معلومة

التغلب على اكتئاب زواج الأقارب

التغلب على اكتئاب زواج الأقارب


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

عندما يحدث اكتئاب زواج الأقارب ، يتم تزاوج فرد غير مرتبط وراثيًا بالحيوان لإدخال التباين الجيني وإزالة الزيجوت المتماثل. في هذه الحالة ، يمكن إجراء التهجين الخارجي أو التهجين. هل هناك أي تفضيل لأي من الأسلوبين على الآخر؟ يشير التكاثر الخارجي هنا إلى التزاوج بين فردين من نفس السلالة ، ولكن لا يوجد أسلاف مشتركة حديثة. يشير التهجين المتصالب إلى التزاوج بين فردين من سلالات مختلفة تمامًا.


يمكن التغلب على اكتئاب زواج الأقارب بالطرق التالية: 1. التربية الخارجية - تربية الحيوانات التي لا علاقة لها ببعضها البعض والتي لم يأت لها أسلاف منذ 4-6 أجيال 2. التهجين الخارجي يتم مع الحيوانات أو نفس السلالة ولكن بعد 4-6 أجيال 3. التكاثر المتصالب - ذكر متفوق يتزاوج مع أنثى متفوقة من سلالة أخرى 4. التهجين بين الأنواع - ذكور وإناث حيوان من نوعين مختلفين مرتبطين


الأساس الجيني لاكتئاب زواج الأقارب في البطاطس

يؤدي اكتئاب زواج الأقارب إلى انخفاض اللياقة بين نسل الأقارب الجيني. تعاني البطاطس (Solanum tuberosum L.) من اكتئاب شديد في التكاثر الداخلي ، باعتبارها محصولًا مكررًا نسليًا ، ومع ذلك ، فإن الأساس الجيني لاكتئاب زواج الأقارب في البطاطس غير معروف إلى حد كبير. لاكتساب نظرة ثاقبة على اكتئاب زواج الأقارب في البطاطس ، قمنا بتقييم عبء الطفرة في 151 بطاطس ثنائية الصبغيات وحصلنا على 344،831 بدائل ضارة متوقعة. يتم إثراء الطفرات الضارة في البطاطس في المناطق المحيطة بالمركز وتكون محددة بالخط. باستخدام ثلاثة F.2 السكان ، حددنا 15 منطقة جينومية مع تشوهات شديدة في الفصل بسبب الاختيار في المرحلتين المشيجية واللاقحة. تقع معظم الأليلات المتنحية الضارة التي تؤثر على البقاء على قيد الحياة وحيوية النمو في مناطق ذات معدلات إعادة تركيب عالية. يشتق أحد هذه الأليلات الضارة من طفرة نادرة تعطل الجين المطلوب لتطور الجنين. توفر هذه الدراسة الأساس لتصميم جينوم سلالات البطاطس الفطرية.


التغلب على اكتئاب زواج الأقارب - علم الأحياء

في عدد قليل من السكان ، يكون التزاوج بين الأقارب أمرًا شائعًا. قد يقلل زواج الأقارب من قدرة السكان على البقاء والتكاثر ، وهي ظاهرة تسمى اكتئاب الأقارب. على سبيل المثال ، يبلغ عدد سكانها 40 فردًا (Vipera berus، كما هو موضح على اليمين) عانوا من اكتئاب زواج الأقارب عندما عزلتهم الأنشطة الزراعية في السويد عن مجموعات الأفعى الأخرى. وُلدت نسب أعلى من النسل المولود ميتًا والمشوه في السكان المعزولين مقارنةً بالسكان الأكبر. عندما قدم الباحثون آفات من مجموعات سكانية أخرى & # 151 مثالاً على التزاوج الخارجي & # 151 ، تعافى السكان المعزولون وأنتجوا نسبة أعلى من النسل القابل للحياة.

يكمن تفسير اكتئاب الأقارب في التاريخ التطوري للسكان. بمرور الوقت ، يعمل الانتقاء الطبيعي على التخلص من الأليلات الضارة من السكان & # 151 عندما يتم التعبير عن الأليلات الضارة السائدة ، فإنها تقلل من لياقة الناقل ، وينتهي الأمر بعدد أقل من النسخ في الجيل التالي. لكن الأليلات الضارة المتنحية "مخفية" عن الانتقاء الطبيعي عن طريق نظيراتها السائدة غير الضارة. سيكون الفرد الذي يحمل أليلًا ضارًا متنحيًا واحدًا يتمتع بصحة جيدة ويمكنه بسهولة نقل الأليل الضار إلى الجيل التالي.

عندما يكون عدد السكان كبيرًا ، فهذه ليست مشكلة بشكل عام & # 151 قد يحمل السكان العديد من الأليلات الضارة المتنحية ، لكن نادرًا ما يتم التعبير عنها. ومع ذلك ، عندما يصبح عدد السكان صغيراً ، ينتهي الأمر بالأقارب المقربين بالتزاوج مع بعضهم البعض ، ومن المحتمل أن يحمل هؤلاء الأقارب نفس الأليلات الضارة المتنحية. عندما يتزاوج الأقارب ، قد يرث النسل اثنين نسخ من نفس الأليل الضار المتنحي وتعاني من عواقب التعبير عن الأليل الضار ، كما هو موضح في المثال أدناه. في حالة الإدمان السويديين ، كان هذا يعني نسل ميت وتشوهات.

بالنسبة إلى الإضافات السويدية ، كان الحل لمشكلة اكتئاب الأقارب بسيطًا & # 151 إنتاج إضافات من مجموعات سكانية أخرى. ولكن إذا كان حيوان الومبت الشمالي ذو الأنف المشعر يعاني من اكتئاب زواج الأقارب ، فلا توجد مجموعات أخرى يمكن أن تنقذه. إن فهم التاريخ التطوري للسكان واحتمالية حمله لأليلات ضارة متنحية ، يشير إلى أنه لا ينبغي أن نسمح لأحجام السكان بالانخفاض الشديد في جهود الحفظ التي نبذلها ، أو قد يؤدي اكتئاب الأقارب إلى تعريض بقاء الأنواع للخطر.


الجوانب السلبية لممارسة التربية

نيهار رانجان تشاتوبادياي ، في تربية الأسماك المستحثة ، 2017

5.3.12 الانقراض المحلي في ظل وجود الهجرة

عادة ما يتم تقليل اكتئاب زواج الأقارب من قبل المهاجرين غير المتجانسين للطفرات المتنحية الضارة (ويتلوك وآخرون ، 2000) ، ومن خلال التغاير ، يمكن تحسين اللياقة البدنية للسكان. ومع ذلك ، يمكن أن يقلل التهجين من متوسط ​​لياقة السكان إذا أدى التهجين إلى تعطيل المجمعات الجينية المتكيفة أو التفاعلات المعرفية المواتية (اكتئاب التزاوج الخارجي). أظهرت دراسات قليلة اكتئاب التزاوج الخارجي لأنه يتطلب تتبع ما بعده Fجيل واحد. أظهرت دراسة أجريت على عصافير الغناء (مار وآخرون ، 2002) ، علامات اكتئاب التزاوج الخارجي في Fالجيل الثاني ، وكانت مقاييس اللياقة منخفضة في F2 جيل من الصلبان من مجدافيات المد والجزر (Tigriopus californium) من مجموعات سكانية مختلفة (بيرتون ، 1990). ومع ذلك ، لا يتم تضخيم تأثير تفكيك عمليات التكيف إلا إذا زادت المسافة الجينية بين المجموعتين بشكل كبير (Edmands ، 1999). وبالتالي ، قد لا يكون خطر التزاوج الخارجي خطيرًا جدًا في معظم التجمعات البرية نظرًا لأن الأمر يستغرق أجيالًا عديدة في بيئات متباينة حتى تكون المسافة الجينية كبيرة بشكل ملحوظ.

