معلومة

6.7: مجموعة الجينات Ribosomal RNA (rRNA) - علم الأحياء

6.7: مجموعة الجينات Ribosomal RNA (rRNA) - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

تُظهر الصورة أعلاه صورة مجهرية إلكترونية (26500x) تُظهر نسخ ترميز الحمض النووي RNA الريبوسوم (الرنا الريباسي) في نواة خلية البويضة النامية للنيوت المرقط.

تمتلك حقيقيات النوى عدة مئات من الجينات المتطابقة التي تشفر الحمض النووي الريبوزي.

الخيوط الطويلة (السهم الأخضر) عبارة عن جزيئات DNA مغلفة بالبروتينات. الألياف الممتدة في مجموعات من المحاور الرئيسية هي جزيئات الحمض النووي الريبي الريبوزومي والتي سيتم استخدامها في بناء ريبوسومات الخلية.

لاحظ كيف يبدأ النسخ عند أحد طرفي كل جين ، مع زيادة طول جزيئات الحمض النووي الريبي (السهم الأحمر) مع تقدمهم نحو الاكتمال.

لاحظ أيضًا العدد الكبير (حتى 100) من جزيئات الحمض النووي الريبي التي يتم نسخها الوقت ذاته من كل جين.

يبدو أن أجزاء الحمض النووي العارية من الحمض النووي الريبي غير نشطة وراثيا. (بإذن من O.L Miller ، Jr. ، و Barbara R.Bety ، قسم الأحياء ، مختبر أوك ريدج الوطني.)


RNA الريبوسوم

سيراجع محررونا ما قدمته ويحددون ما إذا كان ينبغي مراجعة المقالة أم لا.

RNA الريبوسوم (rRNA)، جزيء في الخلايا التي تشكل جزءًا من عضية تصنيع البروتين المعروفة باسم الريبوسوم والتي يتم تصديرها إلى السيتوبلازم للمساعدة في ترجمة المعلومات الموجودة في الرنا المرسال (mRNA) إلى بروتين. الأنواع الثلاثة الرئيسية من RNA التي تحدث في الخلايا هي rRNA و mRNA و RNA الناقل (tRNA).

يتم تصنيع جزيئات الرنا الريباسي في منطقة متخصصة من نواة الخلية تسمى النواة ، والتي تظهر كمنطقة كثيفة داخل النواة وتحتوي على الجينات التي تكوّد الرنا الريباسي. تختلف rRNAs المشفرة في الحجم ، حيث يتم تمييزها على أنها إما كبيرة أو صغيرة. يحتوي كل ريبوسوم على واحد على الأقل من الرنا الريباسي الكبير وواحد على الأقل من الرنا الريباسي الصغير. في النواة ، تتحد الرنا الريباسي الكبير والصغير مع بروتينات الريبوسوم لتشكيل الوحدات الفرعية الكبيرة والصغيرة للريبوسوم (على سبيل المثال ، 50S و 30S ، على التوالي ، في البكتيريا). (يتم تسمية هذه الوحدات الفرعية عمومًا وفقًا لمعدل الترسيب ، الذي يتم قياسه بوحدات Svedberg [S] ، في مجال طرد مركزي.) يتم تصنيع بروتينات الريبوسوم في السيتوبلازم ونقلها إلى النواة للتجميع الفرعي في النواة. ثم يتم إرجاع الوحدات الفرعية إلى السيتوبلازم للتجميع النهائي.

تشكل الرنا الريباسي بنى ثانوية واسعة النطاق وتلعب دورًا نشطًا في التعرف على الأجزاء المحفوظة من الرنا المرسال و الرنا المرسال. في حقيقيات النوى (الكائنات الحية التي تمتلك نواة محددة بوضوح) ، قد توجد في أي مكان من 50 إلى 5000 مجموعة من جينات الرنا الريباسي وما يصل إلى 10 ملايين ريبوسوم في خلية واحدة. في المقابل ، تحتوي بدائيات النوى (الكائنات الحية التي تفتقر إلى النواة) عمومًا على مجموعات أقل من جينات الرنا الريباسي والريبوزومات لكل خلية. على سبيل المثال ، في البكتيريا الإشريكية القولونية، تقوم سبع نسخ من جينات الرنا الريباسي بتجميع حوالي 15000 ريبوسوم لكل خلية.

هناك اختلافات جذرية بين بدائيات النوى في المجالات العتيقة والبكتيريا. هذه الاختلافات ، بالإضافة إلى كونها واضحة في تكوين الدهون وجدران الخلايا واستخدام مسارات التمثيل الغذائي المختلفة ، تنعكس أيضًا في تسلسل الرنا الريباسي. تختلف الرنا الريباسي للبكتيريا والعتائق عن بعضها البعض كما هي من الرنا الريباسي حقيقية النواة. هذه المعلومات مهمة في فهم الأصول التطورية لهذه الكائنات ، لأنها تشير إلى أن الخطوط البكتيرية والبدئية قد تباعدت عن السلائف الشائعة إلى حد ما قبل أن تتطور الخلايا حقيقية النواة.

في البكتيريا ، يكون الجين الذي ثبت أنه الأكثر إفادة للتحقيق في الارتباط التطوري 16S الرنا الريباسي، وهو تسلسل من الحمض النووي الذي يشفر مكون الحمض النووي الريبي للوحدة الفرعية الأصغر للريبوسوم البكتيري. ال 16S الرنا الريباسي الجين موجود في جميع البكتيريا ، ويحدث الشكل المرتبط به في جميع الخلايا ، بما في ذلك خلايا حقيقيات النوى. تحليل 16S الرنا الريباسي كشفت التسلسلات من العديد من الكائنات الحية أن بعض أجزاء الجزيء تخضع لتغيرات جينية سريعة ، وبالتالي التمييز بين الأنواع المختلفة داخل نفس الجنس. تتغير المواقف الأخرى ببطء شديد ، مما يسمح بتمييز مستويات تصنيفية أوسع بكثير.

تنبع الآثار التطورية الأخرى للرنا الريباسي من قدرته على تحفيز تفاعل البيبتيديل ترانسفيراز أثناء تخليق البروتين. المحفزات تعزز نفسها بنفسها - فهي تسهل التفاعلات دون أن تستهلك نفسها. وهكذا ، فإن الرنا الريباسي ، في عمله كمستودع للأحماض النووية وكمحفز ، يُشتبه في أنه لعب دورًا رئيسيًا في التطور المبكر للحياة على الأرض.

محررو Encyclopaedia Britannica تمت مراجعة هذه المقالة وتحديثها مؤخرًا بواسطة كارا روجرز ، كبيرة المحررين.


