معلومة

كيف يتم اختيار تركيز المضاد الحيوي لوسط YPD؟

كيف يتم اختيار تركيز المضاد الحيوي لوسط YPD؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أحتاج إلى تحضير أطباق YPD التي تحتوي على مادة hygromycin ، لكنني لا أعرف التركيز الذي يمكنني استخدامه. سأختار المحولات من Hansenula polymorpha.


وفقًا لهذا الموقع ، بالنسبة للخميرة (أفترض أن هذا يعني خميرة الخميرة) يجب استخدام 50 ميكروغرام / مل إلى 200 ميكروجرام / مل ؛ للفطريات (!) استخدم 100 ميكروغرام / مل إلى 300 ميكروجرام / مل. يؤكد الموقع أيضًا على أهمية الأس الهيدروجيني للوسط.

أعتقد ذلك ، ما لم يكن ملف هانسنولا يأتي الخبير ، سيكون عليك تجربة تجربة أولية لقياس حساسية الخلايا غير المحولة عبر النطاق المشار إليه. ثم يمكنك محاولة اختيار الخلايا المقاومة بتركيز أعلى إلى حد ما من تلك التي تقتل الخلايا غير المحولة. أخيرًا ، يمكنك التحقق لمعرفة مدى مقاومة المحولات ، لتمكينك من تحديد تركيز مفيد للاختيار الروتيني للمحولات.


الحد الأدنى للتركيز

في علم الأحياء الدقيقة ، فإن الحد الأدنى للتركيز (ميكروفون) هو أقل تركيز لمادة كيميائية ، عادة ما يكون دواء ، مما يمنع النمو المرئي للبكتيريا أو البكتيريا. يعتمد MIC على الكائنات الحية الدقيقة ، والإنسان المصاب (في الجسم الحي فقط) ، والمضاد الحيوي نفسه. [1] غالبًا ما يتم التعبير عنه بالميكروجرام لكل مليلتر (ميكروغرام / مل) أو ملليغرام لكل لتر (ملغم / لتر).

يتم تحديد MIC من خلال تحضير محاليل المادة الكيميائية في المختبر بتركيزات متزايدة ، واحتضان المحاليل بدفعات منفصلة من البكتيريا المستزرعة ، وقياس النتائج باستخدام تخفيف أجار أو مرق ميكروديلون. تم تصنيف النتائج إلى حساسة (غالبًا ما تسمى حساسة) أو متوسطة أو مقاومة لمضاد جرثومي معين باستخدام نقطة توقف. نقاط التوقف متفق عليها على القيم المنشورة في إرشادات هيئة مرجعية ، مثل المعهد الأمريكي للمعايير السريرية والمخبرية (CLSI) ، والجمعية البريطانية للعلاج الكيميائي بمضادات الميكروبات (BSAC) أو اللجنة الأوروبية لاختبار الحساسية لمضادات الميكروبات (EUCAST). [2] كانت هناك اختلافات كبيرة بين نقاط التوقف من مختلف البلدان الأوروبية على مر السنين ، وبين تلك من اللجنة الأوروبية لاختبار الحساسية لمضادات الميكروبات (EUCAST) ومعهد المعايير السريرية والمختبرية الأمريكية (CLSI). [3]

في حين أن MIC هو أقل تركيز لعامل مضاد للجراثيم ضروري لتثبيط النمو المرئي ، فإن الحد الأدنى من تركيز مبيد الجراثيم (MBC) هو الحد الأدنى لتركيز العامل المضاد للبكتيريا الذي يؤدي إلى موت البكتيريا. كلما اقترب MIC من MBC ، كلما كان المركب أكثر مقاومة للجراثيم. [4]

غالبًا ما تكون الخطوة الأولى في اكتشاف الأدوية هي فحص عقار مكتبة مرشح ل MICs ضد البكتيريا ذات الأهمية. [5] على هذا النحو ، عادة ما تكون MIC نقطة البداية لإجراء تقييمات أكبر قبل السريرية للعوامل الجديدة المضادة للميكروبات. [6] الغرض من قياس الحد الأدنى للتركيز المثبط هو ضمان اختيار المضادات الحيوية بكفاءة لزيادة نجاح العلاج.


الحد الأدنى للتركيز المثبط (MIC) والحد الأدنى لتركيز الجراثيم (MBC)

الحد الأدنى من تركيز المثبط (MIC) يُعرَّف بأنه أقل تركيز (معبراً عنه بـ mg / L أو ميكروغرام / ميكرولتر) لعامل مضاد للميكروبات يثبط النمو المرئي للكائنات الحية الدقيقة في المختبر. يحدد اختبار MIC النشاط المضاد للميكروبات لعامل اختبار ضد بكتيريا معينة. يتم استخدام الاختبار الإلكتروني وطريقة تخفيف الأنبوب وطرق تخفيف أجار لتحديد قيمة MIC.

أثناء إجراء طريقة التخفيف ، يعتبر أقل تركيز (أعلى تخفيف) لمضاد الميكروبات الذي يمنع ظهور العكارة (النمو) بمثابة MIC. في هذا التخفيف يكون العامل المضاد للميكروبات مضادًا للجراثيم ، أي أن بعض البكتيريا قد تظل حية.

  • بحث مكثف يربط MIC بمستويات مصل يمكن تحقيقها لكل عامل مضاد للميكروبات ،
  • آليات مقاومة معينة ، و
  • نتائج علاجية ناجحة

العلاقة بين MIC ومنطقة التثبيط

يرتبط MIC وقطر منطقة التثبيط عكسيًا. كلما كان الكائن الدقيق أكثر عرضة للعامل المضاد للميكروبات ، انخفض MIC وزادت منطقة التثبيط. على العكس من ذلك ، كلما زادت مقاومة الكائنات الحية الدقيقة ، زادت MIC وأصغر منطقة التثبيط.

يتم تحديد MIC فقط في سيناريوهات سريرية محددة بموجب تعليمات أخصائي علم الأحياء الدقيقة ، على سبيل المثال التهاب الشغاف. يعطي MIC معلومات قيمة ، والتي ستساعد في تخصيص العلاج لتوجيه البكتيريا المسببة فقط.

أوصت CLSI مؤخرًا بإعداد تقارير فئة SDD بدلاً من "وسيطة" عند الإبلاغ عن نتائج cefepime لـ المعوية يعزل بسبب وجود العديد من خيارات الجرعات المعتمدة لـ cefepime.

