذان السلكان β بمنطقة مشوهة [2] يُعتقد أنها مهمة لنشاط الارتباط للبروتين. يتم ربط جميع السموم المتشابكة من خلال ثلاثة جسور ثاني كبريتيد ، والتي تضيف الاستقرار إلى البروتين وتساهم بشكل كبير في تكوينه الهيكلي. تم حفظ بقايا السيستين التي تشكل روابط ثاني كبريتيد بين جميع أعضاء عائلة ديندروتوكسين ، وتقع في C7-C57 و C16-C40 و C32-C53 (ترقيم وفقًا لـ alpha-dendrotoxin).

السموم التغصنية هي متجانسة من الناحية الهيكلية مع مثبطات الأنزيم البروتيني السيرين من نوع كونيتز ، بما في ذلك مثبط التربسين البقري للبنكرياس (BPTI). ثبت أن Alpha-dendrotoxin و BPTI لهما هوية تسلسلية بنسبة 35 ٪ بالإضافة إلى روابط ثاني كبريتيد متطابقة. على الرغم من التماثل الهيكلي بين هذين البروتينين ، لا يبدو أن السموم الشجرية تظهر أي نشاط بروتياز مثبط قابل للقياس مثل BPTI. يبدو أن فقدان النشاط هذا ناتج عن عدم وجود بقايا الأحماض الأمينية الرئيسية التي تنتج اختلافات هيكلية تعيق التفاعلات الرئيسية اللازمة لنشاط البروتياز الذي شوهد في BPTI.

السموم الشجرية هي بروتينات أساسية تمتلك شحنة موجبة صافية عند وجودها في درجة الحموضة المحايدة. توجد معظم بقايا الأحماض الأمينية موجبة الشحنة للسموم الشجرية في الجزء السفلي من الهيكل ، مما يخلق مجالًا كاتيونيًا على جانب واحد من البروتين. تنتج الشحنة الموجبة من بقايا الليسين (Lys) والأرجينين (Arg) المركزة في ثلاث مناطق أولية من البروتين: بالقرب من الطرف N (Arg3 ، Arg4 ، Lys5) ، بالقرب من الطرف C (Arg54 ، Arg55) وفي منطقة الدوران الضيقة (Lys28 ، Lys29 ، Lys30). [3] يُعتقد أن هذه البقايا الموجبة الشحنة يمكن أن تلعب دورًا حاسمًا في نشاط ربط السموم الشجرية ، حيث يمكنها إجراء تفاعلات محتملة مع المواقع الأنيونية (الأحماض الأمينية سالبة الشحنة) في مسام قنوات البوتاسيوم.

تحرير الصيدلة

يرتبط جزيء dendrotoxin الفردي بشكل عكسي بقناة البوتاسيوم من أجل ممارسة تأثيره المثبط. يُقترح أن يتم التوسط في هذا التفاعل عن طريق التفاعلات الكهروستاتيكية بين بقايا الأحماض الأمينية موجبة الشحنة في المجال الموجب للديندروتوكسين والبقايا السالبة الشحنة في مسام القناة الأيونية. يُعتقد أن قنوات البوتاسيوم ، على غرار القنوات الكاتيونية الانتقائية الأخرى ، بها سحابة من الشحنات السالبة التي تسبق الفتحة إلى مسام القناة التي تساعد في توصيل أيونات البوتاسيوم عبر مسار النفاذية. من المعتقد بشكل عام (على الرغم من عدم إثباته) أن جزيئات السموم الشجرية ترتبط بالمواقع الأنيونية بالقرب من السطح خارج الخلية للقناة وتسد المسام جسديًا ، وبالتالي تمنع التوصيل الأيوني. ومع ذلك ، اقترح Imredy و MacKinnon [4] أن دلتا-ديندروتوكسين قد يكون لها موقع ارتباط خارج المركز على البروتينات المستهدفة ، وقد تثبط القناة عن طريق تغيير بنية القناة ، بدلاً من سد المسام جسديًا.