الملخص

الفواصل الداخلية المنسوخة لمجموعة جينات الحمض النووي الريبي الريبوزومي النووي ، والتي يطلق عليها ITS1 و ITS2 ، هي العلامات النووية الأكثر استخدامًا لتحليلات النشوء والتطور عبر العديد من مجموعات حقيقيات النوى بما في ذلك معظم عائلات النباتات. تشمل أسباب شعبية هذه العلامات ما يلي: 1.) سهولة التضخيم بسبب ارتفاع عدد النسخ من مجموعات الجينات ، 2.) الأساليب المتاحة الفعالة من حيث التكلفة والبادئات المحفوظة للغاية ، 3.) العلامات سريعة التطور (أي المتغير بين التقريب 4) الافتراض (و / أو المعالجة) أن هذه التسلسلات غير وظيفية ، وعلامات تطور نسبي محايدة. هنا ، تشير تحليلاتنا لـ ITS1 و ITS2 لـ 50 نوعًا إلى أن كلا التسلسلين يخضعان لقيود انتقائية بدلاً من ذلك للحفاظ على البنية الثانوية المناسبة ، ومن المرجح أن تحافظ على وظائف الربط الذاتي الكاملة ، وبالتالي فهي ليست علامات تطور محايد. تشير نتائجنا إلى أن غالبية مواقع التسلسل تتطور بشكل مشترك مع مواضع أخرى لتشكيل بنية ثانوية مناسبة ، والتي لها آثار على الاستدلال الوراثي. وجدنا أيضًا أن أقل حالة طاقة والعدد الإجمالي للهياكل الثانوية البديلة المحتملة تختلف اختلافًا كبيرًا بين مناطق أنظمة النقل الذكية والتسلسلات العشوائية ذات الطول الإجمالي المتطابق ومحتوى Guanine-Cytosine (GC). أخيرًا ، نراجع الأدلة الحديثة التي تسلط الضوء على بعض المشكلات الإضافية مع استخدام هذه المناطق كعلامات وحيدة لدراسات علم الوراثة ، وبالتالي نوصي بشدة بعلامات إضافية ونهج فعالة من حيث التكلفة للدراسات المستقبلية لتقدير العلاقات النشوء والتطور.

الاقتباس: Edger PP و Tang M و Bird KA و Mayfield DR و Conant G و Mummenhoff K et al. (2014) تحليلات البنية الثانوية للفواصل المنقولة الداخلية للـ rRNA النووي وتقييم فائدتها التطورية عبر الكرنب (الخردل). بلوس واحد 9 (7): e101341. https://doi.org/10.1371/journal.pone.0101341

محرر: Elvira Hörandl ، جامعة جوتنجن ، ألمانيا

تم الاستلام: 21 آب 2013 وافقت: 6 يونيو 2014 نشرت: 1 يوليو 2014

حقوق النشر: © 2014 Edger et al. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ بأي وسيلة ، بشرط ذكر المؤلف الأصلي والمصدر.

التمويل: تعترف PPE و JCP بالدعم المقدم من مؤسسة العلوم الوطنية الأمريكية (DEB 1146603 و DBI 1110443 و NPGI 1202793). م. تمويل معترف به من مؤسسة الأبحاث الألمانية (DFG) بموجب الكود KO2302-11 / 1. 1. http://www.nsf.gov/ 2. http://www.dfg.de/en/. لم يكن للممولين أي دور في تصميم الدراسة أو جمع البيانات وتحليلها أو اتخاذ قرار النشر أو إعداد المخطوطة.

تضارب المصالح: وقد أعلن الباحثون إلى أن لا المصالح المتنافسة موجودة.


التحليل والتحسين والتحقق من مسوحات أمبليكون الجين الرنا الريباسي 16S المتولدة من Illumina

توسع استكشاف المجتمعات الميكروبية عن طريق تسلسل جينات الرنا الريباسي 16S باستخدام أدوات تسلسل منخفضة التكلفة وعالية الإنتاجية. اكتسب التسلسل الجيني 16S rRNA المستند إلى Illumina مؤخرًا شعبية أكثر من 454 تسلسلًا حراريًا نظرًا لتكاليفه المنخفضة ودقته العالية وإنتاجيته الأكبر. على الرغم من أن التقارير الأخيرة تشير إلى أن Illumina و 454 pyrosequencing يوفران مقاييس تنوع بيتا مماثلة ، فلا يزال يتعين إثبات أن تدفقات عمل التسلسل الحراري الموجودة مسبقًا 454 يمكن أن تنتقل مباشرة من 454 إلى تسلسل Illumina MiSeq ببساطة عن طريق تغيير محولات التسلسل الخاصة بالبادئات. في هذه الدراسة ، قمنا بتعديل 454 بادئة تسلسل حراري تستهدف المناطق شديدة التغير V4-V5 من جين 16S rRNA لتكون متوافقة مع متواليات Illumina. تم تحليل المجتمعات الميكروبية من الأبقار والبشر والعلقات والفئران والصرف الصحي والنمل الأبيض ومجتمع وهمي بواسطة 454 وتسلسل MiSeq لمنطقة V4-V5 وتسلسل MiSeq لمنطقة V4. كشف تحليلنا أن تجميع OTU المستند إلى المرجع وحده قدم تحيزات مقارنة بتكتل de novo ، مما يمنع بعض الأصناف من الملاحظة في بعض العينات. بناءً على ذلك ، ابتكرنا ونوصي بخط أنابيب تحليل يتضمن دمج القراءة ، وتصفية الملوثات ، والتكتل المستند إلى المرجع متبوعًا بتجميع de novo OTU ، والذي ينتج مقاييس تنوع متوافقة مع تحليل مجموعات de novo OTU. تم اكتشاف مستويات منخفضة من تلوث مجموعة البيانات بتسلسل Illumina الذي يمكن أن يؤثر على التحليلات التي تتطلب نُهجًا شديدة الحساسية. أثناء الانتقال إلى منصات التسلسل المستندة إلى Illumina يعد بتقديم رؤى أعمق حول اتساع ووظيفة التنوع الميكروبي ، تظهر نتائجنا أنه يجب توخي الحذر لضمان أن التسلسل والمعالجة لا يحجبان التنوع الميكروبي الحقيقي.

بيان تضارب المصالح

تضارب المصالح: يعلن المؤلفون أنه لا توجد مصالح متنافسة.

الأرقام

الشكل 1. مقارنة بين 454 و Illumina ...

الشكل 1. مقارنة 454 وجودة تسلسل Illumina.

مؤامرة تصور الوسيط لكل قاعدة ...

الشكل 2. تتكرر طريقة معالجة RDS ...

الشكل 2. طريقة معالجة RDS مكررة من جديد تجميع OTU أفضل من المجموعات المستندة إلى المرجع.

الشكل 3. تحليل التنوع بيتا للجميع ...

الشكل 3. تحليل التنوع بيتا لجميع مجموعات البيانات.

تظهر مخططات تحليل الإحداثيات الرئيسية ثلاثية الأبعاد ...

الشكل 4. تأثير طريقة المعالجة على ...

الشكل 4. تأثير طريقة المعالجة على التركيب التصنيفي لمجموعات بيانات المجتمع الصورية.

الشكل 5. آثار طريقة المعالجة و ...

الشكل 5. آثار طريقة المعالجة ونسخة قاعدة بيانات Greengenes على التركيب التصنيفي لـ ...


فرسي ثيليريا محيط

ال 18 ثانية تسلسل الجين RNA الريبوسومي للعدوى الخيول ثيليريا تنقسم الأنواع إلى خمس مجموعات (الشكل 1) ، والتي ستتم مناقشتها بالتفصيل لاحقًا في هذه المراجعة. لأغراض هذه المراجعة ، تشتمل الطفيليات في rDNA clade A على T. Equi (بالمعنى الضيق) التي تتميز بأفضل ما يميزها من حيث البيولوجيا والأهمية الاقتصادية ، بينما تلك الموجودة في الواجهات B-E ، (بما في ذلك T. هاني في clade C) T. Equi (سينسو لاتو).