طريقة تخفيف المرق

اختبار تخفيف المرق / الأنبوب هو الطريقة القياسية لتحديد مستويات المقاومة الميكروبية لعامل مضاد للميكروبات. يتم إجراء التخفيفات التسلسلية لعامل الاختبار في وسط نمو جرثومي سائل يتم تلقيحه بعدد معياري من الكائنات الحية ويتم تحضينها لفترة محددة. في نهاية فترة الحضانة (بشكل عام 18-24 ساعة) ، يتم فحص الأنابيب بصريًا بحثًا عن التعكر. اختبار حساسية تخفيف المرق (MIC 6.25 ميكروغرام / مل)

على سبيل المثال في الصورة الموضحة أعلاه ، تقع نقطة توقف تثبيط النمو بين 6.25 (لا يوجد تعكر) و 3.12 ميكروغرام / مل (العكارة لا تزال تظهر) للعامل المضاد للميكروبات. ومع ذلك ، وفقًا للاتفاقية ، يتم تفسير MIC على أنه تركيز العامل المضاد للميكروبات الموجود في الأنبوب الأول في السلسلة والذي يمنع النمو المرئي. لذلك ، في هذا المثال ، يكون MIC هو 6.25 ميكروغرام / مل. اكتشف المزيد عن طريقة تخفيف المرق

طريقة تخفيف أجار

تضاف تركيزات مختلفة من العوامل المضادة للميكروبات إلى وسط أجار ، معظمها مولر هينتون أجار (للكائنات غير الحساسة). يمكن تطبيق كائنات اختبار متعددة (بتركيز 10 ^ 4 CFU / مل) مباشرة أو باستخدام جهاز تكرار اللقاح (مكرر توجيه) على لوحة أجار واحدة بتركيز معين من المضادات الحيوية. لوحظت النتائج بعد الحضانة عند 35 درجة مئوية لمدة 18-24 ساعة.

طريقة الاختبار الإلكتروني

يظهر الاختبار الإلكتروني هيئة التصنيع العسكري

يتم تطبيق شريط بلاستيكي مع تدرج محدد مسبقًا لمضاد حيوي واحد على صفيحة أجار مُلقحة. بعد 18-24 ساعة من الحضانة ، تتقاطع منطقة تثبيط على شكل قطرة مع شريط الاختبار المتدرج عند التركيز المثبط للمضاد الحيوي.

يشير تقاطع الجزء السفلي من منطقة تثبيط النمو على شكل قطع ناقص مع شريط الاختبار إلى قيمة MIC. اكتشف المزيد عن الاختبار الإلكتروني

نظام آلي لتحديد MIC

  • نظام Vitek 2 ((bioMérieux))
  • MicroScan Walkaway (بيكمان كولتر)
  • نظام BD Phoenix (Becton Dickenson Diagnostics)

الإبلاغ عن نتائج MIC

يجب على المختبرات الإبلاغ عن الفئة التفسيرية (حساسة ، حساسة للجرعة معتمدة ، وسيطة أو مقاومة) للطبيب مع أو بدون قيمة MIC. لا ينصح بالإبلاغ عن قيمة MIC فقط لأن الطبيب قد يفشل في تفسيرها بشكل مناسب.

الحد الأدنى من تركيز مبيد الجراثيم (MBC)

يُعرَّف الحد الأدنى لتركيز مبيد الجراثيم (MBC) على أنه أقل تركيز للمضاد الحيوي يقتل 99.9٪ من اللقاح. يُطلق عليه أيضًا الحد الأدنى من التركيز المميت (MLC) ، يتم تحديد MBC للعامل المضاد للبكتيريا عن طريق الزراعة الفرعية لآخر أنبوب MIC واضح على وسط النمو وفحص نمو البكتيريا.

عادةً بالنسبة للأدوية المبيدة للجراثيم ، يكون MIC قريبًا جدًا أو في الحقيقة مجرد خطوة واحدة أو شيء من هذا القبيل من MBC. في الأدوية المضادة للجراثيم ، يمكن أن تكون المسافة بينهما أكبر قليلاً.


يمكن استخدام البروتوكولات المذكورة أدناه لزراعة الخمائر والحفاظ عليها في الوسائط السائلة والصلبة

نمو الخميرة في مرق YPD

  1. علق 50 جم من المنتج (رقم المنتج Y1375) في 1 لتر من الماء المقطر.
  2. الأوتوكلاف لمدة 15 دقيقة عند 121 درجة مئوية.
  3. تلقيح مزارع الخميرة (مصدرها مرق / أطباق الخميرة) في أنابيب / قوارير خالية من المنظفات تحتوي على وسط سائل مُجهز ، راجع الخطوتين 1 و 2 (يجب ألا يزيد الوسط عن ثلث حجم أنبوب الاستزراع أو خمس القارورة الإجمالية الصوت).
  4. دوامة المحتويات لفترة وجيزة لتفريق الخلايا.
  5. تنمو الثقافة في حاضنة اهتزاز عند 300 دورة في الدقيقة (للقوارير) أو 350 دورة في الدقيقة (لأنابيب الاستزراع).

نمو الخميرة على YPD Agar

  1. علق 65 جرام من المنتج (رقم المنتج Y1500) في 1 لتر من الماء المقطر.
  2. يُسخن حتى الغليان مع التحريك لإذابة جميع المكونات تمامًا.
  3. الأوتوكلاف لمدة 15 دقيقة عند 121 درجة مئوية.
  4. صب حوالي 25-30 مل من وسط أجار على لوحات معقمة واتركها في غرفة التدفق الصفحي.
  5. خط (خميرة تم الحصول عليها من صفيحة YPD) / انتشار (خميرة مصدرها مزارع مرق) على ألواح أجار واحتضانها عند 30 درجة مئوية.

ملحوظة: يمكن ملاحظة مستعمرات الخميرة المفردة بعد حوالي 24 ساعة ، ولكن هناك حاجة إلى الحضانات لمدة تزيد عن 48 ساعة قبل أن يمكن استخدامها لأغراض الطلاء المتماثلة. معدل نمو مزارع الخميرة باستخدام المكملات الغذائية المتوسطة التسرب الاصطناعية هو


مناقشة

باختصار ، نجد أنه طالما لا يوجد تدفق للمقاومة المزدوجة في المجتمع البؤري ، فإن العلاج المركب يتفوق على جميع الاستراتيجيات الأخرى التي تم النظر فيها هنا ، سواء من حيث زيادة وتيرة غير المصابين وتقليل تكرار المقاومة. لاحظ أن تفوق العلاج المركب يعتمد على معايير تركز فقط على تطور المقاومة وعدد غير المصابين ، ولكنها تتجاهل الجوانب الأخرى ذات الصلة للغاية في الممارسة السريرية ، مثل الآثار الجانبية. ومع ذلك ، لا يبدو أن ميزة العلاج المركب ناتجة عن ارتفاع إجمالي تركيز المضادات الحيوية عند الجمع بين المضادات الحيوية. عندما يكون هناك تدفق للمقاومة المزدوجة ، تفشل جميع الاستراتيجيات ، حيث تؤدي جميعها إلى زيادة المقاومة المزدوجة. بعبارة أخرى ، العلاج المركب هو الأفضل في منع تطور المقاومة ، وجميع الاستراتيجيات ضعيفة في إدارة المقاومة الموجودة مسبقًا.