يعتمد تقليل أو زيادة اللياقة البدنية لدى السكان بعد استقبال المهاجرين أيضًا على التفاعلات بين العديد من العوامل الوراثية وغير الجينية (درجة النزف ، الديموغرافيا ، السلوك ، البيئة ، إلخ. Tallmon et al. ، 2004). لذلك قد يكون من الصعب التنبؤ بما إذا كان أي حدث هجرة معين سيؤثر على الإنقاذ الجيني ، خاصة عندما يفتقر مديرو الحفظ إلى فهم التفاعلات بين العوامل الوراثية وغير الجينية. ومع ذلك ، قام Gaggiotti (2003) بمراجعة الدراسات التي أجريت على نباتات مثل لوتس سكوباريوس, مجموع Ipomopsis، و سيلين diclinis وخلصت إلى أن اكتئاب التزاوج الخارجي قد يكون شائعًا في البرية ولكن الفوائد المحتملة للتزاوج الخارجي عادة ما تفوق تهديدات الاكتئاب.


بوتلينكس

استندت جميع التوصيات التي تم تقديمها في القسم السابق إلى الحفاظ على الحد الأدنى الثابت Nه'س. لسوء الحظ ، من الصعب الحفاظ على ثابت Nه جيل بعد جيل. يعرف أي شخص سبق له إدارة مجموعة من الأسماك جيدًا أنه من الصعب الحفاظ على حالة ثابتة من السكان. تتآمر العديد من العوامل لتقليل حجم السكان في بعض الأحيان. يُطلق على الانخفاض الحاد المفاجئ في حجم السكان اسم & ldquobottlenecks. & rdquo يمكن أن تكون الآثار الجينية للاختناقات مدمرة ويمكن أن يكون لها تداعيات طويلة المدى.

كما تم وصفه في الفصل 4 ، يعني Nه على مدى سلسلة من الأجيال هو الوسط التوافقي ، وليس المتوسط ​​الحسابي البسيط. وبالتالي ، فإن الجيل مع أصغر Nه له تأثير غير متناسب على متوسط ​​القيمة. هذا يعني أن عنق الزجاجة يمكن أن يقلل بشكل كبير يعني Nه، والذي بدوره سيزيد بشكل كبير من زواج الأقارب والانجراف الوراثي.

على سبيل المثال ، إذا أراد مزارع الحفاظ على قيمة N ثابتةه من 100 لمدة 10 أجيال ولكنها تواجه عنق الزجاجة 20 في الجيل 6 ، المتوسط ​​Nه الذي أنتجه هو:

نه يعني يمكن تحديده باستخدام الزر & ldquo1 / x & rdquo على آلة حاسبة محمولة باليد.

المتوسط ​​الحسابي لهذه السلسلة من Nههو 92 ، لذا يعني Nه هو 22٪ أصغر مما هو متوقع. إذا كان هناك اثنين من الاختناقات من 20 ، يعني Nه قد ينخفض ​​إلى 55.6 فقط.

يمكن أن يكون للاختناقات تأثيرات شديدة وطويلة الأمد على زواج الأقارب ، لأنه بمجرد حدوث زواج الأقارب ، فإنه يقلل من N في المستقبل.هكما تم وصفه في الفصل 4. يعتمد تأثير الاختناقات في المتوسط ​​على زواج الأقارب على حجم عنق الزجاجة وعددها. إن السكان الذين تتم إدارتهم بشكل سيئ ويعانون من اختناقات متعددة حيث يتم تقليل عدد السكان إلى عدد قليل نسبيًا من الذكور و / أو الإناث ، سيتم تكاثرهم تمامًا. من ناحية أخرى ، فإن السكان الذين تتم إدارتهم بشكل جيد والذين يواجهون عنق زجاجة واحد سيكونون أقل تأثراً بكثير. سيؤدي الاختناق الفردي إلى زيادة فورية في زواج الأقارب وقد يزيد متوسط ​​زواج الأقارب لجيل أو جيلين (يعتمد المبلغ على حجم عنق الزجاجة) ، ولكن إذا تمت إدارة السكان بشكل صحيح لتقليل زواج الأقارب قبل وبعد عنق الزجاجة ، متوسط ​​زواج الأقارب سوف يستقر بعد أجيال قليلة من عنق الزجاجة ، وقد لا يكون الضرر الناجم عن زواج الأقارب شديدًا.

الشكل 32. آثار الاختناقات على تواتر الجينات. منذ الانجراف الجيني واحتمال فقدان الأليلات يرتبطان عكسياً بعدد التكاثر الفعال (Nه) ، فإن حجم عنق الزجاجة يحدد مقدار التغيير الجيني. ترددات ال أ و أ الأليلات في السكان كلاهما 0.5. مثل عنق الزجاجة (N.ه) يصبح أصغر ، فإن الانجراف الجيني يغير تواتر الجينات حتى يصل تردد الأليل إلى الصفر.

الآثار التي يمكن أن تحدثها الاختناقات على الانجراف الجيني أكثر تدميراً بكثير. يرتبط احتمال فقدان الأليل عكسيًا بـ Nه، لذا فإن احتمالات فقدان الأليل تزداد مثل Nه النقصان. الاختناقات تزيد من الاحتمالية بشكل كبير. يوضح الشكل 32 تأثير عنق الزجاجة على تردد الجينات.

على سبيل المثال ، إذا كان المزارع يحاول الحفاظ على قيمة N ثابتةه من 344 لمدة 10 أجيال من أجل إنتاج ضمان بنسبة 99٪ للاحتفاظ بأليل تردده 0.01 (الجدول 5) وهناك عنق زجاجة 25 في الجيل 8 ، واحتمال فقدان الأليل عند إنتاج الجيل العاشر هو تحدد على النحو التالي:

الخطوة 1. يجب تحديد احتمالية فقدان الأليل لكل جيل.

الخطوة الثانية: يجب تحديد ضمان الحفاظ على الأليل لكل جيل (1.0 - احتمال فقدان الأليل).