18 ثانية تم وضع تسلسلات rDNA في GenBank وتم تحديدها على أنها Theileria Equi ولكن تم اكتشافها داخل أنواع مضيفة مختلفة ومحاذاة في CLC Genomics Workbench v.10.1.1 (Qiagen) ، جنبًا إلى جنب مع outgroup 18 ثانية متواليات rDNA من البيروبلازميدات الأخرى كما هو محدد في الشكل. تم قطع جميع التسلسلات بطول مماثل يبلغ 401 نقطة أساس ، وتمتد إلى المنطقة الرابعة شديدة التغير من الطول الكامل 18 ثانية rDNA. تمت مقارنة التسلسلات المحاذاة في أقصى احتمال للتطور في نفس البرنامج ، مع نموذج استبدال النوكليوتيدات Kimura 80 ، مع استخدام ربط الجوار في بناء الأشجار الأولية لتمكين الاستدلال التطوري المحسن. تم إجراء خمسمائة مكررات في تحليل التمهيد مع قيم للعقد أعلى من حد القطع البالغ 50 المشار إليه على الشجرة للفروع الرئيسية. توفر الشجرة عينة تمثيلية من المتواليات الريبوسومية التي تقع في مجموعات متميزة عبر أنواع مضيفة مختلفة مصابة ولا يُقصد منها تقديم تصوير شامل لعلاقات جميع الخيول. ثيليريا يعزل

تشير دراسات الجينوم المقارنة [12 ، 21] إلى ذلك T. Equi و T. هاني لها ميزات وسيطة بين ثيليريا و بابيزيا وقد تمثل تصنيفًا مميزًا ، أقرب إلى ثيليريا من بابيزيا. على غرار كل الآخرين ثيليريا النيابة. ، T. Equi يخضع لمرض انفصام في الكريات البيض قبل تطور مراحل داخل الكريات الحمر [22] ، على عكس بابيزيا spp. ، التي تصيب كريات الدم الحمراء في الثدييات فقط. لم يتم بعد إثبات مرحلة دورة الحياة داخل الخلية T. هاني، والبحث جار لتحديد ما إذا كان أحدهم موجودًا.

تحليل البنية التحتية ثيليريا النيابة. التي تمت دراستها حتى الآن تُظهر أن دخول خلايا الثدييات يتضمن "انزلاق" من أغشية الطفيلي والمضيف المتجاورين بشكل وثيق ، ولكنه لا يتطلب ارتباطًا يعتمد على التوجيه للمركب القمي وتحرير محتويات العضية ، كما هو الحال في بابيزيا النيابة. وأنواع معظم أجناس apicomplexan الأخرى [6 ، 7]. علاوة على ذلك ، في ثيليريا، تشارك rhoptries والعضيات القمية الأخرى في التأسيس داخل الخلية المضيفة ، ولكن ليس في عملية الدخول كما هو الحال في معظم Apicomplexa. دور العضيات المعقدة القمية في T. Equi و T. هاني إدخال الخلية المضيفة غير معروف حاليًا ، على عكس T. بارفا و T. annulata, T. Equi تمتلك الحيوانات البوغية والميروزويت هياكل مورفولوجية مشابهة للميكرونيم [23] وبالتالي قد تستخدم آلية مختلفة لغزو الخلية المضيفة. آلية مهمة واحدة للمناعة الوقائية للتحول ثيليريا، بما فيها T. بارفا، يعتمد على كل من تطوير استجابة خلايا CD8 + T لخلايا الدم البيضاء المضيفة المصابة بالششيزونت واستجابة الجسم المضاد لمستضدات sporozoite [24 ، 25]. بينما لا تتحول ثيليريا لديهم أيضًا فترة وجيزة من الفصام في الكريات البيض المضيفة [22] ، ولا يزال وجود وأهمية الاستجابة المناعية الخلوية لهذه المرحلة الطفيليّة غير معيّنة. على عكس التحويل الأكثر شهرة ثيليريا الأنواع ، ولكنها تشبه بابيزيا، انتقال T. Equi في القراد يحدث على حد سواء ترانستاديالي وداخل الاستاد [1].

على عكس الآخرين ثيليريا, T. Equi-تصيب طفيليات النوع عائلات متعددة من الثدييات ، مع تقارير عن إصابة الكلاب [26 ، 27] ، والجمال [28] ، والتابير [29] ، والرباط المائي ، والماشية ، والماعز [30] ، والأغنام [31] بالإضافة إلى الخيول. لوحظ مرض سريري في حيوانات التابير والكلاب ، ولكن ليس في الإبل. معظم المتحولين وغير المتحولين الآخرين ثيليريا تتطفل الأنواع فقط على عائلة واحدة من الثدييات وغالبا ما تتطفل من نوع واحد إلى ثلاثة أنواع فقط داخل تلك العائلة [32]. Theileria Equi هو أيضًا منحل في نطاق نواقل القراد ixodid المستخدمة ، مع ما لا يقل عن 14 نوعًا من أنواع القراد المتباينة نسبيًا في أربعة أجناس مختلفة متورطة في الانتقال الطبيعي والتجريبي [2]. قد تكون القدرة على البقاء في العديد من أنواع الثدييات وناقلات المفصليات نتيجة لتكملة أكبر للجينات في T. Equi، الذي يحتوي جينوم قاعدته البالغة 11.7 ميغا بايت (MB) على جينات ترميز البروتين المتوقعة لعام 1985 والتي تكون غائبة في بابيزيا بوفيس وتحويل الخلايا المضيفة ثيليريا الأنواع [12]. ثيليريا هانيي يحتوي على جينوم 10 ميجا بايت تقريبًا ، متوسط ​​الحجم بين تحويل الخلايا المضيفة ثيليريا و T. Equi. يحتوي هذا النوع على ما لا يقل عن 878 جينًا غائبًا T. بارفا و T. annulata [33].

الميزات الجديدة لـ T. Equi يشمل الجينوم توسعات كبيرة في عائلة بروتين ناقل الكاسيت متعدد النسخ ATP وعائلة البروتين الإفرازي من النوع الثاني [21] ، والتي قد تساهم في قدرة الطفيلي على البقاء في أنسجة مضيفة ومتعددة متعددة. العديد من الجينات الإضافية في T. Equi و T. هاني توجد في عائلات جينية متعددة النسخ لا تظهر أي هوية تسلسلية مهمة للبروتينات في قواعد البيانات العامة ، على الرغم من أن بعضها يحتوي على مجالات محفوظة. وبالتالي ، فإن الفهم المحسن للأساس الجزيئي للمضيف المختلط وتفضيلات المتجهات ينتظر نظامًا للمعالجة الجينية والتنميط الظاهري لهذه الطفيليات. الخيول المعدية ثيليريا النيابة. تمتلك FAINT (يرتبط بشكل متكرر بـ ثيليريا) في إطارات قراءة متعددة مفتوحة (ORFS). توجد مجالات FAINT ، التي تكون وظيفتها غير معروفة ، في البروتينات الافتراضية لـ T. بارفا, تي أنولاتا و ت. أورينتاليس، لكنها غائبة في تلك الخاصة بـ بابيزيا الأنواع [34 ، 35].


2. شظايا RNA الريبوسوم (rRFs)

الأجزاء المشتقة من الرنا الريباسي (rRFs) عبارة عن رنا قصيرة غير مشفرة (ncRNAs) مشتقة من الرنا الريباسي النووي والميتوكوندريا 22. غالبًا ما تكون هذه الأجزاء وفيرة ويتم تعديلها بطريقة تعتمد على الجنس والسكان.