النتائج في اتفاق كامل مع التوقعات النظرية (4 ، 12). علاوة على ذلك ، فإن اكتشاف أن ركوب الدراجات والخلط لهما تأثيرات مماثلة مدعوم من قبل RCT متعدد المراكز حديثًا (17). ومع ذلك ، فإن التفوق الملحوظ للعلاج المركب يتعارض إلى حد ما مع الملاحظات التجريبية. قارن اثنان من التحليلات التلوية للتجارب المعشاة ذات الشواهد (15 ، 16) العلاج الأحادي مع β-lactam واحد مع العلاج المركب مع β-lactam (عادة مختلف) و aminoglycoside. خلصت هذه الدراسات إلى أن العلاج المركب لا يقدم ميزة على العلاج الأحادي فيما يتعلق بظهور مقاومة المضادات الحيوية. في حين أن العلاج المركب قلل من فشل العلاج بسبب ظهور المقاومة (15) ، كان العلاج الأحادي أفضل أو غير أدنى فيما يتعلق بنقاط النهاية السريرية الأخرى ، مثل ظهور المقاومة ، والوفيات (إما جميع الأسباب أو المنسوبة إلى العدوى) ، أو العدوى. بشكل عام ، فإن التجارب المعشاة ذات الشواهد التي تقارن العلاج المركب والعلاج الأحادي نادرة ، لا سيما فيما يتعلق بالمقاومة كنقطة نهاية سريرية أولية (15). نظرًا لنجاح العلاج المركب في الحد من ظهور المقاومة في حالات العدوى الأخرى مثل فيروس نقص المناعة البشرية أو الملاريا أو السل ، من وجهة نظرنا ، فإن العلاج المركب يستحق مزيدًا من البحث كاستراتيجية لمنع مقاومة المضادات الحيوية أيضًا لعدوى المستشفيات.

لقد فوجئنا بعدم وجود مقاومة مزدوجة لوحظ في تجاربنا ، بالنظر إلى التقارير السابقة التي تشير إلى أن النزف الإيجابي يمكن أن يقود تطور المقاومة المزدوجة للأدوية المستخدمة (18). تعتمد السلالات المقاومة المستخدمة في السيناريوهين الأول والثاني على طفرات أحادية النقطة تمنح مقاومة عالية المستوى لكل دواء. عند دمجها ، فإنها تمنح أيضًا مقاومة مزدوجة عالية المستوى بتكلفة منخفضة (18). كشف تسلسل المجموعات المختارة من كل من العلاجات الأحادية ، بالإضافة إلى علاجات ركوب الدراجات والخلط ، عن طفرات في المواقع الموصوفة سابقًا في كليهما جيرا و rpsL (18) (الملحق SI، الجدول S2). ومع ذلك ، نادرًا ما تم العثور على الطفرات الدقيقة التي أدخلناها في سلالاتنا. ترينداد وآخرون (18) لا تجد فقط الإبستاسيس الإيجابي ، ولكن أيضًا الطفرات التي بدت قاتلة عند دمجها. على الرغم من أن بعض الطفرات التي وجدناها تختلف عن تلك التي درسها Trindade et al. (18) ، قد يكون التفسير المحتمل لغياب المقاومة المزدوجة تفاعلات سلبية قوية بين طفرات المقاومة التي تتطور في تجاربنا.

تؤكد النتائج المقدمة جدوى نهجنا لدراسة تطور المقاومة باستخدام إطار عمل قائم على علم الأوبئة في المختبر. نبرهن على أن التطور التجريبي المتوازي على المدى الطويل لمقاومة المضادات الحيوية في ظل ديناميات سكانية وبائية واقعية ممكن في إعداد آلي. لقد بحثنا هنا في مجموعة محدودة من السيناريوهات. الأهم من ذلك ، نحن فقط نأخذ في الاعتبار الطفرات الصبغية التي لا يتم نقلها أفقياً. ومع ذلك ، في حين أن المقاومة بوساطة البلازميد هي مصدر قلق كبير ، فإن طفرات مقاومة الكروموسومات تساهم أيضًا في المقاومة في العديد من مسببات الأمراض المهمة (22 ، 23).

من المهم أن نذكر أنه إلى أي مدى يتناسب سلوك نموذجنا التجريبي مع نتائج النموذج الوبائي لم يكن معروفًا مسبقًا. في الأساس ، تحدث نفس العمليات ، أي الطفرات والاختيار ، في جميع أذرع العلاج. ومع ذلك ، في حين أن نموذجنا التجريبي يلتقط السلوك نوعيًا ، إلا أن هناك اختلافات كمية ، خاصة فيما يتعلق باستراتيجيات الدراجات والخلط. يسلط التناقض بين التوزيعات الخلفية التي تم الحصول عليها من أذرع العلاج المختلفة الضوء على أنه لا يمكن التقاط ديناميكيات السكان في ذراع معالجة معين بالكامل باستخدام تقديرات المعلمات التي يمكن تحديدها من أذرع العلاج الأخرى.

لا يأخذ نموذجنا في الاعتبار التأثيرات العشوائية ، والتي تعد قيدًا عند نمذجة أحداث الانقراض. على الرغم من أن هذا ، من الناحية النظرية ، قد يؤثر على تواتر السلالات المقاومة ، خاصة بالنسبة للعلاجات المتعددة الأدوية ، فإننا نعتقد أن نتائج تقديرنا ستكون قوية لمثل هذه التأثيرات العشوائية ، نظرًا لأننا لم نلاحظ أي أحداث انقراض في غياب العلاج.