احتمالات فقدان الأليل وضمانات حفظ الأليل لجميع الأجيال العشرة هي:

نهالخطوة 1: احتمال فقدان الأليلالخطوة الثانية: ضمان حفظ الأليل
(P = (1.0 - q) 2Nه )(1.0 - ف)
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
25 ف = (0.99) 2 (25) = 0.6050060670.394993932
344 ف = (0.99) 2 (344) = 0.00099314770.999006852
344 ف = (0.99) 2 (344) = 0.00099314770.999006852

الخطوة 3. يجب تحديد ضمان الحفاظ على الأليل لمدة 10 أجيال. إنه نتاج ضمان الاحتفاظ بالأليل لكل جيل ، أي أن الضمانات لكل جيل تتضاعف لتحديد الضمان بعد إنتاج الجيل العاشر:

ضمان بعد 10 أجيال=(0.999006852)(0.999006852)(0.999006852)(0.999006852)
(0.999006852)(0.999006852)(0.999006852)(0.394993932)
(0.999006852)(0.999006852)
ضمان بعد 10 أجيال=0.3915

الخطوة 4. يجب تحديد احتمال فقدان الأليل بعد 10 أجيال. 1.0 - ضمان الحفاظ على الأليل:

احتمال فقدان الأليل = 1.0 - ضمان الاحتفاظ بالأليل

احتمال فقدان الأليل = 1.0 - 0.3915

احتمال فقدان الأليل = 0.6085

أدى الاختناق البالغ 25 عند الجيل 8 إلى زيادة احتمال فقدان الأليل في الجيل العاشر من 0.01 (وهو الهدف) إلى 0.6085.

التأثير الإجمالي لعنق الزجاجة الفردي على الانجراف الجيني أكثر خطورة بكثير مما هو عليه في المتوسط ​​من زواج الأقارب ، ويمكن أن يمنع حدوثه المزارع أو مدير المفرخ من تحقيق أهدافه ، حتى لو قام بعمل رائع لعدة أجيال. هذا لأنه بمجرد فقدان الأليل ، لا يمكن استعادته إلا عن طريق الطفرة أو إدخال مخزون حضنة جديد. وبالتالي ، يجب أن يكون منع الاختناقات هو الهدف الرئيسي لإدارة مخزون الحضنة إذا كان الهدف الجيني هو تقليل الآثار الضارة لتزاوج الأقارب والانجراف الجيني.


عندما تتكاثر الحياة البرية المهددة بالانقراض

أصبحت مجموعات غوريلا الأراضي المنخفضة الشرقية المهددة بالانقراض صغيرة جدًا لدرجة أن الأنواع تواجه تهديدًا جديدًا: فقدان التنوع الجيني.

لا تستطيع الغوريلا أخذ قسط من الراحة. في مواجهة فقدان الموائل ، والصيد الجائر ، وعدم الاستقرار السياسي ، والتهديدات الأخرى ، انخفض عدد السكان. تواجه بعض غوريلا السهول الشرقية ، المعزولة الآن في مجموعات صغيرة ، تهديدًا جديدًا: فقدان التنوع الجيني. مع تقلص عدد السكان ، غالبًا ما يتقلص تجمع الجينات أيضًا. إذا كان الانخفاض شديدًا بدرجة كافية ، فقد يهدد زواج الأقارب بقاء النوع.

يُطلق على الانخفاض في قدرة السكان على البقاء على قيد الحياة من خلال زواج الأقارب اسم اكتئاب الأقارب. ولكن كما ناقش علماء الأحياء فيليب هيدريك وستيفن كالينوفسكي في المراجعات السنوية، يأخذ اكتئاب الأقارب أشكالًا مختلفة في ظل ظروف مختلفة. ليس من السهل تعميم تأثيره على البقاء. بالنسبة للأنواع طويلة العمر مثل الغوريلا ، قد تستغرق التأثيرات الإجمالية لتزاوج الأقارب عقودًا لتظهر ويصعب دراستها.

غالبًا ما تتم دراسة زواج الأقارب في المختبر باستخدام كائنات حية مثل ذبابة الفاكهة (ذبابة الفاكهة) ، حيث يمكن تربية مجموعة صغيرة وفحصها على مدى أجيال متعددة. في مثل هذه الدراسات ، مع زيادة زواج الأقارب ، تصبح الطفرات الضارة عادة أكثر وأكثر تركيزًا في السكان من خلال عملية تسمى كشف القناع ، مما يعرض للخطر اللياقة العامة للسكان. عندما يصبح عدد السكان أصغر بشكل متزايد وأكثر تزاوجًا ، تصبح الحالات الوراثية الضارة أكثر شيوعًا.

بالطبع ، لا تعمل الجينات بمعزل عن غيرها. التفاعل بين الجينات والبيئة أمر بالغ الأهمية. في بعض الحالات ، قد يجعل هذا اكتئاب الأقارب نقطة خلافية للأنواع المهددة بالانقراض ، لأن التهديدات الخارجية مثل فقدان الموائل قد تهدد بالانقراض قبل أن يتسبب اكتئاب الأقارب في خسائر فادحة. لسوء الحظ ، تعيش الأنواع المهددة بشدة عادة في بيئات مرهقة. بعبارة أخرى ، قد يكون وضعهم في العالم الحقيقي أسوأ مما تتنبأ به النماذج ، ويواجه السكان الفطريون احتمالًا أقل للبقاء على قيد الحياة من السكان الأصحاء.

علاوة على ذلك ، فإن عددًا صغيرًا من الأنواع في البرية يختلف عن مجموعة صغيرة بشكل مصطنع في المختبر. إن مجموعة ذبابة الفاكهة في المختبر ، على سبيل المثال ، هي عينة من كل التنوع الجيني الهائل المتاح لذبابة الفاكهة. بالنسبة لمجموعة صغيرة من السكان المهددة بالانقراض فعليًا ، يكون التنوع الجيني الإجمالي منخفضًا وأيًا كان التنوع الجيني الذي يحدث في عدد السكان المنخفض ، فكل ما هو موجود ، وهو وضع يسمى عنق الزجاجة. في بعض الأحيان يؤدي ذلك إلى انتشار الطفرات الخطيرة - ويمكن أن يهدد ذلك بشكل مباشر بالانقراض.

احصل على النشرة الإخبارية لدينا

كل جين له متغيرات مختلفة ، تسمى الأليلات ، والتي تنشأ من خلال الطفرة. قد يمنح أحد أليل الجين منفعة ، لكن قد يتسبب أليل مختلف لنفس الجين في حدوث ضرر. في عنق الزجاجة ، تكون معظم الأليلات المختلفة ، بما في ذلك الأليلات الضارة ، غير شائعة. في بعض الأحيان يتم الكشف عن أليل قاتل ويظهر في شخص ما ، مما يؤدي إلى قتل ذلك الفرد أو منع التكاثر. نظرًا لأن الأليل الضار نادر في البداية ، فإن هذه النتيجة تزيل تلك الأليلات الضارة من السكان. في مثل هذه الحالات ، يؤدي زواج الأقارب إلى تسريع فقدان الأليلات الخطرة ، والتي قد تكون مفيدة على الأقل مؤقتًا. من ناحية أخرى ، يمكن بسهولة إصلاح الأليلات الضارة ولكن غير المدمرة في مجموعات صغيرة ، مما يقلل من اللياقة البدنية بمرور الوقت.

الخبر السار هو أنه في بعض الأحيان يمكن تخفيف زواج الأقارب أو حتى عكسه عن طريق الإدخال الدقيق للجينات. قد يعني هذا إعادة إدخال الأفراد المولودين في الأسر ، أو النقل الانتقائي بين المجموعات المعزولة. تأتي مثل هذه الإجراءات بحد ذاتها مع مخاطر ، ولكن إذا كان زواج الأقارب مؤلمًا بدرجة كافية ، فقد يكون من الضروري اتخاذ إجراءات صارمة.