بقايا مهمة بيولوجيا تحرير

حاولت العديد من الدراسات تحديد بقايا الأحماض الأمينية المهمة لربط نشاط dendrotoxins بأهداف قنوات البوتاسيوم الخاصة بهم. هارفي وآخرون. [5] تم استخدام تعديلات خاصة بالبقايا لتحديد البقايا المشحونة إيجابياً والتي كانت ضرورية لنشاط الحجب لـ dendrotoxin-I. لقد أبلغوا أن أستلة Lys5 بالقرب من منطقة N- الطرفية و Lys29 في منطقة بيتا بدوره أدى إلى انخفاض كبير في تقارب ربط DTX-I. تم عرض نتائج مماثلة مع dendrotoxin-K باستخدام الطفرات الموجهة بالموقع لاستبدال بقايا الليسين والأرجينين المشحونة إيجابياً بالألانين المحايدة. لقد أوضحت هذه النتائج ، إلى جانب العديد من النتائج الأخرى ، أن اللايسينات موجبة الشحنة في النصف الطرفي N ، ولا سيما Lys5 في 310الحلزون ، يلعب دورًا مهمًا جدًا في ربط السموم الشجرية بأهداف قناة البوتاسيوم الخاصة بهم. قدمت بقايا اللايسين في منطقة β-turn نتائج أكثر إرباكًا ، ويبدو أنها حرجة من الناحية البيولوجية في بعض متماثلات السموم الشجرية وليست ضرورية للآخرين. علاوة على ذلك ، أدى تحور ثلاثي اللايسين بالكامل (K28-K29-K30) إلى Ala-Ala-Gly في alpha-DTX إلى تغيير ضئيل جدًا في النشاط البيولوجي.

هناك اتفاق عام على أن بقايا اللايسين المحفوظة بالقرب من الطرف N (Lys5 في alpha-DTX) ضرورية للنشاط البيولوجي لجميع dendrotoxins ، في حين أن البقايا الإضافية ، مثل تلك الموجودة في منطقة تحول بيتا ، قد تلعب دورًا في خصوصية السموم الشجرية عن طريق التوسط في تفاعلات السموم الفردية مع المواقع المستهدفة الفردية. هذا لا يساعد فقط في تفسير الخصوصية الصارمة لبعض السموم المتفرعة لأنواع فرعية مختلفة من قنوات K + ذات الجهد الكهربائي ، ولكن أيضًا يفسر الاختلافات في فاعلية السموم الشجرية لقنوات K المشتركة. على سبيل المثال ، Wang et al. [6] أظهر تفاعل dendrotoxin-K مع K.الخامس1.1 يتم التوسط من خلال بقايا اللايسين في كل من الطرف N ومنطقة β-turn ، بينما يبدو أن alpha-dendrotoxin يتفاعل مع هدفه فقط من خلال الطرف N. قد يساعد هذا المجال التفاعلي الأقل اتساعًا في تفسير سبب كون alpha-dendrotoxin أقل تمييزًا بينما يكون dendrotoxin-K انتقائيًا بشكل صارم لـ Kالخامس1.1.

تعرض قنوات البوتاسيوم للخلايا العصبية الفقارية درجة عالية من التنوع الذي يسمح للخلايا العصبية بضبط خصائص الإشارات الكهربائية بدقة من خلال التعبير عن مجموعات مختلفة من الوحدات الفرعية لقناة البوتاسيوم. علاوة على ذلك ، نظرًا لأنها تنظم التدفق الأيوني عبر الأغشية البيولوجية ، فهي مهمة في العديد من جوانب التنظيم الخلوي ونقل الإشارات لأنواع الخلايا المختلفة. لذلك ، فإن قنوات البوتاسيوم ذات الجهد الكهربائي هي أهداف لمجموعة واسعة من السموم البيولوجية القوية من الكائنات الحية مثل الثعابين والعقارب وشقائق النعمان البحرية والقواقع المخروطية. وهكذا ، أدت تنقية السم إلى عزل السموم الببتيدية مثل السموم الشجرية ، والتي أصبحت أدوات دوائية مفيدة لدراسة قنوات البوتاسيوم. بسبب قوتها وانتقائها لأنواع فرعية مختلفة من قنوات البوتاسيوم ، أصبحت السموم المتشابكة مفيدة كمجسات جزيئية للدراسة الهيكلية والوظيفية لهذه البروتينات. قد يساعد ذلك في تحسين فهمنا للأدوار التي تؤديها أنواع القنوات الفردية ، فضلاً عن المساعدة في التصنيف الدوائي لأنواع القنوات المتنوعة هذه. [7] علاوة على ذلك ، توفر السموم المتفرعة الموسومة إشعاعيًا أداة لفحص المصادر الأخرى في البحث عن سموم قناة البوتاسيوم الجديدة ، مثل فئة kalicludine من سموم قناة البوتاسيوم في شقائق النعمان البحرية. أخيرًا ، قد توفر المعلومات الهيكلية التي توفرها السموم الشجرية أدلة على تخليق المركبات العلاجية التي قد تستهدف فئات معينة من قنوات البوتاسيوم. تم استخدام Dendrotoxin I أيضًا للمساعدة في تنقية وتوصيف بروتين قناة K + الذي يرتبط به عبر تقنيات مختلفة لفحص الارتباط والكروماتوغرافيا. [8]