يمكن أن تزيد الدراسات المستقبلية الواقعية من خلال دراسة تأثير استراتيجيات العلاج عندما تكون المقاومة محمولة بالبلازميد أو عندما يكون الامتثال للنظام الموصوف غير كامل ، وكلاهما يمكن أن يؤثر على تفوق العلاج المركب. علاوة على ذلك ، تسمح الدراسات في المختبر بالنظر في مجموعة أوسع بكثير من الأدوية والسلالات البكتيرية ، حيث تعتمد تأثيرات العلاج المركب على كل من السلالة والدواء (20 ، 24 ، 25). بالنظر إلى الجوانب غير العملية للنماذج الحيوانية لعلم الأوبئة التجريبي ، قد يقدم نهجنا محاولة صحيحة لتضييق الفجوة بين الدراسات الحسابية والسريرية حول تطور مقاومة المضادات الحيوية.


استنتاج

نجد ذلك عند درجة الحرارة & # x0223c25 & # x000b0C ، C. neoformans يعيش بشكل أفضل عند التعرض لـ FLC على وسائط YNB مقارنة بوسائط YPD الغنية ويكون تأثير نوع الوسائط عكس ذلك عند معالجة الخلايا بـ AMB. لا يظهر تأثير درجة الحرارة تبادليًا مشابهًا ، حيث تتأثر الخلايا المعالجة بـ FLC و AMB أكثر بالأدوية عند درجات حرارة أعلى. تتطور الخلايا المعالجة بـ FLC إلى مستعمرات مقاومة للأدوية بسهولة أكبر عند احتضانها على وسائط YPD مقارنةً بـ YNB وعندما تكون درجة الحرارة عند أو أقل من 35 & # x000b0C. أخيرًا ، من بين مضادات الأكسدة الأربعة (RA ، AA ، GSH و PDTC) ، GSH هو الوحيد الذي له تأثير إنقاذ واضح على الخلايا المعالجة بـ AMB مع عدم وجود مثل هذا التأثير على الثقافات المعالجة بـ FLC. وبالتالي ، تظهر بعض العوامل البيئية تأثيرات معاكسة على تثبيط FLC و AMB بوساطة C. neoformans، والتي يجب أخذها في الاعتبار عند تنفيذ العلاجات المضادة للمكورات المشفرة.


الاستنتاجات

من أجل زيادة عيار البروتين المؤتلف المنتج في P. باستوريسغالبًا ما يصنع الباحثون سلالات تحتوي على نسخ متعددة من الجينات ذات الأهمية. بالإضافة إلى ذلك ، بالنسبة للبحث الذي يهدف إلى زيادة سعة التعبير للخلية ، من المفيد إنشاء نسخ متعددة النسخ مع مجموعة من أرقام النسخ من أجل التقييم المنهجي لتأثيرات جهود هندسة الإجهاد. لذلك ، هناك حاجة إلى طريقة ناجحة وسريعة وفعالة للقيام بذلك. تم استخدام طرق مختلفة تاريخيًا بما في ذلك الطلاء مباشرة على وسط انتقائي بتركيزات أعلى من المضادات الحيوية وفي المختبر المتعدد للبلازميد قبل التحول [5]. في عام 2008 Sunga et al. أبلغ عن طريقة ثورية حيث أدى التعرض لزيادة تدريجية في تركيز المضادات الحيوية إلى ظهور سلالات ذات عدد نسخ أعلى [15]. ومع ذلك ، فإننا نقترح بديلاً أسرع وأرخص لهذا ، والذي لا يزال ينتج مجموعة متنوعة من السلالات بأرقام نسخ مختلفة.

لقد أظهرنا أنه من الممكن إنشاء نسخ متعددة النسخ باستخدام طريقة PTVA السائلة مع تغييرات متوسطة كل 12 أو 24 ساعة (L12 أو L24 ، على التوالي ، الأشكال 2 و 4 و 5 والملف الإضافي 3: الجدول S1). ومع ذلك ، أدى L24 إلى طريقة أكثر قوة أدت إلى سلالات ذات نطاق أوسع من عدد النسخ لكل من المضادات الحيوية المختبرة (الشكل 2). باستخدام L12 ، يتم إنشاء النسخ متعددة النسخ في إجمالي 8 أيام ونصف. يستغرق L24 الأكثر فاعلية إجمالي 12 يومًا. في المقابل ، الطريقة الأصلية حيث تُترك كل لوحة لتنمو لمدة 5 أيام ، ينتج عنها فترة 45 يومًا لتوليد نسخ متعددة النسخ. حتى مع بروتوكول L24 الأطول ، تستغرق الطريقة الأصلية أكثر من ثلاثة أضعاف (الشكل 1).

بالإضافة إلى ذلك ، نظرًا لأنه يمكن إجراء PTVA السائل بكميات صغيرة ، يتم تقليل تكلفة المضادات الحيوية بشكل كبير. بشكل عام ، مطلوب أقل من نصف كمية المضاد الحيوي لبروتوكول PTVA السائل ، بغض النظر عن توقيت التغييرات المتوسطة (الجدول 2).

من المثير للدهشة ، في سياق تحقيقنا أننا اكتشفنا أن رقم نسخة البداية للسلالة الأولية يؤثر على متوسط ​​رقم النسخة النهائي ونطاق أرقام النسخ التي تم إنشاؤها ، بغض النظر عن طريقة PTVA المستخدمة. البدء باستنساخ نسخة واحدة ينتج عنه سلالات ذات متوسط ​​عدد نسخ أعلى بعد PTVA من البدء باستنساخ متعدد النسخ ، لكل من PTVA السائل واللوح (الشكل 5). على حد علمنا ، لم يتم الإبلاغ عن هذه الملاحظة من قبل. لذلك ، عند بدء مستعمرات PTVA الأولية ، لا ينبغي تحديدها بناءً على العائد ، بل يجب تحديد نسخة واحدة. ربما تم تسليط الضوء عليه من خلال حقيقة أنه لا يمكن إنشاء نسخ متعددة النسخ إلا باستخدام ناقل pZαGFP عند البدء بنسخة واحدة (الشكل 4) ، قد يكون السبب الأساسي هو التوازن بين معدل النمو المبكر وضغط الاختيار. من المحتمل أن الخلايا التي تحتوي على عدد نسخ أولي أعلى يمكنها البقاء على قيد الحياة بالفعل في المراحل المبكرة من PTVA لأن النسخ الإضافية من جين المقاومة كافية للبقاء على قيد الحياة في البداية بتركيزات منخفضة من المضادات الحيوية ، مما يقلل من كمية تضخيم الناقلات في الجولات المبكرة. ومع ذلك ، قد يؤدي هذا لاحقًا إلى مشاكل إذا كان الناقل لا يمكن تضخيمه بالسرعة الكافية للتكيف مع تركيزات أعلى من المضادات الحيوية عند التحدي. ومع ذلك ، نظرًا لعدم إجراء أي تحقيقات لتحديد الآلية الدقيقة لـ PTVA ، فمن الصعب شرح سبب كون استنساخ نسخة واحدة نقطة انطلاق أكثر فائدة.