نتائج

التنميط الجيني والتضمين

تم إجراء التنميط الجيني لجميع أفراد الدراسة على اختبار Illumina Ovine SNP50 BeadChip بمقايسة 51135 SNPs. بالإضافة إلى ذلك ، تم التنميط الجيني 189 فردًا على شريحة Ovine Infinium عالية الكثافة التي تحتوي على 606066 SNPs. لزيادة الدقة الجينية لتحليلاتنا ، قمنا بدمج الأنماط الجينية الجسدية من كل من رقائق SNP مع معلومات النسب لإسناد SNPs المفقودة في الأفراد الذين تم تنميطهم الجيني بكثافة أقل باستخدام AlphaImpute 56. أظهر التحقق المتقاطع أن التضمين كان ناجحًا ، بمتوسط ​​99.3 ٪ من الأنماط الجينية المنسوبة بشكل صحيح لكل فرد (الجدول التكميلي 1). علاوة على ذلك ، معاملات زواج الأقارب المستنتج FROH كانت متشابهة جدًا عند مقارنة الأفراد الذين تم تنميطهم الجيني على شريحة عالية الكثافة (متوسط FROH = 0.239) والأفراد الذين يعانون من تعدد الأشكال (متوسط FROH = 0.241) ، مما يشير إلى عدم وجود تحيز واضح في وفرة ROH المستنتج بناءً على البيانات المحسوبة (الشكل التكميلي 1). بعد مراقبة الجودة ، احتوت مجموعة البيانات الجينومية على 417373 تعدد الأشكال والنيوكليوتيدات الصبغي الجسدي مع متوسط ​​تردد أليل ثانوي (MAF) يبلغ 23 ٪ (الشكل التكميلي 2) ومعدل استدعاء متوسط ​​99.5 ٪ عبر الأفراد.

أنماط زواج الأقارب في الجينوم

اكتشفنا أولاً كيفية زواج الأقارب وحجم السكان الصغير على المدى الطويل (تقديري نه = 194 57) على شكل أنماط ROH في أغنام Soay (الشكل 1). كان لدى الأفراد متوسط ​​194 ROH (sd = 11.6) أطول من 1.2 ميجا بايت ، والتي شكلت في المتوسط ​​24 ٪ من الجينوم الجسدي (أي متوسط FROH = 0.24 ، النطاق = 0.18-0.50 ، الشكل التكميلي 3). معامل زواج الأقارب المتوسط FROH من الأغنام المولودة في سنة معينة ظلت ثابتة على مدار فترة الدراسة (الشكل التكميلي 4). من بين الاختلافات الفردية في طول ROH كان مرتفعًا: متوسط ​​ROH في الخراف السبعة الأكثر توالد كان أكثر من ضعف طول ROH في الخراف السبعة الأقل تربية (6.83 مقابل 2.72 ميجا بايت ، على التوالي الشكل 1 أ) على الرغم من متوسط ​​عدد ROH كان مشابهًا (170 مقابل 169 ، على التوالي).

أ ROH أطول من 5 ميغا بايت في الأفراد السبعة ذوي أعلى معاملات زواج الأقارب FROH في الصفوف السبعة العليا والأفراد السبعة الأقل FROH في الصفوف السبعة السفلية. ب توزيع ROH بين فئات الطول المختلفة. تمثل كل نقطة بيانات نسبة ROH لفئة طول معينة داخل جينوم جسمي للفرد. تم تصنيف فئات طول ROH من خلال متوسط ​​الطول المادي المتوقع عندما يكون للأنماط الفردانية الأساسية سلف مشترك حديث (MRCA) من 2 إلى 32 جيلًا (ز) قبل. ج كثافة ROH على مستوى الجينوم بين جميع الأفراد البالغ عددهم 5952 فردًا في نوافذ غير متداخلة 500 كيلو بايت. تم قياس التدرج اللوني وفقًا لكثافة ROH ، والتي تظهر في وسيلة إيضاح الشكل.

تباينت وفرة ROH في أغنام Soay أيضًا بشكل كبير بين فئات طول ROH (الشكل 1 ب). يتكون الجزء الأكبر من IBD في السكان من ROH بين 2.4 و 4.9 ميجا بايت نشأت منذ حوالي 8-16 جيلًا ، والتي شكلت 8.1 ٪ من جينوم الفرد في المتوسط. تم العثور على Long ROH & gt 19.5 ميجا بايت في 38.2 ٪ من الأفراد (الشكل 1 ب). ومع ذلك ، فإن ROH الطويلة تشكل في المتوسط ​​0.6٪ فقط من جينوم الأفراد الأقل توالدًا مع نسب زواج الأقارب Fبيد & lt 0.1. في المقابل ، امتد ROH الطويل لأكثر من 7٪ و 18٪ من الجينوم في الأفراد الفطريين Fبيد & GT 0.1 و Fبيد & gt 0.2 ، على التوالي (الشكل التكميلي 5).

تباين تواتر ROH في السكان بشكل كبير عبر الجينوم (الشكل 1 ج). قمنا بمسح ROH في نوافذ غير متداخلة بسعة 500 كيلو بايت ، وصنفنا النوافذ بنسبة 0.5٪ بأعلى كثافة من ROH كجزر ROH والنوافذ بنسبة 0.5٪ بأقل كثافة من ROH مثل صحارى ROH 31. احتوت أعلى جزيرة ROH على الكروموسوم 1 (227-227.5 ميجا بايت) على ROH في 87 ٪ من الأفراد ، بينما كان لدى 4.4 ٪ فقط من الأفراد ROH في أعلى صحراء ROH على الكروموسوم 11 (58.5-59 ميجا بايت ، انظر الجدول التكميلي 2 للحصول على a قائمة أفضل الصحارى والجزر ROH).

كثافة ROH ومعدل إعادة التركيب

يمكن تفسير التباين الواسع في كثافة ROH على طول الجينوم جزئيًا عن طريق إعادة التركيب لأن المناطق ذات معدل إعادة التركيب العالي تنتج ROH أقصر ، ويقل احتمال اكتشافها بواسطة خوارزميات استدعاء ROH 30. والجدير بالذكر أن إعادة التركيب في حد ذاته لا يؤثر على النسبة الحقيقية الأساسية لـ IBD ، ولكنه يؤثر فقط على توزيع طول ROH. وبالتالي ، يمكن للمناطق ذات إعادة التركيب العالية أن تخلق صحارى ROH مفترضة دون تغيير في المستويات الحقيقية لـ IBD ، لأنه من غير المرجح أن يتم استدعاء ROH القصير 30. لتقييم مقدار التباين في كثافة ROH على طول الجينوم الذي يرجع إلى اختلاف معدل إعادة التركيب ومدى تتبع المستويات الأساسية لـ IBD ، قمنا ببناء نموذج مختلط خطي بكثافة ROH (نسبة الأفراد الذين لديهم ROH) مقاسة بـ 500 كيلو بايت windows كمتغير استجابة ، معدل إعادة تركيب النافذة في cM / Mb استنادًا إلى خريطة ربط Soay sheep 58 ونافذة SNP غير المتجانسة كتأثيرات ثابتة بالإضافة إلى معرف كروموسوم كتأثير عشوائي.