يعد تسلسل الجيل التالي (NGS) أداة قوية لاكتشاف الحمض النووي الريبي وقد أتاح للعلماء تصنيف الحمض النووي الريبي في خلايانا بطريقة غير متحيزة. تم اكتشاف العديد من الحمض النووي الريبي المهم والقصير ووصفت في سياق الصحة والمرض. كان معروفًا منذ عدة سنوات أن الحمض النووي الريبي الصغير غير المشفر (sncRNAs) مثل microRNAs (miRNAs) ، و mRNA isoforms (isomiRs) ، وشظايا مشتقة من الحمض الريبي النووي النقال (tRFs) لها أدوار وظيفية في تنظيم التعبير الجيني. أظهر مختبر Rigoutsos أن كلاً من miRNAs و tRNAs ينتجان بطريقة صارمة & # 8220clouds & # 8221 من isomiRs 15 و tRFs 16. تشترك IsomiRs و tRFs من نفس القالب الأبوي عادةً في نفس التسلسل الأساسي وتختلف في نقاط النهاية الخاصة بها. أظهر مختبر Rigoutsos أيضًا أن هويات ووفرة isomiRs و tRFs تعتمد على السمات الشخصية مثل الجنس والأصل السكاني والعرق / الإثنية وكذلك على نوع الأنسجة وحالة الأنسجة ونوع المرض 17 & # 821121.

وصف منشور حديث من مختبر Rigoutsos rRFs التي يتم إنتاجها من الرنا الريباسي الستة (الشكل 2). قاموا بتحليل ملفات تعريف sncRNA لخطوط الخلايا اللمفاوية المستمدة من 434 مشاركًا في مشروع 1000 جينوم. يتألف المشاركون من الرجال والنساء الأصحاء من خمس مجموعات جغرافية. كان هدفنا هو فهم الملامح العامة والخاصة بالسكان من rRFs. لقد أظهرنا أن rRNAs تنتج & # 8220clouds & # 8221 من rRFs بطريقة صارمة. أظهرنا أيضًا أن هناك آلافًا من rRFs تم إنتاجها من مواقع محددة عبر جميع الرنا الريباسي الستة. تتمتع هذه rRFs بملفات طول ووفرة فريدة. أظهرت تحليلاتنا أن العديد من هذه rRFs موجودة في كل مكان وموجودة في جميع العينات التي تم تحليلها. ومع ذلك ، وجدنا أيضًا عددًا كبيرًا من rRFs التي تعتمد على السمات الشخصية للمتبرعين بما في ذلك الجنس والأصل السكاني ، وكذلك على نوع الأنسجة والمرض. تعكس هذه الخصائص النتائج المعملية السابقة على isomiRs و tRFs.

الشكل 2: الرنا الريباسي النووي الأربعة واثنان من الميتوكوندريا تنتج العديد من الشظايا (rRFs) بطريقة صارمة

rRFs هي أحدث إضافة إلى ذخيرة sncRNA. إنها تمثل الفئة الثالثة من sncRNAs التي يعتمد إنتاجها على السمات الشخصية والسياق الخلوي. الطريقة التي يتم بها إنتاج rRFs غير معروفة. ومن غير المعروف أيضًا آلية عمل rRFs & # 8217 والأدوار الوظيفية. تعد هذه الأسئلة حاليًا مجالًا للتحقيق النشط من قبل الباحثين في مركز الطب الحسابي في Jefferson & # 8217s.


المواد والأساليب

سلالات الخميرة والبلازميدات وظروف النمو للتضخيم المفرط

تم اشتقاق سلالات الخمائر المستخدمة في هذه الدراسة من NOY408-1b في الخلفية الوراثية W303 ومن سلالة S288c (OpenBiosystems) وهي مدرجة في الجدول S1. نمت السلالات عند 30 درجة مئوية في وسط YPD باستثناء hst3 hst4 متحولة مزدوجة تمت زراعتها عند 23 درجة مئوية. لرصد تضخيم rDNA المفرط ، فإن rtt109 متحولة مع البلازميد المحتوي على الجالاكتوز فوب 1 (YCplac22-غال-فوب 1) تمت زراعته مسبقًا في وسط صناعي كامل مطروحًا منه التربتوفان مع رافينوز (SC-trp + raf). ثم تم نقل السلالة إلى SC-trp مع الجالاكتوز بدلاً من رافينوز (في الوقت صفر) وحصدت في الأوقات المحددة (0 ، 6 ، 12 ، 18 ، 24 ، 36 ساعة) لتحضير الحمض النووي الجيني في سدادات agrose [43]. كعنصر تحكم ، فإن RTT109 تم رصد السلالة بالتوازي. تمت إضافة رافينوز (حجم 1/10 من مخزون رافينوز 10x) والجالاكتوز قبل الاستخدام مباشرة. تم إنشاء سلالات الخميرة مع بدائل الأحماض الأمينية في هيستون K56 بواسطة خلط البلازميد [44].

فحص الجينوم لطفرات الخميرة مع عدد نسخ rDNA مرتفع

تمت تنقية الحمض النووي الجينومي من ∼4.800 طفرة خميرة من مكتبة الحذف على مستوى الجينوم (OpenBiosystems) كما هو موصوف [43]. ثم تم إخضاعهم للرحلان الكهربي للهلام النبضي كما هو موضح أدناه. كانت المواد الهلامية ملطخة ببروميد إيثيديوم (EtBr). السلالات المتحولة ذات الكروموسوم XII الأطول من علامة الحجم 3.13 ميجا بايت (H. وينجي) على أنها طفرات rDNA مفرطة التضخيم (الجدول 1). استخدمنا جلًا عريضًا بمشط طويل (45 سنًا) لإجراء الفصل الكهربائي. تم تكديس ثلاثة أنواع من المواد الهلامية الرقيقة على بعضها البعض في خزان الرحلان الكهربائي للسماح بالتشغيل المتزامن لعينات ∼130.

الرحلان الكهربائي للهلام النبضي والتهجين الجنوبي

تم إجراء الفصل الكهربائي للهلام النبضي (CHEF) باستخدام CHEF Mapper XA (BioRad) والتهجين الجنوبي كما هو موصوف [25] ، [43]. كانت الظروف عبارة عن زمن نبضة 300-900 ثانية و 100 فولت لمدة 68 ساعة عند 14 درجة مئوية في هلام الاغاروز بنسبة 0.8٪.

2D الكهربائي للهلام

لاكتشاف وسيطة التكرار وإعادة التركيب بواسطة الرحلان الكهربائي للهلام ثنائي الأبعاد أثناء التضخيم المفرط ، تم تحضير الحمض النووي من الخلايا (YSI204 ، YSI205) التي تنمو في SC-trp + Gal (9 ساعات) و SC-trp + Raf ، وتم هضمها باستخدام نهيأنا في المقابس [43]. تم الكشف عن rDNA باستخدام مسبار خاص بـ rDNA. تم عزل الحمض النووي وهضمه في سدادات الاغاروز.