أخيرًا ، تم تحديد اختيار علامة الاختيار على أنه مهم. على الرغم من أن النسخ متعددة النسخ قد تم تحقيقها باستخدام كل من علامات التحديد ، إلا أن استخدام Zeocin أدى إلى ارتفاع سلالات عدد النسخ القصوى (الأشكال 2 ، 4). بالإضافة إلى ذلك ، أدى الجمع بين طريقة PTVA السائلة الجديدة و Zeocin إلى ظهور سلالات بمعدلات نمو أسرع و OD بشكل عام أعلى600 (الجدول 1) ، والتي يمكن أن تكون مفيدة عند النظر في الإنتاجية الحجمية.


القطع

تم فحص العديد من المروجين بمستوى تعبير عالٍ وشائع الاستخدام في Bacillus subtilis لتحديد أكثرها كفاءة لتجاربنا في بناء الأجزاء البيولوجية. ثلاثة من هؤلاء المروجين ، Groe (BBa_J100034) ، SecA (BBa_K1469002) ، P43 (BBa_K143013) ، موجودون بالفعل في سجل iGEM.

التسلسلات الأولية للمروجين الفرديين المستخدمة في مشروع البيولوجيا التركيبية لدينا هي كما يلي:

groe-up: CGC GGATCC CCAATACTGTTTTCTCAAATGTATGTA
groe-down: CGG GGTACC TGAAATAACCTCCTCAATAGTATGA

YxiE-up: CGC GGATCC AATTGAAGCGCGCGAAGCCA
YxiE-down: CGG GGTACC جكتكتكككجككتتكجاكتج

SecA-up: CGC GGATCC جاكاتكجتككجتكاجااكجكتت
SecA-down: CGG GGTACC تكاكاكجككتاتتاجاجكاتجت

Ylbp-up: CGC GGATCC جتكاكاكاجتكاكجتكجتجاتا
Ylbp-down: CGG GGTACC ACATATTGTAAACGCTTATTTA

P43 متابعة: CGC GGATCC تجاتاجتجتاتجتتكج
P43-down: CGG GGTACC تاتاتجتاككجكتاتكاكت

السلالات والبلازميدات

كانت سلالة البكتيريا التي استخدمناها هي B. subtilis WB600 ، وكان البلازميد WB0911H-ASN (مع شريط مقاومة الأمبيسلين والكاناميسين المضاد الحيوي). تم التبرع بكل من السلالة والبلازميد إلينا من قبل البروفيسور جيان شين في جامعة جيانان ، الصين.

الشكل 1 pMAA0911H-ASN ناقل التحول
  1. تضخيم PCR للمنتج الجيني ASN
  2. بناء نواقل التحويل (استخراج البلازميدات ، الهضم ، الاقتران والتحويل ، إلخ)
  3. بناء محولات Bacillus subtilis
  4. الرحلان الكهربائي SDS-PAGE لتأكيد التعبير البروتيني ASN
  5. 5- تم تحديد النشاط الأنزيمي لـ ASN بطريقة القياس اللوني. تم تقسيم عملية الكشف إلى خطوتين: التحلل المائي وتلوين ASN.
    1. التحلل المائي لـ ASN: تمت إضافة 100 مل من المحلول المخفف باستخدام ASN إلى خليط 1100 مل من الركيزة والمخزن المؤقت. استمر التفاعل لمدة 10 دقائق عند 37 درجة مئوية. تم إنهاؤه بإضافة 100 مل من حمض ثلاثي كلورو الخليك (1.5 مولار). تم بعد ذلك طرد الخليط عند 12000 دورة في الدقيقة لمدة دقيقتين. يتكون النظام النهائي من 900 ميكرولتر KH2PO4-K2HPO4 عازلة (20 ملي مولار ، درجة الحموضة 7.5) و 200 ميكرولتر من الأسباراجين (189 ملي مولار).
    2. التلوين: تمت إضافة محلول 100 مل من عملية التحلل المائي ASN إلى 3400 ميكرولتر من الماء منزوع الأيونات ، وأضيف 500 مايكرولتر من كاشف نيسلر للتلوين ، وتم اكتشاف قيمة الامتصاص عند 436 نانومتر. (هنا تعريف وحدة نشاط إنزيم ASN هو: كمية الإنزيمات المطلوبة لتحليل L-asparagine لإطلاق 1μM NH3 في دقيقة واحدة عند 37 درجة مئوية.

    نتائج الرحلان الكهربائي SDS-PAGE: (يتم تمييز النطاق الخاص ببروتين ASN عند 43 كيلو دالتون باللون الأحمر)
    العمود M هو العلامة ، العمود 1 ، 2 ، 3 ، 4 ، 5 و 6 لبنى Bacillus subtilis مع بلازميدات WB0911H-ASN (بلازميد أصلي) ، WBGroE ، WBYxiE ، WBSecA ، WBYlbP و WB43 ، على التوالي.

    الشكل 2 الرحلان الكهربائي الهلامي

    الأنشطة الأنزيمية ASN مع محولات مختلفة:

    الشكل 3 النشاط الأنزيمي لـ ANS مقابل الإجهاد
    استنتاج

    يُظهر الرحلان الكهربائي SDS-PAGE (الشكل 2) ومقارنة النشاط الأنزيمي لـ ASN (الشكل 3) أنه يمكن تحسين إنتاج ASN عن طريق استبدال المروجين. ومن بين المحفزات التي ميزناها ، تتمتع P43 بأعلى قوة بدء (كلما زاد نشاط الإنزيم ، زادت سماكة وإشراق النطاق المقابل.

    وبالتالي قمنا بتمييز الطابعات الحيوية الأساسية Groe (BBa_J100034) و SecA (BBa_K1469002) و P43 (BBa_K208002).

    بناء الأجزاء المركبة

    تسلسل فترة الببتيد والبرونسولين:

    من أجل الحصول على إفراز أعلى للإنسولين ، أجرينا تحسين التعبير الجيني وإفراز البرونسولين باستخدام سلالة الخميرة GS115 مع pPICZαA البلازميد كمتجه للتعبير. تم إدخال الببتيد الفاصل بين إشارة الببتيدات الإفرازية و proinsulin لتحسين التعبير الجيني لإفراز proinsulin.