أوضح معدل إعادة التركيب وعدم تجانس الزيجوت معًا 42 ٪ من التباين في كثافة ROH (هامشي ر 2 = 0.42 ، 95٪ CI [0.40 ، 0.44] ، الجدول التكميلي 3 أ) ، مع غالبية التباين موضح بواسطة تغاير الزيجوت (شبه جزئي ر 2 = 0.38، 95٪ CI [0.36، 0.40]، الشكل 2 ب) وحوالي 4٪ فقط مفسرة بمعدل إعادة التركيب (شبه جزئي ر 2 = 0.04 ، 95٪ CI [0.02 ، 0.07] ، الشكل 2 أ والشكل التكميلي 6 لمؤامرة كروموسوم). يتشابه النمط عند إعادة تشغيل النموذج فقط على النوافذ التي تم تحديدها على أنها جزر وصحاري ROH ، حيث يتم تفسير كثافة ROH إلى حد كبير من خلال تغاير الزيجوت (شبه جزئي ر 2 = 0.89 ، فاصل الثقة 95٪ [0.83 ، 0.94] ، الشكل 2 د) ، مع نسبة صغيرة فقط من التباين مفسرة بتغير معدل إعادة التركيب (شبه جزئي ر 2 = 0.07، 95٪ CI [0.01، 0.12]، الشكل 2 ج). وبالتالي ، على الرغم من أن معدل إعادة التركيب يؤثر على أطوال ROH وبالتالي احتمالات اكتشاف ROH ، فإن هذا يمثل نسبة صغيرة فقط من التباين في كثافة ROH المكتشفة ، والتي تعكس في الغالب الأنماط الأساسية لـ IBD على طول الجينوم.

تم قياس كمية كثافة الزيجوت المتماثل (ROH) ومعدل إعادة التركيب وتغاير الزيجوت في نوافذ غير متداخلة 500 كيلو بايت ، حيث تمثل كل نقطة نافذة واحدة. أعلى 0.5٪ من النوافذ ذات أعلى وأدنى كثافة ROH في السكان ، تسمى جزر ROH (ن = 24) والصحارى (ن = 24) باللون البنفسجي والأصفر على التوالي في جميع المخططات الأربعة. أ العلاقة بين كثافة ROH ومعدل إعادة التركيب. ب علاقة كثافة ROH و SNP تغاير الزيجوت. ج معدل إعادة التركيب داخل جزر وصحاري ROH. د تغاير الزيجوت داخل جزر وصحاري ROH. الخطوط الصلبة في أ و ب هي خطوط انحدار خطية وخطوط متقطعة في ج و د هي وسائل على نطاق الجينوم. تُظهر Boxplots الوسيط كخط مركزي بحدود الصندوق على هيئة النسب المئوية 25 و 75 والشعيرات العلوية والسفلية على أنها أكبر وأصغر قيمة ولكن ليس أكثر من 1.5 * نطاق رباعي من المفصلة. يتم أيضًا توفير بيانات المصدر لهذا الشكل كملف بيانات مصدر.

أخيرًا ، استكشفنا مقدار التباين في كثافة ROH الذي تم تفسيره من خلال إعادة التركيب عند استخدام عتبات دنيا مختلفة من ROH. كررنا التحليل باستخدام مجموعة بيانات استنادًا إلى حد أدنى لطول ROH يبلغ 0.4 ميجا بايت ، ومجموعة بيانات ثانية بحد أدنى لطول ROH يبلغ 3 ميجا بايت (الجدول التكميلي 3 ب ، ج). مقارنة بمجموعة البيانات الأصلية بحد أدنى لطول ROH يبلغ 1.2 ميغا بايت ، أوضحت إعادة التركيب تباينًا أقل في كثافة ROH في مجموعة البيانات بما في ذلك أقصر ROH (شبه جزئي ر 2 = 0.01 ، 95٪ CI [0.00 ، 0.04]) والمزيد من التباين في مجموعة البيانات التي تتكون فقط من ROH أطول (شبه جزئي ر 2 = 0.08 ، فاصل الثقة 95٪ [0.06 ، 0.11]). وبالتالي ، فإن اختلاف معدل إعادة التركيب له تأثير أكبر على الوفرة المكتشفة من ROH الأطول عبر الجينوم.

اكتئاب زواج الأقارب في البقاء على قيد الحياة

البقاء على قيد الحياة هو عنصر أساسي في اللياقة البدنية. في أغنام Soay ، يموت أكثر من نصف جميع الأفراد في شتاءهم الأول ، مما يقلل من فرصهم في التكاثر (الشكل التكميلي 7). يتم تقييم بقاء الأغنام من خلال فحوصات الوفيات الروتينية التي يتم إجراؤها على مدار العام. تم العثور على أكثر من 80٪ من الأغنام في منطقة الدراسة بعد موتها 50 ، مما أدى إلى إجمالي 15،889 ملاحظة بقاء سنوية لـ 5952 رأسًا من الأغنام. توزيع معاملات زواج الأقارب الفردية FROH كشفت في فئات عمرية مختلفة أن الأفراد الناشئين نادرًا ما ينجون سنواتهم الأولى من حياتهم ولا يصلون أبدًا إلى سن الشيخوخة (الشكل 3 أ). ومع ذلك ، يبدو أن قوة اكتئاب الأقارب تتراجع في الأعمار الأكبر (الشكل 3 ب). على سبيل المثال ، في الأغنام الأكبر من أربع سنوات ، كانت نسبة الناجين بين الأفراد الأكثر نسلًا أقل بشكل هامشي فقط من الأفراد الأقل نسلًا (الشكل 3 ب).

أ توزيعات معاملات زواج الأقارب FROH تتراوح أعمار الأغنام من 0 إلى 9 سنوات. ب نسبة الأفراد الباقين على قيد الحياة سنويًا في أربع مراحل مختلفة من الحياة وبين مختلف FROH الطبقات. نظرًا لأن الأفراد المتكاثرون نادرون نسبيًا ، فإن الفئة الأخيرة تمتد على نطاق أوسع من معاملات زواج الأقارب. يتم أيضًا توفير بيانات المصدر لهذا الشكل كملف بيانات مصدر. ج احتمالية البقاء على قيد الحياة المتوقعة وفترات زمنية موثوقة 95٪ على مدى معاملات زواج الأقارب FROH لكل مرحلة من مراحل الحياة أثناء الإمساك بالجنس وثابت التوأم عند 1 (ذكر) و 0 (بدون توأم). تتجاوز التنبؤات لفئات مراحل الحياة اللاحقة نطاق البيانات ولكنها تظهر عبر النطاق الكامل لإمكانية المقارنة.