للكشف عن ERC أثناء التضخيم المفرط بواسطة الرحلان الكهربائي للهلام ثنائي الأبعاد ، تم عزل الحمض النووي من الخلايا قبل وبعد 9 ساعات من إطلاقه في SC-trp + Gal. لفصل الحمض النووي الكبير بين 5 و 50 كيلو بايت بواسطة 1D الكهربائي للهلام ، تم استخدام هلام SeaKem Gold Agarose 0.3٪ (Lonza) في TAE عند 1 فولت / سم لمدة 20 ساعة. بعد إزالة كل ممر أعلى من 5 كيلو بايت من هلام 1D ، تم إجراء الترحيل الكهربائي للهلام ثنائي الأبعاد في 1.0٪ جل SeaKem LE Agarose (Lonza) مع EtBr عند 6 فولت / سم لمدة 5 ساعات عند 4 درجات مئوية. تم تنظيف الجل وتم تهجين جزء من الغشاء الذي يحتوي على DNA أطول من 7 كيلو بايت باستخدام مسبار خاص بـ rDNA. تم فحص الجزء الآخر من الغشاء الذي يحتوي على DNA أقصر من 7 كيلو بايت URA3. تم تطبيع إشارة ERC إلى URA3 إشارة في كل لطخة. تم تحديد الكميات النسبية من ERC من ثلاث تجارب مستقلة كما هو موضح في الشكل 8B. للكشف عن تضخيم الدائرة المتداول (الشكل 8 د) بواسطة الرحلان الكهربائي للهلام ثنائي الأبعاد ، تم استخدام الخلايا التي تحتوي على بلازميد IGS ، YEplac195 التي تحتوي على منطقة IGS من rDNA. تم عزل الحمض النووي من الخلايا بعد 48 ساعة من إطلاقه في SC-trp + Gal. كانت الشروط المستخدمة في الرحلان الكهربائي للهلام ثنائي الأبعاد وتحريض التضخيم المفرط مماثلة لتلك الموصوفة أعلاه ، باستثناء أنه تم هضم الحمض النووي باستخدام Bglالثاني قبل الكهربائي. Bglلا يقطع II البلازميد ولكنه يقطع الحمض النووي الريبي الصبغي ، بحيث تشكل البلازميدات المدمجة في الكروموسوم فقط الهياكل الخطية التالية Bglالثاني الهضم. تم الكشف عن تسلسل البلازميد باستخدام مسبار محدد (أمبير).

الترسيب المناعي للكروماتين

تم إجراء الترسيب المناعي للكروماتين كما هو موصوف [6].

مجهر القوة الذرية (AFM)

جزء الحمض النووي المتبقي في سدادة هلام agrose بعد الرحلان الكهربائي للهلام النبضي تم استخلاصه عن طريق التكسير. تم إجراء مراقبة AFM كما هو موضح [45]. أثناء تحضير العينة ، تم تقطيع الحمض النووي إلى أجزاء أصغر (& lt∼50 كيلو بايت). من بين هذه الأجزاء (1500) ، بحثنا عن الدائرة ذات الحجم المناسب (8-11 كيلو بايت). تم إجراء التصوير باستخدام أداة Didital MultiMode AFM في وضع التنصت. تم استخدام الصورة J (المعاهد الوطنية للصحة) لقياس طول الحمض النووي.


تحديد موقع مطلوب لنشاط منع شوكة تكرار الحمض النووي في مجموعة جينات الرنا الريباسي في خميرة الخميرة

يحتوي جينوم الخميرة على مواقع منع شوكة تكرار الحمض النووي ، التي قمنا بتسميتها سوج المواقع ، في مجموعة جينات الحمض النووي الريبي الريبوسومي (rDNA). توجد هذه في نهاية 3 من وحدة النسخ 35S rRNA وهي تمنع حركة شوكة النسخ المتماثل في اتجاه معاكس لاتجاه بوليميريز RNA 1. ثنائي الأبعاد (2D) الاغاروز الكهربائي للهلام. ظل نشاط الحجب حتى على البلازميد غير المتورط في نسخ الرنا الريباسي 35S وحركة الشوكة المثبطة بنفس الطريقة القطبية كما هو الحال في كروموسوم الخميرة. لتعريف الموقع بشكل أكبر ، تم استنساخ شظايا أصغر في بلازميد من نوع YEp. عرض 109 صغير حسب المنطقة سوج النشاط وكان يقع بالقرب من منطقة المحسن لنسخ الرنا الريباسي 35S. إنه يتداخل مع عنصر أساسي في البقعة الساخنة المؤلفة HOT1.

هذه معاينة لمحتوى الاشتراك ، والوصول عبر مؤسستك.


نتائج

التحليل الوراثي الخلوي

كانت البيانات الوراثية الخلوية الأساسية ، بما في ذلك الرقم ثنائي الصبغيات والتشكل الكروموسومي للأنواع التي تم تحليلها ، متوافقة مع المعلومات المنشورة مسبقًا [24 ، للمراجعة]. تم الحصول على خرائط وراثية خلوية لـ 5S rDNA لـ 18 نوعًا من أنواع cichlid في أمريكا الجنوبية ، و 22 نوعًا أفريقيًا وآخر آسيويًا ، ويتم تقديم البيانات في الملفين الإضافيين 1 و 2. حتى الآن تم تحديثه إلى 23 أفريقيًا و 1 آسيوي و 23 نيوتروبيكال (انظر الملفات الإضافية 1 و 2). يتم عرض الكروموسومات الميتافازية المهجنة التمثيلية في الشكلين 1 و 2. تراوح عدد المواقع لكل جينوم ثنائي الصبغيات من 2 إلى 15 ، وكان النمط الأكثر شيوعًا هو وجود 2 كروموسومات تحمل مجموعات 5S rDNA. حدث هذا النمط في 38 نوعًا ، والتي تتوافق مع

79.0٪ من العينات التي تم تحليلها. وقد لوحظ أكبر عدد من المواقع في الأنواع الأفريقية Astatotilapia latifasciata (15 موقعًا ، الشكل 1 ز) وفي الأنواع المدارية Laetacara dorsigera (14 موقعًا ، الشكل 2 ز). تم استبعاد هذين النوعين من التحليلات الإحصائية الواردة أدناه بسبب العدد الكبير بشكل غير طبيعي من مجموعات الحمض النووي الريبي 5S مقارنة بأنواع البلطي الأخرى التي تمت دراستها.

ضوئي فى الموقع تهجين متواليات 5S rDNA إلى الكروموسومات الميتافازية للقشريات الآسيوية والأفريقية. تم اكتشاف تسلسل 5S rDNA باستخدام FITC (أخضر) ، وتمت مقاومة الكروموسومات بـ DAPI ، وتم تحويل الصور إلى تدرج رمادي. (أ) Etroplus maculatus, (ب) Oreochromis niloticus, (ج) البلطي ماريا, (د) T. مامفي, (ه) هيميكروميس بيماكولاتوس, (F) Gephyrochromis moorii, (ز) Astatotilapia latifasciata, (ح) Melanochromis auratus, (أنا) Pseudotropheus Tropheus. تشير رؤوس الأسهم إلى الكروموسومات الحاملة لـ 5S rDNA. شريط = 5 ميكرومتر.

ضوئي فى الموقع تهجين تسلسل 5S rDNA إلى الكروموسومات الميتافازية للقشريات الاستوائية. تم اكتشاف تسلسل 5S rDNA باستخدام FITC (أخضر) ، وتمت مقاومة الكروموسومات بـ DAPI ، وتم تحويل الصور إلى تدرج رمادي. (أ) Retroculus lapidifer, (ب) Astronotus ocellatus, (ج) سيشلا بيكيتي, (د) جيوفاجوس بروكسيموس, (ه) ساتانوبركا جوروباري, (F) Aequidens tetramerus, (ز) Laetacara dorsigera, (ح) أبطال efasciatus, (أنا) Mesonauta فيستيفوس. تشير رؤوس الأسهم إلى الكروموسومات الحاملة لـ 5S rDNA ، وتميز العلامات النجمية الكروموسومات التي تحمل موقعين. شريط = 5 ميكرومتر.