بطاقة توكس: تأثيرات أدوية القلب والأوعية الدموية على إمكانات العمل وتخطيط القلب

Authors: Todd Duppong, MD (PGY2, Emergency Medicine Residency Program, Morristown Medical Center), Cynthia Santos, MD (Assistant Professor Emergency Medicine, Medical Toxicology, Rutgers NJMS) // Edited by: Alex Koyfman, MD (@EMHighAK, EM Attending Physician, UTSW / Parkland Memorial Hospital), and Brit Long, MD (@long_brit, EM Attending Physician, San Antonio Military Medical Center)

A 35 year old lady intentionally overdosed on her prescription medication for fibromyalgia and recent diagnosis of depression. ECG shows sinus tachycardia (rate of 150), QRS ≥120 ms, and R wave elevation in aVR ≥3 mm. What are the action potential phases responsible for ECG changes? What ECG changes are associated with cardiotoxicity? Which medications cause changes in action potential/ECGs?

خلفية:

An electrocardiogram (ECG) is a rapid diagnostic tool frequently used for evaluation because of the predictable cardiotoxic effects from specific drugs. Serial ECGs should be performed in addition to a good history, physical examination, and evaluation of clinical findings/toxidrome to guide course and treatment.

Figure 1: Represents ECG and time associated action potential phases.[1]


Potassium Channel Blockers (Class III Antiarrhythmics)

The main drug is amiodarone, which is most commonly used as antiarrhythmic. It is effective in a wide range of arrhythmias.

Chemical Nature

Resemble thyroxine, having properties of class 1, II and IV drugs.

آلية العمل

It mainly acts by blocking K+ channels. It increases the refractory period. It increases the duration without effecting phase 0 and resting membrane potential.

There are two types of K+ channels:

Inward potassium current or rectifier also called delayed potassium currents. 2 components are:

The drug acts mainly by blocking IKr. Chronic administration also affects I ك , It كتل K+ channels. Also have some effects on alpha and beta receptors, blocking them non-competitively, having a small effect.

الدوائية

Drug is rapidly absorbed after oral route of administration. It has high volume of distribution (greater tissue binding). Since it is highly lipid soluble, it tends to deposit in the tissues, especially adipose tissue. It is metabolized in the liver and excreted in bile. It is slowly released from the tissue binding sites. Half life is longer (about 30 days, may even be up to 100 days).

الاستخدامات
  1. Drug has broad antiarrhythmic effect (esp. ventricular arrhythmias)
  2. Supraventricular arrhythmias
  3. Reentrant tachycardia –as prolongs refractory period.
Adverse Effects

Since the drug causes prolongation of refractory period

  1. QT interval is prolonged
  2. Because of resemblance with thyroxine, drug may interfere with functions of thyroid, causing hypo or hyperthyroidism.
  3. As has greater Vd, it gets bound and deposited in cornea, leading to visual problems and photophobia.
  4. Has tendency to deposit in skin, may sensitize it to sunlight. Bluish discoloration occurs on exposed parts on prolonged administration (due to iodine content).
  5. On prolonged administration pulmonary fibrosis might occur
  6. Hepatic damage might occur as is metabolized in the liver.
تفاعل الأدوية
  1. With digoxin, plasma conc. of digoxin increases
  2. Warfarin, similar to digoxin
  3. With beta blockers and Ca++ channel blockers –both cause depression of heart, causing hypotension and bradycardia.
جرعة

Start at loading dose, first given 200 mg for 1 week (twice daily). Maintenance dose is 200 mg once daily.

Bretylium

Bretylium is adrenergic neuron blocker and sympatholytic drug. It acts by inhibiting release of NE from adrenergic nerve terminals. It is mainly used for treatment of refractory ventricular arrhythmias esp. after MI and during surgery.

Sotalol

Sotalol is a beta blocker with class III properties. It prolongs the refractory period and action potential. It is commonly used.


شاهد الفيديو: Calcium channel blockers الية عملها أثارها الجانبية Hypertension 3. (ديسمبر 2022).