قمنا بنمذجة قوة اكتئاب زواج الأقارب عبر العمر باستخدام نموذج حيواني مع توزيع خطأ ذي حدين والبقاء السنوي كمتغير استجابة. بشكل عام ، كان تأثير زواج الأقارب على البقاء قوياً: في الحملان (عمر 0) ، زيادة بنسبة 10٪ في FROH كان مرتبطًا بتغيير مضاعف 0.4 في احتمالات البقاء على قيد الحياة (نسبة الأرجحية ، أو [فاصل زمني موثوق به 95 ٪ ، CI] = 0.40 [0.30 ، 0.53] ، الجدول التكميلي 4) ، أو انخفاض بنسبة 60 ٪ (1-0.40) في احتمالات البقاء على قيد الحياة. هذا يترجم إلى اختلافات بقاء غير خطية على مقياس الاحتمال. على سبيل المثال ، ذكر الخروف غير التوأم سوي الحمل مع FROH 10٪ فوق المتوسط ​​لديهم احتمال أقل بنسبة 23٪ للبقاء على قيد الحياة في أول شتاء مقارنة بحمل متوسط ​​(FROH = 0.34 مقابل FROH = 0.24 الشكل. 3 ج). عبر العمر ، يقدر النموذج التفاعلات بين FROH وتوقعت مراحل الحياة المختلفة انخفاضًا في قوة اكتئاب زواج الأقارب في مراحل لاحقة من الحياة (الشكل 3 ج) مع أكبر فرق متوقع بين العمر المبكر (1 ، 2) ومتأخر العمر (عمر 5+ ، أو [95٪ CI) ] = 2.03 [1.08 ، 3.82] ، الجدول التكميلي 4).

قمنا بعد ذلك بتقدير حمل زواج الأقارب في Soay sheep باعتباره العدد الثنائي الصبغية للمكافئات المميتة 2B. المعادلات المميتة هي مفهوم متجذر في علم الوراثة السكانية ، حيث يساوي المكافئ المميت مجموعة من الطفرات التي ، إذا انتشرت بين الأفراد ، من شأنها أن تسبب وفاة واحدة في المتوسط ​​59. تابعنا اقتراحات Nietlisbach et al. 60 وإعادة تجهيز نموذج البقاء مع توزيع بواسون ووظيفة الارتباط اللوغاريتمي باستخدام هيكل نموذج مبسط بدون تفاعلات من أجل مقارنة أفضل عبر الدراسات. أعطى هذا تقدير 2 ب = 4.57 (95٪ CI 2.61–6.55) مكافئات قاتلة للبقاء السنوي لأغنام Soay.

العمارة الجينية لاكتئاب زواج الأقارب

لتحديد عواقب البقاء على قيد الحياة لكونك مرض التهاب الأمعاء في كل موقع من مواقع SNP ، استخدمنا دراسة ارتباط معدلة على مستوى الجينوم (GWAS). على عكس GWAS التقليدية حيث ص- قيم تأثيرات SNP المضافة ذات أهمية ، قمنا بتحليل تأثيرات حالة ROH لكلا الأليلين في كل SNP. على وجه التحديد ، في موضع ديالي ، ينتج ROH إما من نمطين فرديين من IBD يحتويان على أليل A أو من نمطين فرديين من IBD يحتويان على أليل ب. على أنماط فردانية أليل ب. لاختبار ذلك ، قمنا ببناء نموذج مختلط ذي الحدين للبقاء السنوي لكل موقع SNP. في كل نموذج ، قمنا بتركيب اثنين من تنبؤات حالة ROH. تم تعيين المتنبئ الأول 1 إذا كان الأليل A متماثل اللواقح وجزء من ROH و 0 بخلاف ذلك. تم تعيين المتنبئ الثاني على 1 إذا كان الأليل B متماثل اللواقح وجزءًا من ROH و 0 بخلاف ذلك. تقديرات النموذج و ص- تعكس قيم هذين المتنبئين ، ما إذا كانت ROH مرتبطة بعواقب البقاء على قيد الحياة في كل موقع من مواقع SNP ولكل أليل. في نموذج GWAS ، قمنا أيضًا بالتحكم في تأثير SNP الإضافي وتعني زواج الأقارب الفردي FROH (بناءً على جميع الجسيمات الذاتية باستثناء الكروموسوم البؤري) ، جنبًا إلى جنب مع مجموعة من السمات الفردية الأخرى والتأثيرات البيئية (انظر قسم "الطرق" للحصول على التفاصيل).

يمكن لـ GWAS على حالة ROH الأليل الكشف عن الأليلات المتنحية الضارة في مناطق معينة عندما تصل تأثيرات ROH إلى أهمية الجينوم على نطاق واسع. علاوة على ذلك ، يمكن أن يكون توزيع تأثيرات حالة ROH عبر الجينوم مفيدًا أيضًا للعدد الإجمالي للأليلات المتنحية الضارة التي تساهم في اكتئاب زواج الأقارب من خلال ROH. في ظل الفرضية الصفرية القائلة بأن حالة ROH ليس لها تأثير على البقاء في أي موضع SNP ، نتوقع توزيعًا بنسبة 50/50 لتقديرات حالة ROH السلبية والإيجابية بسبب الصدفة. في المقابل ، وجدنا العديد من التأثيرات السلبية أكثر من الإيجابية لحالة ROH على البقاء عبر الجينوم أكثر مما كان متوقعًا بالصدفة (الشكل 4 أ ، ب 465 كلفن سلبي مقابل 354 كلفن. اختبار ذي حدين دقيق ص = 2.2 * 10-16). علاوة على ذلك ، تزداد نسبة تأثيرات ROH السلبية لتقديرات النموذج الأكبر (الشكل 4 أ) وأصغر ص- القيم (الشكل 4 ب). اختبرنا هذا إحصائيًا باستخدام نموذجين خطيين معممين ذي الحدين (GLMs) ، مع اتجاه التأثير كاستجابة ثنائية ، وتقدير النموذج و ص- القيمة ، على التوالي ، كمتنبئين. كان من المرجح أن تكون تأثيرات ROH سلبية عندما كان تقدير نموذجهم أكبر (log-OR [95٪ CI] = 0.35 [0.344، 0.358]) وعندما ص- كانت القيمة أصغر (log-OR [95٪ CI] = −3.82 [−3.84، −3.80]). وبالتالي ، فمن المرجح أن عددًا كبيرًا من الأليلات الضارة المتنحية تساهم في اكتئاب زواج الأقارب ، والذي يتجلى في تأثيرات ROH السلبية المنتشرة عبر العديد من المواقع.

تم تصور اكتئاب زواج الأقارب الإقليمي واختباره باستخدام اثنين من تنبؤات حالة ROH الثنائية. حدد أحد المتنبئين حالة ROH للأليل A (في ROH = 1 ، وليس في ROH = 0) ، بينما حدد الآخر حالة ROH للأليل B. أ توزيع أحجام التأثير لتأثيرات حالة ROH من SNP. ب توزيع لل ص-قيم لتأثيرات حالة ROH SNP-wise. تظهر الرسوم البيانية الصفراء التي تظهر تأثيرات إيجابية متراكبة فوق الرسوم البيانية الأرجواني التي تظهر تأثيرات سلبية لتسليط الضوء على نسبة أكبر بكثير من تأثيرات حالة ROH السلبية مما كان متوقعًا بالصدفة. ج مؤامرة مانهاتن لوضع ROH ص- القيم عبر الجينوم. يشير الخط المنقط إلى عتبة الأهمية على مستوى الجينوم لتصحيح Bonferroni الذي استند إلى العدد الفعال للاختبارات عند حساب عدم توازن الارتباط.