كشفت البيانات الحالية والنتائج المنشورة سابقًا عن متوسط ​​2.7 موقع من 5S rDNA لكل جينوم ، حيث

31.7 ٪ كانوا موجودين في الكروموسومات الفوقية / الفرعية (م / سم) و

68.3٪ كانت في كروموسومات telo / acrocentric (t / a). فيما يتعلق بالموضع الكروموسومي لهذه المواقع ،

42.9 ٪ لديهم موقع قريب (p) ،

47.6٪ لديهم موقع بيني (i) و

9.5٪ لديهم موقع طرفي (t). عند فحص موقع 5S rDNA على أذرع الكروموسومات ، وجدنا ذلك

50.8٪ من المواقع كانت مرتبطة بالذراع الطويل (L) و

12.7٪ كانوا مصابون بذراع قصيرة (S). بالإضافة الى،

تم تعيين 36.5 ٪ عن كثب إلى المنطقة المركزية (C) ، ولكن كان من المستحيل التمييز بين ذراع الكروموسومات التي تم وضعهم عليها (انظر الملفات الإضافية 1 و 2 الجدول 1 الشكل 3).

توزيع عدد ونسبة مجموعات الحمض النووي الريبي 5S (الأشرطة الخضراء) و 18 S (الأشرطة الحمراء) في جينومات 48 و 41 cichlid ، على التوالي. تم اعتبار الأنواع ذات الظروف متعددة الأشكال أكثر من مرة. (أ) إجمالي عدد المواقع ، (ب) عدد / النسبة المئوية للمواقع في الكروموسومات ذات التشكل المميز: telo / acrocentric (t / a) ، meta / subetacentric (m / sm) (ج) عدد / النسبة المئوية للمواقع القريبة (p) والخلالية (i) والطرفية (t) (د) توزيع عدد / نسبة المواقع في أذرع الكروموسومات المتميزة: القصير (S) والطويل (L) وفي المناطق المركزية (C). الانواع Astatotilapia latifasciata و Laetacara dorsigera تم استبعادها بسبب عددها غير النمطي لمجموعات 5S rDNA.

تم فحص ثلاثة أنواع أفريقية لرسم خرائط 18S rDNA (أسماك البلطي, Placidochromis electra و الحمار الوحشي الكاذب) في هذه الدراسة ، والتي تُحدِّث إجمالي أنواع البلطي التي تم تحليلها إلى 32 نوعًا (ملفان إضافيان 1 و 2). تفاوت عدد مواقع 18S rDNA من 2 إلى 6 ، بمتوسط

2.9 موقع لكل جينوم ثنائي الصبغة. كانت الحالة المشروطة هي وجود موقعين على زوج كروموسوم واحد متماثل (

63.4٪). معظم مجموعات جينات الرنا الريباسي 18S (

تم العثور على 68.3 ٪) في الكروموسومات t / a ، و

31.7 ٪ كانت موجودة في عناصر م / سم. كان 18S rDNA موجودًا في الموقع النهائي في

93.3٪ من المواقع المعينة فقط

6.6 ٪ كانت خلاليًا ، ولم يكن أي منها موجودًا في المنطقة القريبة. ومن السمات البارزة الأخرى ارتباط 18S rDNA مع الذراع القصيرة للكروموسومات (

2.5 ٪ من المواقع الواقعة على الذراع الطويلة ، ولا ترتبط أي منها بالمناطق المركزية (انظر الملفات الإضافية 1 و 2 الجدول 2 الشكل 3).

كشف التحليل الفردي للبيانات الخاصة بالمجموعتين الرئيسيتين المدروستين ، وهما البلطي الأفريقي والأفريقي ، عن خصائص معينة لكل مجموعة (انظر الملفات الإضافية 1 و 2 الجدول 1). بالنسبة لـ 5S rDNA ، كانت الخصائص على النحو التالي: كان متوسط ​​عدد المواقع لكل جينوم ثنائي الصبغة 3.1 و 2.3 موقعًا في الممثلين الأفارقة والمداريين الجدد ، على التوالي 56.8 ٪ من المواقع كانت موجودة في كروموسومات t / a ، و 43.2 ٪ من المواقع كانت تقع في الكروموسومات m / sm في النسب الأفريقي 84 ٪ من المواقع كانت موجودة في الكروموسومات t / a ، و 16 ٪ من المواقع في الكروموسومات m / sm في البلطيات الاستوائية الجديدة كان الموقع التفضيلي للمواقع قريبًا (67.6 ٪) في الأفارقة والخلالي في البلطي المداري (76.0٪) في الأفارقة ، تم تعيين معظم المواقع عن كثب إلى المنطقة المركزية (71.9٪) ، بينما بالنسبة إلى Neotropicals ، تم تعيين 5S rDNA في الغالب إلى أذرع الكروموسومات الطويلة (84.0٪). بالنسبة لـ 18S rDNA ، كانت الخصائص على النحو التالي: كان متوسط ​​عدد المواقع لكل جينوم ثنائي الصبغة 3.7 و 2.5 موقعًا في الممثلين الأفريقيين والمداريين الجدد ، على التوالي ، كانت جميع المواقع التي تمت ملاحظتها لـ 18S rDNA في البلطي الأفريقي موجودة في المحطة مناطق الأذرع القصيرة لكروموسومات t / a (انظر الملف الإضافي 1 الجدول 2) في الأنواع المدارية ، لوحظ نمط أكثر تنوعًا لموضع هذه العلامة مع المواقع في كل من الكروموسومات m / sm و t / a بدقة كان الموقع في المقام الأول في المنطقة الطرفية للذراع القصير (انظر الملف الإضافي 2 الجدول 2).

إلى جانب الاختلافات العامة بين سلالتي البلطي ، في الأنواع الأفريقية ، لوحظت اختلافات في توزيع 5S rDNA بين البلطي و haplochromines. في البلطي (الشكل 1 ب-د) ، كانت مواقع 5S rDNA تقع بشكل عام على كروموسومات t / a صغيرة. في haplochromines (الشكل 1f-i) ، كانت هذه النسخ الجينية موجودة على أكبر زوج كروموسوم m / sm في جميع الأنواع التي تم تحليلها (انظر الملف الإضافي 1 ، الجدول 2) مع وجود مواقع إضافية لوحظت في Astatotilapia latifasciata (الشكل 1 ز) و Gephyrochromis moorii (الشكل 1f). ويرد في الشكل 4 عرض تركيبي للعدد المشروط المحتمل ومواقع الكروموسوم لمجموعات 5S و 18S rDNA في الأنساب المتميزة من البلطي.

عرض اصطناعي للمواقع الصبغية الأكثر شيوعًا للـ rDNA المرسومة على مخطط cladogram لعائلة cichlid. استندت الشجرة إلى علم التطور الذي اقترحه سباركس وسميث (2004).