    تسلسل الأحماض الأمينية للببتيد الفاصل هو: EEAEAKR.
    تسلسل النوكليوتيدات هو: GAAGAAGCTGAAGCTGAAGCTAAGA
    التسلسل النهائي للفاصل الزمني الببتيد والبرونسولين هو:

    GAAGAAGCTGAAGCTAAGA ATGGCGCTTTGGATGAGACTGCTGCCGCTGCTGGCACTTCTTGCGCTTTGGGGACCGGACCCAGCAGCGGCATTTGTTAATCAACATCTTTGTGGCTCACATCTTGTGGAAGCACTTTATCTTGTTTGCGGAGAAAGAGGATTTTTCTATACACCGAAAACAAGAAGAGAAGCAGAAGATCTTCAGGTTGGACAGGTTGAACTGGGCGGCGGACCGGGCGCAGGATCACTTCAGCCGCTGGCACTGGAAGGCTCACTGCAAAAAAGAGGCATTGTGGAACAATGCTGTACAAGCATTTGCAGCCTTTATCAGCTGGAAAATTATTGCAATTAA

    البلازميدات

    الشكل 4 خريطة Palsmid

    لقد اخترنا مواقع التقييد على النحو التالي:
    في نهاية 5: EcoR I GAATTC
    في نهاية 3: Kpn I GGTACC

    الطرق التجريبية
    1. ص صيغة وسائط النمو:
      1. وسط YPG: 2.0٪ التربتون ، 1٪ مستخلص الخميرة ، 2٪ الجلسرين (وسط صلب مع 1.5٪ أجار).
      2. وسط YPD الكامل: 2.0٪ تربتون ، 1٪ خلاصة خميرة ، 2٪ جلوكوز.
      3. وسيط BMGY التعريفي: 2.0٪ التربتون ، 1٪ مستخلص الخميرة ، 1.34٪ YNB ، 2٪ الجلسرين ، 10 مليمول / لتر فوسفات البوتاسيوم (درجة الحموضة 6.0) ، البيوتين 4 × 10-5٪ (عن طريق الترشيح المعقم).
      4. وسيط BMMY التعريفي: 2.0٪ التربتون ، 1٪ مستخلص الخميرة ، 1.34٪ YNB ، 0.5٪ ميثانول ، 10 مليمول / لتر فوسفات البوتاسيوم (درجة الحموضة 6.0) ، البيوتين 4 × 10-5٪ (عن طريق الترشيح المعقم).

      تم التقاط مستعمرة واحدة في الصفيحة الحاملة Pichia pastoris GS115 وتم تلقيحها في دورق شاكر سعة 50 مل يحتوي على 5 مل من وسط YPD. تم تحضينها طوال الليل عند 30 درجة مئوية و 200 دورة / دقيقة. تم استخدامه بعد ذلك كبذرة لتلقيح 100 مل سائل YPD في دورق شاكر سعة 500 مل لينمو عند 30 درجة مئوية و 200 دورة / دقيقة حتى OD600 = 1.2-2.0. تم طرد سائل نمو P. pastoris عند 4 درجات مئوية لمدة 5 دقائق عند 1600 × جم ، وتم إزالة المادة الطافية تمامًا. تم إعادة تعليق الحبيبات بـ 10 مل من سوربيتول D (تركيز 1 جزيء جرامي / لتر). تم طرد المعلق عند 4 درجات مئوية لمدة 5 دقائق عند 1600 × جم. تمت إزالة المادة الطافية. تكررت 5 مرات. استخدم 1000 ميكرولتر 1 مول / لتر D- سوربيتول لعمل معلق نهائي ، ضعه في حمام جليدي.

      ضع 80 ميكرولتر من تعليق خلية Pichia pastoris المختص في كوب إلكتروبوريس 0.2 سم مبرد مسبقًا ، أضف 20 ميكرولتر من البلازميد الخطي واخلطه. تم وضع الخليط على الجليد لمدة 5 دقائق (أو - 20 درجة مئوية لمدة دقيقة واحدة). ضع الكوب في جهاز electroporator للتثقيب الكهربائي (الجهد 2.0 كيلو فولت ، وقت الصدمة الكهربائية 5 مللي ثانية). ثم أضف على الفور 1 مل معقم مبرد مسبقًا 1 مول / لتر D-Sorbitol واسترح لمدة 60 دقيقة. تم طلاء لوحة MD بـ 200 ميكرولتر من تعليق خلية Pichia pastoris المختصة ووضعها في فرن عند 30 درجة مئوية لمدة 20-60 دقيقة. يتم زراعة الصفيحة لمدة 3-5 أيام.

      تم اختيار المواد المؤتلفة من P. pastoris بشكل عشوائي من صفيحة YPG-Zeocin (Bleomycin ، نوع من المضادات الحيوية) مع المسواك المعقمة. تمت زراعة المواد المؤتلفة على ألواح YPG-Zeocin بتدرج تركيز زيوسين (300 ميكروغرام / مل ، 600 ميكروغرام / مل). تم ضبط الحاضنة على 30 درجة مئوية لمدة 3-5 أيام. تم فحص المستعمرات في أطباق مختلفة يوميا. وفقًا للاعتماد الكمي بين عدد نسخ الجينات غير المتجانسة ومقاومة zeocin ، يمكن الاستدلال على أن الخلايا التي تنمو فقط على الألواح ذات تركيز منخفض من zeocin تكون ذات أعداد نسخ منخفضة ، وأن الخلايا التي نمت على الصفيحة مع ارتفاع zeocin التركيز بأرقام نسخ عالية.