كشفت GWAS عن تأثيرات ROH المهمة على مستوى الجينوم في سبع مناطق على الكروموسومات 3 (منطقتان) و 10 و 14 و 18 و 19 و 23 (الشكل 4 ج والجدول التكميلي 5). في خمس من هذه المناطق ، ارتبطت حالة ROH لأحد الأليلات بتأثيرات سلبية على البقاء ، والتي من المحتمل أن تكون ناجمة عن الأليلات المتنحية الضارة نسبيًا. ارتبط ROH في منطقتين أخريين على الكروموسومات 3 و 19 بزيادة احتمالات البقاء على قيد الحياة ، ربما بسبب الأنماط الفردية ذات التأثيرات الإيجابية على البقاء على قيد الحياة. To explore the genomic regions with large ROH effects further, we quantified the ROH density and SNP heterozygosity in 2 Mb windows around the top GWAS hits (Supplementary Fig. 8). Strongly deleterious recessive alleles might be expected to occur in regions of elevated heterozygosity where they are rarely expressed in their homozygous state. Heterozygosity was higher than average around the top SNPs on chromosomes 10, 14, 18 and 23, and ROH frequency was lower around the top SNPs on chromosomes 10, 18, 19 and 23, but overall, but we did not observe a convincing pattern of genetic diversity across the five regions harbouring strongly deleterious mutations (Supplementary Fig. 8).


THE GENETIC INTERPRETATION OF INBREEDING DEPRESSION AND OUTBREEDING DEPRESSION

Inbreeding with close relatives and outbreeding with members of distant populations can both result in deleterious shifts in the means of fitness-related characters, most likely for very different reasons. Such processes often occur simultaneously and have important implications for the evolution of mating systems, dispersal strategies, and speciation. They are also relevant to the design of breeding strategies for captive populations of endangered species. A general expression is presented for the expected phenotype of an individual under the joint influence of inbreeding and crossbreeding. This expression is a simple function of the inbreeding coefficient, of source and hybridity indices of crossbreeding, and of specific forms of gene action. Application of the model may be of use in identifying the mechanistic bases for a number of evolutionary phenomena such as the shift from outbreeding enhancement to outbreeding depression that occurs with population divergence.

الكلمات الدالة: Inbreeding depression outbreeding depression.


المواد والأساليب

Study species and populations

Witheringia solanacea is a small shrub that extends from southern Mexico and the Caribbean to South America (D𠆚rcy, 1973). It possesses the gametophytic SI system characteristic of the Solanaceae, where allele-specific S-RNases expressed in the style cause the degradation of RNA, and therefore the death of pollen tubes bearing the cognate س-allele (McClure et al., 1990). The floral biology of W. solanacea is described in detail by Bohs (2000). Its flowers are pollinated by small bees and its fleshy fruits are bird-dispersed. Witheringia solanacea also reproduces prolifically by vegetative reproduction in gardens and along trailsides. Cuttings were collected in the field from Costa Rican populations and maintained in the greenhouse at Colby College. Populations and locations have been described by Stone and Pierce (2005) and Stone et al. (2006). Plants were sampled from populations in three geographic regions. Self-incompatible plants were sampled from large populations in the Las Cruces region, at 1180� m a.s.l. in southwestern Costa Rica, and the Monteverde region in northwestern Costa Rica, extending from 1100 m elevation in the San Luis Valley to 1500 m a.s.l. in the village of Monteverde. The SC individuals came from the very small population at Vara Blanca at 1360 m a.s.l. in central Costa Rica and from the undescribed but morphologically distinct variety at lower elevations in the Monteverde region. Treatments were carried out on seven SI individuals from Las Cruces and 13 from Monteverde, in addition to the two strongly SC individuals available from Vara Blanca and three from Monteverde. The low sample size of SC plants was a consequence of the relative scarcity of the SC phenotype in Monteverde and the tiny overall size of the population in Vara Blanca, which over a decade of monitoring has never been found to contain more than six individuals.

Pollen chase experiment and pollen tube growth

For each trial, we conducted 3𠄶 pairs of SO and OO treatments over a period of 1 week to 10 days. During the summers of 2004�, 48 trials were carried out: seven on SC plants, 14 on Las Cruces plants, and 27 on Monteverde plants. Pollen was collected in clean vials and applied using clean toothpicks to styles of unopened flowers, 24 h before anthesis. Buds at this stage can be identified because they are still tightly closed but have developed the green splotches that decorate the corolla of mature flowers. Pairs of buds were chosen on each recipient, the bud for the SO treatment receiving self-pollen, and the bud for the OO treatment receiving outcross pollen. Twenty-four hours later, outcross pollen from a single compatible donor was applied to both flowers. Previous work in our laboratory has shown that although bud self-pollinations produce fewer pollen tubes at the base of the style than do bud outcross-pollinations, both types of pollinations produce tubes that grow past midstyle at 24 h and reach the base of the style by 48 h. Therefore, we assume that 24 h priority is sufficient to ensure that bud self-pollen tubes reach the base of the style before the subsequent outcross pollen tubes do. In total, 852 pollinations were done, half of which were bud pollinations. Fruits were allowed to ripen, and seeds were counted.

Germination and genotyping

To compare germination rates among treatments for SI populations, we planted seeds from fruits representing all available mothers and cross types. In most instances, 20 seeds were planted per cross, but in some cases all seeds per fruit were planted. We planted five seeds per cell in a 128-cell flat filled with Metro-Mix 200 (Sun-Gro Horticulture, Vancouver, British Columbia, Canada), alternating the position of cells occupied by seeds from SO and OO fruits. Seeds were covered with a fine layer of vermiculite, and the flats were placed in a mist bench under 12-h light/12-h dark in the greenhouse at Colby College. Liquid fertilizer was applied weekly once initial sprouts appeared. Germination was recorded at 6 wk, at which time seedlings were transplanted to individual cells and randomly placed on the bench. Seedlings were harvested by clipping with scissors at ground level at 12 wk and air dried.

To detect the level of self-fertilization resulting from the SO treatment, we used five microsatellite loci to genotype progeny and parental plants. We genotyped 73 progeny from 13 SO pollinations on eight maternal plants. Microsatellite-enriched libraries were developed by Craig Newton of ATG genetics (Vancouver, Washington. USA). We amplified inserts using universal m13 primers, sequenced the inserts using an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, California, USA), and designed primers using the program Primer3 (Rozen and Skaletsky, 2000). Primer sequences appear in Table 1 .

الجدول 1

Primer sequences for microsatellite genotyping of Witheringia solanacea.