تحليل جينات الرنا الريباسي 5S و 18S في جينوم O. niloticus

استرجعت نتائج البحث BLASTn لجين 5S rRNA لقاعدة بيانات BouillaBase 59 نسخة تم توزيعها على 42 سقالة ، واسترد البحث عن جين 18S rRNA 38 نسخة تم توزيعها على 31 سقالة (انظر الملف الإضافي 3). لكل نتيجة ، تم ترتيب النسخة المفترضة وفقًا لطول تسلسلها وقيمة E. كان Scaffold 6 هو الوحيد الذي يحتوي على نسخ مفترضة من الجينات 5S و 18S rRNA (الشكل 5). كانت معظم تسلسلات الرنا الريباسي 18S التي تم استردادها عبارة عن نسخ جزئية من الجين (انظر الملف الإضافي 4). على الرغم من أن الدراسات السابقة كشفت عن نوعين من تكرار 5S rDNA (النوع الأول والنوع الثاني) في O. niloticus genome [25], only type I copies were recovered in the present analysis (see Additional file 5). Moreover, the analysis of the FRs of the rRNA genes (see Additional files 6 and 7) detected the presence of transposable elements (TEs) that flanked a high number of rRNA gene copies, with a predominance of SINEs in the FRs of 5S rRNA gene sequences (Figure 5).

The organization of rRNA genes and TEs on scaffold 6 of the Oreochromis niloticus الجينوم. The 5S and 18S rRNA genes, putative TEs (SINE2-1_AFC, PIVE, Copia-53_MLp-1 and SINE_FR2), and the vasa gene are indicated by arrows. C1 and C2 represent conserved repeats in the NTS of the 5S rRNA type I gene.


Sandwalk

Humans 5S RNA genes are about 200 bp in size from the transcription start site to the termination site. The precursor is processed to give the mature 120 bp 5S RNA that is incorporated into ribosomes [Ribosomal RNA Genes in Eukaryotes].

5S RNA genes are arranged as tandem repeats in a large cluster on chromosome 1 (1q42). The number of repeats varies from individual to individual within the range of 35-175 copies (Stults et al. 2008). The length of the repeats also varies but most of the genes are part of a 2200 bp repeat. Since only a small part of this is actually transcribed (200 bp) it looks like much of this locus is non-essential DNA. (The 5S RNA repeat in macaques is 7300 bp and in rats it is 1800 bp.)

The reported human genome sequences do not contain the region of the 5S RNA genes. It is impossible to clone and assemble fragments of repeated DNA sequences.

The other ribosomal RNA genes are located in a single transcription unit that gives rise to an RNA precursor of 13,000 bp. This is known as 45 RNA and the "gene" (operon) is often called the 45S gene. This large transcript is processed to give three mature RNAs: 18S (1874 bp), 5.8S (160 bp), and 28S (4718 bp) [Ribosomal RNA Genes in Eukaryotes].

The transcription units are arranged mostly as head-to-tail tandem repeats of 43 kb. Thus, 30 kB of this repeat unit consists of non-transcribed spacer. The length of this non-transcribed spacer varies from species to species although it tends to be the same within a given species (but see below). The conservation of length and sequence in a region of DNA that is non-essential may seem surprising but it is related to the frequent recombination events that occur at the sites of ribosomal RNA genes. The genes themselves are almost identical in sequence as a result of concerted evolution or gene conversion. The flanking regions (non-transccribed spacers) are "conserved" because they are carried along.

Let's assume that 20 kb of the non-transcribed spacer is non-functional and non-essential (= junk). That means 23 kb (13 kb of 45S transcript and 10 kb of spacer) is essential for proper function of the ribosomal RNA genes.

The ribosomal RNA genes are located at regions called nucleolar organizer regions (NORs) because this is the site where a nucleolus forms within the nucleus. The nucleolus is actually a dense region of the nucleus where massive transcripton of ribosomal RNA genes is occurring.

In humans, there are five clusters of ribosomal RNA genes (NORs) located at 13p12, 14p12, 15p12, 21p12, and 22p12. All of them are found in distinctive regions at the ends of apocentric chromosomes (chromosomes with a centromere region near one end). Cluster lengths (number of repeats) varies from individual to individual. The frequency of recombination events leading to rearrangements is

10% per generation. This means that almost every individual has a unique fingerprint of ribosomal RNA gene repeats. (Each of us has 10 clusters.)

There are about 600 repeats in the average diploid genome (Stults, 2008). (This means 300 repeats in the haploid genome.) As is the case with the 5S repeats, none of the nucleolar organizer regions has been cloned and sequenced. All five loci are represented by large gaps in the "finished" genome.

The total amount of DNA in the large ribosomal RNA clusters is 12,900 kb (300 × 43 kb). Of this amount 6,000 kb (47 %) is probably junk in the sense that it is dispensible.

Many of the human 45S genes are pseudogenes and unusual rearrangements are common (Caburet et al., 2005). In mouse, up to half of all the 45S genes are non-functional pseudogenes. Presumably these are due to errors in recombination events and they are likely to be transient.

The minimum number of 45S genes in mammals is not known for certain in humans but in chickens the loss of anything more than half the average number is lethal. It seems reasonable that of the 300 or so human 45S genes only about 150 are absolutely required and the remainder are dispensable. However, concerted evolution of these genes is essential in the long run and the mechanism of concerted evolution and gene conversion requires lots of copies. Thus, all copies are necessary for the species even though only half may be required for any one individual.

Total ribosomal RNA genes in the genome:

5S: 100 copies of 2.2 kb repeats = 220 kb. (estimate 100 kb essential, 120 kb junk)
45S: 300 copies of 43 kb repeats = 12,900 kb. (estimate 7,000 kb essential, 6,120 junk)


Dataset: 1000 Genomes Project

We used the short RNA-seq datasets that were released by the 1KG Project [32] and were derived from the lymphoblastoid cell lines (LCL) of individuals belonging to five population groups: CEU (Utah Residents with Northern and Western European Ancestry), FIN (Finnish in Finland), GBR (British from England and Scotland), TSI (Toscani in Italia), and YRI (Yoruba in Ibadan, Nigeria). The 1KG Project released 452 total short RNA-sequencing datasets (and 35 technical replicates). The samples were sequenced at seven facilities (Geuvadis Consortium). The 48 samples that were sent to one of the facilities (number “six”) were sequenced using 47 cycles of sequencing whereas all other samples were sequenced using 33 cycles. In order to be consistent, we removed all samples that came from facility “six”—this left us with 434 LCL datasets for our downstream analyses (83 CEU, 94 FIN, 88 GBR, 87 TSI, and 82 YRI). We used the 35 technical replicates (1 CEU, 1 FIN, 1 GBR, 1 TSI, and 1 YRI sequenced at seven facilities) for the rRF correlations.

Other datasets: Gene Expression Omnibus and The Cancer Genome Atlas

We analyzed short RNA-seq for six samples from the Gene Expression Omnibus (GEO) data (GSE99430) [34] which looked at the 293T cells and their derived extracellular vesicles (EV). 293T cell samples are as follows: SRR5628228, SRR5628229, and SRR5628230. The EV samples are as follows: SRR5628231, SRR5628232, and SRR5628233. The abundances of the rRFs found in these datasets can be found in Additional file 4. We also analyzed short RNA-seq data for the 80 uveal melanoma (UVM) samples from The Cancer Genome Atlas (TCGA) [33].

Reference rRNAs

We used the GenBank 45S (RNA45SN1), 5S (RNA5S12), 12S (MT-RNR1), and 16S (MT-RNR2) rRNAs as our reference rRNA sequences for this analysis. The GenBank accession numbers are as follows: NR_145819.1, NR_023374.1, NR_137294.1, and NR_137295.1, respectively. RNA45SN1 was chosen as a representative 45S and is 13,351 nucleotides (nts) long. RNA5S12 was chosen as a representative 5S rRNA and is 121 nts long. MT-RNR1 and MT-RNR2 are the two consensus MT rRNAs and are 954 and 1,559 nts long, respectively.