      تم اختيار المستعمرات المؤتلفة على لوحات YPD بأرقام نسخ مختلفة (100 ، 300 ، و 600 ميكروغرام / مل زيوسين ، على التوالي). تم استخدامها لتلقيح 100 مل وسط BMGY في قوارير 1000 مل ، ووضعها في شاكر لمدة 16-24 ساعة عند 30 درجة مئوية. عندما كان OD600 2-6 ، تم استبدال الثقافة بنفس الحجم من وسيط BMMY للتحريض تحت ظروف معقمة. استمرت الثقافة عند 28 درجة مئوية لمدة 120 ساعة. تمت إضافة الميثانول كل 24 ساعة ليصبح التركيز الكلي للميثانول في السائل 0.5٪. بعد التخمير ، تم ترسيب المادة الطافية بحمض ثلاثي كلورو الخليك (TCA). تمت إضافة 50٪ TCA مع 0.2٪ ديوكسيكولات الصوديوم. تم خلط 25 ٪ من TCA مع 75 ٪ طاف متوسط ​​للطرد المركزي (نسبة الحجم) بالتساوي ووضعها على الجليد لمدة 30 دقيقة. ثم تم طرده بالطرد المركزي (4 ℃ ، 20000 xg ، لمدة 20 دقيقة) ، تمت إزالة المادة الطافية ، وأعيد تعليق الكريات بنسبة 10 ٪ من TCA. تم طرده مرة أخرى (نفس الحالة). قم بإزالة المادة الطافية ، وعلقها بالأسيتون البارد (- 20 درجة مئوية) وطردها (نفس الحالة). تم تجفيف الترسيب بواسطة منفاخ وتم إجراء الكشف الكهربي بواسطة محلول SDS المؤقت.

      نتائج تجريبية:
      1. فحص محولات Pichia Pastoris:
      الشكل 5 فحص التدرج للمحولات ج: فحص زيوسين 300 ميكروغرام / مل | ب: 600 ميكروغرام / مل زيوسين الفرز

      يمكن أن نرى من الشكل 5 أن بعض Pichia pastoris ربما تم دمجها مع نسخ متعددة من نوى التعبير الجيني ، وقد تنمو بشكل أسرع ، ولها قطر مستعمرة أكبر ، وقد تعبر عن جينات proinsulin بشكل أكثر كفاءة.

      الشكل 6 الكهربائي للتعبير عن الأنسولين. الرقم 1-8 يشير إلى عينات من Pichia pastoris المؤتلف ، والتحكم هو نتيجة الرحلان الكهربائي للبرونسولين. توجد الأشرطة المظلمة من رقم 1-8 في نفس مكان التحكم الإيجابي تقريبًا ، مما يشير إلى أن منتج التعبير هو proinsulin.
      استنتاج

      لقد وجد أن أعلى مستوى تعبير للبروتين المؤتلف يمكن أن يصل إلى 150 مجم / لتر ، وهو ما يمثل حوالي 40 ٪ من إجمالي البروتين المفرز لمشروعنا (مع إدخال جديد لببتيد فاصل). بالمقارنة ، كان أعلى تعبير إفرازي للبرونسولين هو 32 مجم / لتر فقط في محولات Pichia pastoris المذكورة في الأدبيات. تم زيادة التعبير عن proinsulin بحوالي 5 مرات بعد عمل البيولوجيا التركيبية لدينا لتعديل الطرف N من proinsulin.

      تحسن

      منع ظهور تقييد الموقع.

      الطرق التجريبية
      1. بناء البكتيريا. يتم تحويل كل من جين HPI الأصلي وجين HPI المعدل إلى بكتيريا B. subtilis
      2. التخمير
      3. استخلاص البروتين (من خلال الاستنزاف الميكانيكي)
      4. بروتين جل الكهربائي
      نتائج تجريبية

      الشكل 7 نتيجة SDS-PAGE للبكتيريا التي تحتوي على جين HPI غير معدل (BBa_K1328003) ، التجربة 1 هي تحكم سلبي - بقي الطاف بعد جمع WB800N. التجربة 2-3 هي مادة طافية للعينة 1 و 2. التجربة 4-6 عبارة عن مواد خارقة مخففة 10 مرات من التجربة 1-3.

      من خلال الشكل 7 ، من المعروف أن البكتيريا التي تحتوي على جين HPI الأصلي تفرز كمية صغيرة من proinsulin لا تكفي لإدراكها بالعين المجردة.

      الشكل 8 هو نتيجة SDS-PAGE للبكتيريا ذات الجين HPI المُحسَّن للكودون و N-terminal المعدل (BBa_K3141001) ، التجربة 1 هي تحكم سلبي - بقي الطاف بعد جمع WB800N. التجربة 2-3 هي مادة طافية للعينة 13 و 16. التجربة 4-6 عبارة عن مواد خارقة مخففة بمقدار 5 مرات من التجربة 1-3.
      استنتاج

      توجد قضبان البروتين المستهدفة بالحجم المتوقع ، حيث يوشك البرونسولين على الظهور - عند 10.5 كيلو دالتون إلى 14 دك. أنتجت البكتيريا ذات جين HPI المعدل كمية كبيرة من البروتين المستهدف (كما هو موضح في الشكل 8). نتيجة لذلك ، وجد أن التعديل على تسلسل HPI زاد من إنتاج البروتين.


      مناقشة

      بكتريا قولونية و S. cerevisiae نوعان من الكائنات الحية النموذجية التي تعمل أيضًا كمصانع خلايا صناعية لإنتاج مجموعة متنوعة من المركبات التي تتراوح من المواد الفعالة صيدلانيًا إلى المكونات الغذائية والوقود الحيوي.

      على الرغم من حقيقة ذلك X. dendrorhous لم يتم دراستها على نطاق واسع مثل بكتريا قولونية أو S. cerevisiae، فإنه يُظهر إمكانات كبيرة ليصبح كائنًا أساسيًا لإنتاج التربين [12]. من أجل تقييم قيمة الخميرة الحمراء كمصنع للخلايا ، قمنا بالتعبير عن شرطي 6 الجين في الثلاثة X. dendrorhous المسوخ ومقارنة إنتاج α- كوبرينين مع بكتريا قولونية و S. cerevisiae سلالات تعبر عن نفس الجين.

      [كدنا] من شرطي 6 تم التعبير عن الجين من قبل الجميع X. dendrorhous الطفرات ، في حين أن الإصدار الجينومي للجين ، عند نقله إلى الخميرة الحمراء ، لم ينتج عنه تراكم ألفا كوبرينين (البيانات غير معروضة) تشير إلى أن X. dendrorhous لا يمكن لصق الجين من بشكل صحيح C. cinereus.

      عندما نمت في وسط غني ، كل شيء X. dendrorhous أظهرت السلالات ، بما في ذلك النوع البري ، معدلات نمو متشابهة جدًا: فقد وصلت إلى OD600 قيم 20 وأنتجت 12 جرامًا كحد أقصى من الوزن الجاف للخلية لكل لتر من المزرعة. وبالمثل ، عند النظر إلى إنتاج α-cuprenene ، فإن السلالات الثلاثة XdCop6, ΔE- كوب 6 و ΔYB-Cop6 لم تظهر اختلافات كبيرة بين بعضها البعض ، حيث تراوحت مستويات سيسكيتيربين من 70 إلى 80 مجم من المركب لكل لتر من المتوسط.