اسمتسلسلتيم (ଌ)Product length (bp)Alleles in sample
WsolgataA6Lctgctacccatggctcaact60.28185�6
WsolgataA6Rttttctcggttgcaatggtt60.48
WsolcaA3Lgcaaaatacagtcaacacaatgaa59.10244�2
WsolcaA3Rgctcacgtggtgtttgtaga57.30
WsolcaE1Lcgatccacatcagctgaaaa59.80187�3
WsolcaE1Racccaggaattggggtaaga60.55
WsolcaE2Lgcggatccaggacatgaata60.83209�3
WsolcaE2Rctcctgcgacctgtctgttt60.44
WsolcaE9Ltccctcattggtaagggatg59.74154�4
WsolcaE9Rcgaccagtgctagctgacaa60.20

We extracted genomic DNA using the Qiagen (Germantown, Maryland, USA) DNeasy Plant Mini Kit on 40 mg dried leaf material, using dry ice to keep the tissue brittle for grinding in the Qiagen tissue lyser. PCR was carried out in 25 μL volumes in standard buffer with 1.5 mM MgCl2, 0.8 mM dNTPs, 0.5 μM each primer, 2 U طق polymerase, and 10 ng genomic DNA. In each reaction, the left primer was fluorescently tagged with 6-FAM. A touchdown PCR program was used, with the annealing temperature decreasing from 60ଌ to 50ଌ by 0.5° each cycle for the first 20 cycles and kept at 50ଌ thereafter. Other PCR conditions were an initial denaturation at 95ଌ for 2.5 min and 35 cycles with 95ଌ for 20 s, annealing for 30 s, and extension at 72ଌ for 30 s with a final extension at 72ଌ for 10 min. PCR products were suspended in deionized formamide with ROX-500 size standard (Applied Biosystems) and run under standard conditions on an ABI 3130 genetic analyzer. Peaks were visualized using GeneScan and scored manually.

تحليل البيانات

For the two SI populations, we used a two-way ANOVA to compare fruit and seed set of SO and OO treatments, with population as a random factor and treatment as a fixed factor. Maternal plant was nested within population. Treatment and the population × treatment interaction were tested over treatment × maternal plant nested within the population. To meet assumptions of ANOVA, proportion fruit set was arcsine-transformed, and seed number per plant per treatment was averaged and square-root transformed. The low number of available SC plants made it impossible to evaluate assumptions of parametric tests. For analyses involving SC plants, we used a Wilcoxon’s matched pairs signed rank test for paired comparisons, a Mann–Whitney test for unpaired comparisons, and Kruskal–Wallis tests for comparisons involving all three populations. Nonparametric tests were also used for germination data. Mann–Whitney tests were done by hand, and the program Stata 10.1 (Stata-Corp, College Station, Texas, USA) was used for all other analyses. The cumulative embryonic fitness decline associated with self-precedence was calculated for each individual according to the formula: δ = 1 − (ثsf/ثمن · ثss/ثos)، أين ثsf = proportion of SO pollinations producing fruit, ثمن = proportion of OO pollinations producing fruit, ثss = average seed number resulting from SO pollinations, ثos = average seed number resulting from OO pollinations.

To estimate the selfing rate for SO fruits, we calculated the probability, at each locus, that each offspring was a product of self-fertilization. If any locus revealed a definitive outcrossing event, the progeny was recorded as an out-cross. If no loci revealed definitive outcrossing, the likelihood of selfing was found by multiplying the probabilities across loci.

Pollen tube data, together with selfing rate estimates, allowed us to account for residual SI in the estimate of embryonic inbreeding depression. Bud self-pollination of SI plants from the Monteverde population yielded an average of 37 pollen tubes at the base of the style, whereas bud self-pollination of SI plants from Las Cruces yielded an average of only 13 pollen tubes at the base of the style (Stone et al., 2006). The number of pollen tubes at the base of the style after bud self-pollinations provides the maximum number of selfed seeds that could be expected under bud self-pollination. Any seeds in excess of that expectation should be due to the outcross pollination done on the second day of the pollen chase experiment. An expected selfing rate can therefore be obtained by comparing the number of self-pollen tubes with the total number of seeds. The observed selfing rate of surviving progeny as obtained by microsatellite genotyping was compared with the expected rate to estimate the relative postzygotic fitness of selfed progeny.


What impact has recent inbreeding had on the genetic diversity of domestic dogs?

Research published today in Canine Genetics and Epidemiology investigated the rate of inbreeding in domestic dog breeds recognized by The Kennel Club. Here, Tom Lewis explains more.

The term ‘inbreeding’ is widely associated with severe physiological (and in humans, mental) impairment as a consequence of parents being closely related. As a result, incestuous relationships are a widespread cultural taboo, with laws against incestuous marriages, at least of first degree relatives, almost universally present throughout the world.

However, it is actually very difficult to avoid any degree of relationship between two parents. In part this is due to simple mathematics – the number of ancestors increases exponentially with each generation further back (two parents, four grand-parents, eight great-grand-parents) meaning that it is inevitable there will be some degree of common ancestry if we go back far enough.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

That relatives resemble each other is a central tenet of genetics. Therefore, if we select breeding animals that resemble each other with respect to a particular trait, then these individuals will on average be more closely related than if mating was random.

This means that selection will lead to some degree of inbreeding. Consequently, rather than attempting to avoid any inbreeding in domestic animal populations at all, a more useful strategy is to manage the loss of genetic diversity (rate of inbreeding) to within sustainable levels.

Calculating the rate of inbreeding

The domestic dog shows a greater variety in appearance and behavior than any other domestic species. Many distinct breeds were formed and are maintained by closed registries which have led to the widespread belief that pedigree dogs are very inbred.

Crucially however, the rigorous recording of pedigree data provides large datasets from which genetic parameters and historical trends can be determined, and this information used to guide future breeding strategies.

The rates of inbreeding calculated in all 215 domestic dog breeds recognized by the Kennel Club over the period 1980 to 2014 form the results central to a study recently published in Canine Genetics and Epidemiology. Although the precise profile of rate of loss of genetic diversity is unique for each breed, the study did determine some broad trends.

What did we find?

There was a general contraction of within-breed genetic diversity in the 1980s and 1990s, with the overall rate of inbreeding at a level at which detrimental effects, such as inbreeding depression, would be expected to be observed. However, since the turn of the century the rate of inbreeding has tended to decline across breeds, implying breeders have taken steps to conserve genetic diversity.

Interestingly this general decline in the rate of inbreeding coincides with the relaxation of the UK’s quarantine laws. This suggests that breeders may have taken the opportunity provided by new laws easing travel restrictions for dogs to slow the erosion of genetic diversity, or even re-introduce some genetic variation, through more widespread use of non-UK animals in breeding.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size (as judged by mean number of Kennel Club registrations). This implies that it is possible to conserve genetic diversity via a sustainable rate of inbreeding in small populations, perhaps through judicious use of migrant animals for breeding to provide an injection of genetic diversity to the population.

The existence of popular sires, or male parents, was observed in virtually all pedigree dog breeds in the study. The repeated use of prolific breeding males is both often a feature of selection and a contributor to a high rate of inbreeding, and is typical in breeding practices of almost all domestic mammal species.

Intense selection in males

The much greater reproductive capacity of males compared to females means more intense selection can be applied to males, and the few selected then make a far greater individual genetic contribution to future generations.

While this results in widespread dissemination of genes influencing ‘sought after’ traits (the response to selection), it also makes such males much more likely to be a common ancestor to all breeding animals in subsequent generations, increasing the rate of inbreeding.

The challenge remains, for the dog as for other domestic species, to achieve sufficient response to selection (for traits related to health, temperament, and so on) at a rate of loss of genetic diversity which is sustainable.


شاهد الفيديو: صباح العربية: هذه مخاطر زواج الأقارب (شهر نوفمبر 2022).