Defining the “rRNA space”

We define “rRNA space” as the union of (a) the genomic regions that comprise the six rRNAs (see previous paragraph), (b) all rRNA repeats that are listed in RepeatMasker [59] including partial instances, and (c) any إضافي genomic regions that are identified via a glsearch [60] search of the genome using the six rRNAs as queries, default parameters, and an ه value cutoff of 1E−08. An rRF that can be found in the union of the genomic regions obtained through steps a, b, and c above as well as elsewhere in the genome is referred to as an “ambiguous” rRF. Otherwise, it is referred to as being “exclusive” to the rRNA space. This is analogous to our definition of tRNA space and our analyses of tRFs [26, 30, 36, 48].

رسم الخرائط

We first processed the 434 short RNA-seq datasets using cutadapt [61] to quality-trim and remove adapters from the sequenced reads. The reads were then mapped to the genome using a brute-force, deterministic, and exhaustive approach that enforced exact matching to the genome. Only reads with a minimum of 16 nts were kept and analyzed further. During mapping, we catalogued reads which are exclusive to the rRNA space and which are ambiguous. We also kept track of reads that straddle either the left or the right boundary of any of the six rRNAs (Fig. 1a blue box).

Thresholding

We thresholded the rRFs using the Threshold-seq tool [35] and default parameter settings. Threshold-seq calculates an adaptive sequence read cutoff that is different for each sample (Fig. 1a green box). We also calculated a ≥ 10 RPM threshold by first normalizing each rRF’s abundance to reads-per-million (RPM) by dividing the number of reads that support the rRF by the total number of sequenced short RNA reads (i.e., read depth) and multiplying by 1 million then keeping only unique rRFs that passed a threshold of ≥ 10 RPM. (Fig. 1a orange box).

Determining length cutoffs

As might be expected, shorter sequences are more likely than longer sequences to have many genomic instances that are not part of the rRNA space. In fact, we find that many of the identified rRFs with lengths ≥ 16 nts are ambiguous. Thus, for each rRNA in turn, we identified the minimum length at which fewer than 2% of the genomic instances of an rRNA’s rRFs fall outside of the rRNA space. To do this, we first examined rRFs from the same rRNA if and only if their sequence lengths ranged from 16 through 33 nts inclusive. Next, for each rRF, we counted the number of its instances that fall inside the rRNA space, outside the rRNA space, and across the whole genome. For all rRFs from a given rRNA, and for each sequence length value (16–33 nts), we calculated the ratio of the number of instances that fall inside of the rRNA space over the total number of rRFs that fall outside of the rRNA space and call this the signal to noise ratio (S/N). We identified the minimum rRF length for which the S/N becomes ≥ 50 (the number of instances that fall outside of the rRNA space over the total number of genomic instances is ≤ 2%). We repeated this calculation separately for each of the six rRNAs (Fig. 1a red box).

التحليلات

Differential abundances were calculated using the Significance Analysis of Microarrays (SAM) package in R using a stringent false discovery rate (FDR) cutoff of 0.01. Partial least squares-discriminant analysis (PLS-DA) was carried out in R using the default settings and a VIP cutoff of 1.5. Pearson correlations were calculated using R.

عزل الحمض النووي الريبي

For total RNA preparation, cells were grown in suspension using RPMI 1640 media with 30% non-heat inactivated FBS + glutamate (Sigma-Aldrich). After seeding, cells were grown for 3–5 days and harvested. RNA was isolated using TRIzol extraction (Invitrogen).

Northern blotting

We purchased commercially available lymphoblastoid cell lines (Coriell Institute) derived from 18 total people from the CEU, GBR, and YRI populations. For each population, we purchased three male samples and three female samples. The cell lines are the following: CEU females (GM12769, GM12807, GM12837) CEU males (GM12884, GM12905, GM12919), YRI females (GM18487, GM18523, GM18870), YRI males (GM18907, GM19203, GM19239), GBR females (HG00122, HG00134, HG00137), and GBR males (HG00243, HG00264, HG01789). As per Coriell’s policy, all cell lines were tested and found to be mycoplasma-free. 5μg of RNA from each cell line was run on a 15% acrylamide/8 M urea gel at 250 V for 45 min. 100 nmol of RNA target cDNA (5.8S 24-mer, GGGCTACGCCTGTCTGAGCGTCGC 5.8S 21-mer, TACGCCTGTCTGAGCGTCGCT 5S 18-mer, ACCGGGTGCTGTAGGCTT 28S 20-mer, CGCGACCTCAGATCAGACGT) served as positive control. Gel was transferred to Hybond™-N + membrane (Amersham Biosciences, catalog number: RPN303B) and transferred at 400 mA for 10 min. Membrane was dried and then cross-linked twice at 120,000 μJ/cm 2 . All membranes were cut so that the top portion could be probed with the 5S rRNA probe (ACGTCTGATCTGAGGTCGCGT)—the loading control, and the bottom portion was probed with the 5.8S 24-mer (GCGACGCTCAGACAGGCGTAGCCC), 5.8S 21-mer (AGCGACGCTCAGACAGGCGTA), 5S 18-mer (ACCGGGTGCTGTAGGCTT), and 28S 20-mer (ACGTCTGATCTGAGGTCGCG). Membranes were pre-hybridized in hybridization buffer (PerfectHyb™ Plus Hybridization Buffer: H7033-1 L) for 30 min rotating at 37 °C. Northern probes were made using the DIG labeling kit (DIG Oligonucleotide 3′-End Labeling Kit, 2nd Gen: 3353575910). For Fig. 5, the 9 LCL female and 9 LCL male RNAs were run on two different gels and the top portions of each membranes were incubated with 2.5 μl of 5S probe and the lower portions of the membranes were incubated with 5 μl of 5.8S 24-mer probe for 16 h rotating at 37 °C. For Additional file 6: Figure S5, female CEU (GM12769), GBR (HG0112), and YRI (GBM18523) RNA was used and uncut membranes were incubated with 5 μl of the corresponding probes. Detection of membranes was done using the DIG detection kit (DIG Wash and Block Buffer Set: 11585762001, Anti-Digoxigenin-AP, Fab fragments: 11093274910, CDP-Star Chemiluminescent Substrate: C0712-100ML) following the manufacturer’s instructions.

Secondary structures

Secondary structures were generated using the Vienna RNAFold Web Server http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi [62] with default settings. The sequences for which we predicted secondary structures are listed in the “Reference rRNAs” section.

Deep sequencing of independently obtained commercial cell lines

We purchased commercially available lymphoblastoid cell lines (Coriell Institute) derived from two individuals: one who was a 63-year-old African American male (ND02672) and one who was a 66-year-old Caucasian American male (ND07114). As per Coriell’s policy, all cell lines were tested and found to be mycoplasma-free. Two different libraries were created for each sample: Illumina’s TruSeq Small RNA Library Prep Kit Set (#RS-200) and NEB’s NEBNext Small RNA Prep Set for Illumina (#E7330) at the Jefferson Genomics Core Facility according to the standard kit protocols, which size select for small RNAs. The Illumina NextSeq 3′-adapter is TGGAATTCTCGGGTGCCAAGG, and the NEBNext 3′-adapter is AGATCGGAAGAGCACACGTCT. The samples were all sequenced using the Illumina NextSeq 500 sequencing platform at 75 cycles and 30 million reads.


شاهد الفيديو: علم الأحياء تحت المجهر: ما الحمض النووي والحمض النووي الريبي (ديسمبر 2022).