      Comparing Figures 3 and 7, it is clear that, differently from the experiments in the rich medium, the three X. dendrorhous strains shared an altered growth behavior in the minimal medium. في حين XdCop6 و ΔYB-Cop6 reached a maximum cell dry mass of nearly 5 g/L, similar to the one obtained with the wild type strain, ΔE-Cop6 could not produce more than 3.5 g of dry cells per liter of medium. In 2008 Niklitschek and colleagues have reported the difficulty to isolate a X. dendrorhous strain in which both crtE alleles had been knocked out [16], suggesting an important role of this protein in the yeast growth. In the light of the results shown in this study, we can conclude that difference in growth between the ΔE-Cop6 mutant and all the other X. dendrorhous strains in the minimal medium could be explained by a lack, in this particular medium, of compounds important for the yeast growth produced directly or indirectly by the CrtE protein.

      Concomitantly with the reduced growth in the minimal medium, the concentration of α-cuprenene in the dodecane was also affected, reaching values ranging from 15 to 21 mg/L of culture. The decrease in sesquiterpene accumulation can partly be explained by the reduced cell mass and partly by the lower concentration of nutrients in the minimal medium which would induce the cells to minimize the energy consumption by shutting down unnecessary pathways.

      When comparing cell mass accumulation and α-cuprenene production in all X. dendrorhous, بكتريا قولونية و S. cerevisiae strains, the prokaryote showed the lowest values. The low biomass in the bacterium is most likely to be ascribed to a lack of glucose in its growth medium, while the limited sesquiterpene production is due to the lower terpene flux in بكتريا قولونية compared to the two eukaryotes.

      The differences in growth curves and dry weight between the X. dendrorhous و ال S. cerevisiae strains seem to have morphological reasons. X. dendrorhous cells are on average bigger than S. cerevisiae ones [17] and at the same optical density S. cerevisiae cell counts are almost 10 times higher than in X. dendrorhous cultures, meaning that the same OD600 value corresponds to more S. cerevisiae cells than it does for X. dendrorhous. Since, at the beginning of the time course experiments, the initial OD600 for all the strains was set at 0.05, the number of cells initially transferred to the fresh medium was higher in ScCop6 than in all the X. dendrorhous المسوخ. This would explain the delay in growth we observed for XdCop6, ΔE-Cop6 و ΔYB-Cop6 مقارنة ب ScCop6. Additionally, the higher cell mass accumulation observed in the X. dendrorhous strains compared to S. cerevisiae may be due to the red yeast’s bigger sized cells rather than to a higher number of cells.

      The highest α-cuprenene production levels were obtained with the X. dendrorhous strains both in the rich and in the minimal medium experiments. Remarkably, in the YPD medium the gap in sesquiterpene accumulation between the red yeast and the S. cerevisiae strain was far more pronounced. We assume that, since the complete medium does not allow selective pressure on ScCop6, which was isolated by its ability to grow on minimal medium lacking uracil, the strain might have undergone a reduction in plasmid copy number.

      في حين ScCop6 mutants contain an average of 20 copies of Cop6، ال X. dendrorhous white mutants possess just one copy of the gene since the recombination of the constructs can occur only once in the single crtE أو crtYB الجينات. In order to obtain a mutant with a higher number of integrations of the gene in the genomic rDNA, we transformed the X. dendrorhous wild type strain with a higher concentration of the DNA fragment from the pPR-Cop6 vector and selected the transformants on YPD medium containing a concentration of geneticin 5 times higher than normal, hoping for gene amplification. Unfortunately, no colony grew after this transformation and we could not evaluate the effect of more gene copies on the α-cuprenene accumulation.

      Nevertheless, we can safely assume that the concentration of the precursors is not a limiting factor in the sesquiterpene production in X. dendrorhous, since the strain XdCop6 can easily sustain the production of both α-cuprenene and astaxanthin, especially when grown in the YPD rich medium. The production of both terpene compounds in XdCop6 confirms the hypothesis that a higher gene copy number would positively influence the α-cuprenene production in X. dendrorhous.

      ختاما، X. dendrorhous shows great promise since it has the GRAS status, it grows at room temperature in minimal media, and it has already been used by industry for the production of astaxanthin. We discovered that it can produce at least three non-native sesquiterpenes, pentalenene [12], α-cuprenene and cubebol (data not shown). بالإضافة إلى، X. dendrorhous is the best microorganism, among the ones we have analyzed, to be used for the production of α-cuprenene. A better understanding of the molecular biology of this yeast will prove useful for the identification of stronger promoters for a higher gene expression.

      In light of the aforementioned advantages and of the provided results, X. dendrorhous is an interesting candidate for being used as a cell factory for the production of terpenes.


      Aureobasidin A for yeast two-hybrid studies

      Aureobasidin A (AbA) is a cyclic depsipeptide antibiotic, isolated from the filamentous fungus Aureobasidium pullulans R106, which is toxic to yeast at low concentrations (0.1&ndash0.5 µg/ml). Sensitive species include خميرة الخميرة, شيزوساكارومايس بومب, المبيضات glabrata, نيدولانس الرشاشيات، و A. niger.

      AbA inhibits a yeast enzyme, inositol phosphorylceramide (IPC) synthase, which is expressed from the AUR1 gene (Takesako et al. 1993, Hashida-Okado et al. 1996). Expression of a mutant gene, AUR1-C, in transformed yeast confers resistance to the drug. It is this gene that is used in Matchmaker Gold systems as a reporter for protein interactions.

      Aureobasidin A (AbA) is a cyclic depsipeptide antibiotic, isolated from the filamentous fungus Aureobasidium pullulans R106, which is toxic to yeast at low concentrations (0.1&ndash0.5 µg/ml). Sensitive species include خميرة الخميرة, شيزوساكارومايس بومب, المبيضات glabrata, نيدولانس الرشاشيات، و A. niger.

      AbA inhibits a yeast enzyme, inositol phosphorylceramide (IPC) synthase, which is expressed from the AUR1 gene (Takesako et al. 1993, Hashida-Okado et al. 1996). Expression of a mutant gene, AUR1-C, in transformed yeast confers resistance to the drug. It is this gene that is used in Matchmaker Gold systems as a reporter for protein interactions.


      شاهد الفيديو: أفضل طريقة لحفض المضادات الحيوية (ديسمبر 2022).