
معنى "بادئات IL-2" في مقال علمي


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

من مقال ("تحسين التهاب الدماغ والنخاع المناعي الذاتي التجريبي في فئران لويس بواسطة علاج FTY720" ، 2003):

أجرينا تضخيم PCR في خليط تفاعل 100 ميكرولتر يحتوي على 200 ميكرومتر من كل من dNTPs العادي ، و 10 pmol من كل تمهيدي ، و 2.5 U من TaqDNA polymerase (TaKaRa) باستخدام الاشعال IL-2 (300 زوج أساسي ؛ bp) ، 5'-CAGCTGTTGCT GGACTTACAGG-3 'و 5'-CACAGTTGATGGCTCATCATCG-3' ؛ IL-6 (294 نقطة أساس) ، 5'-GACTTCACAGAGGATACCC-3 'و 5'-TAAGTTGTCTTCACAAACTCC-3' ؛ INF-γ (310 نقطة أساس) و 5'-GGATATCTGAGGAACTGGCAAAAG-3 'و 5'-GCTAGATT CTGGTGACAGCTGGTG-3' ؛ β-actin (461 نقطة أساس) 5'-CATCGTGGGCCGCTCTAGGCA-3 'و 5'-CCGGCCAGCCAAGTCCAGACGC-3'.

لست متأكدًا تمامًا: هل يقصدون أن البادئات "خاصة بجين IL-2"؟

هل يقصدون أن "5'-CAGCTGTGCT GGACTTACAGG-3 'و 5'-CACAGTTGATGGCTCATCATCG-3' عبارة عن بادئات خاصة بجين IL-2"؟

من الوصف ، نعم ، من المفترض أن تكون تلك البادئات خاصة بجين IL-2. الطريقة التي سيتم استخدامها بها ستكون على الرنا المرسال ، وليس الحمض النووي ، لذلك يمكنك استخدامها لتحديد مستوى نسخ IL-2. ومع ذلك ، يبدو أن هناك بعض الخلل ، لأنه في حين أن التسلسل الأول (5'-CAGCTGTGCT GGACTTACAGG-3 ') يطابق الجرذ IL-2 mRNA بدءًا من 120 في التسلسل ، فإن الثاني (CACAGTTGATGGCTCATCATCG) لا يتطابق مع أي IL-2 mRNA. -2 ؛ لا يؤدي بحث BLAST إلا إلى ظهور التطابقات العشوائية وغير ذات الصلة.

قد يكون هذا خطأ في الورق (نسخ ولصق التمهيدي الخاطئ ، وهو أمر شائع للغاية ، للأسف) ؛ ربما كان خطأ في التصميم (استخدم شخص ما التمهيدي الخطأ وحصل على نتائج محظوظة بدت مطابقة لما يتوقعه) ؛ أو ربما أرتكب شيئًا خاطئًا ، ولن أحاول تحرّي الخلل وإصلاحه أكثر من ذلك.

(يحرر، كما يشيرVonBeche في التعليقات ، فإن التمهيدي العكسي يكاد يكون مطابقًا عند 398 ، مع عدم تطابق أحادي النوكليوتيد الذي أفسد بحثي - ربما متغير أليلي ، ولكن ربما يكون خطأ بنفس القدر)

شاهد الفيديو: 35 البادئات: Prefixes المقاطع التي تسبق الكلمة (ديسمبر 2022).