معلومة

هل يمكن تحويل Euchromatin إلى Heterochromatin؟

هل يمكن تحويل Euchromatin إلى Heterochromatin؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

وأنا أعلم ذلك يمكن تحويل الهيتروكروماتين إلى كروماتين حقيقي لكن هو عكس ذلك ممكن؟ إذا كانت الإجابة بنعم ، فكيف؟


أود أن أقترح في المستقبل إجراء قدر صغير من البحث قبل السؤال. على سبيل المثال ، صفحة ويكيبيديا الخاصة بالكروماتين الحقيقي تقول هذا:

يشارك Euchromatin في النسخ النشط للحمض النووي إلى منتجات الرنا المرسال. يسمح الهيكل غير المطوي للبروتينات المنظمة للجينات ومجمعات بوليميراز RNA بالارتباط بتسلسل الحمض النووي ، والذي يمكنه بعد ذلك بدء عملية النسخ. لا يتم نسخ كل كروماتين حقيقي بالضرورة ، ولكن بشكل عام ما لا يتم تحويله إلى هيتروكروماتين لحماية الجينات أثناء عدم استخدامها. لذلك ، هناك صلة مباشرة بمدى فعالية إنتاج الخلية وكمية الكروماتين الحقيقي الذي يمكن العثور عليه في نواتها. يُعتقد أن الخلية تستخدم التحول من كروماتين حقيقي إلى كروماتين مغاير كطريقة للتحكم في التعبير الجيني وتكرارها ، نظرًا لأن مثل هذه العمليات تتصرف بشكل مختلف على الكروماتين المضغوط بكثافة ، والمعروفة باسم `` فرضية الوصول ''. أحد الأمثلة على euchromatin التكويني الذي يتم تشغيله دائمًا هو جينات التدبير المنزلي ، والتي ترمز للبروتينات اللازمة للوظائف الأساسية لبقاء الخلية.

الهيتروكروماتين الاختياري هو كروماتين يتحول ذهابًا وإيابًا حسب الظروف. يحدث هذا من خلال (de) "التكثيف" أو (de) "الضغط" للكروماتين:

من بين المكونات الجزيئية التي يبدو أنها تنظم انتشار الهيتروكروماتين هي بروتينات مجموعة Polycomb والجينات غير المشفرة مثل Xist. لا تزال آلية مثل هذا الانتشار موضع جدل. [19] تنظم المجمعات القمعية متعددة القواطع PRC1 و PRC2 ضغط الكروماتين والتعبير الجيني ولها دور أساسي في العمليات التنموية.

أود أن أقترح قراءة هذه الصفحات قليلاً والخروج بسؤال أكثر تحديدًا إذا لم يجيبوا عليه.


الفرق بين Euchromatin و Heterochromatin

يتكون جسمنا من بلايين الخلايا. تحتوي الخلية النموذجية على نواة ، وتحتوي النواة على الكروماتين. وفقًا لعلماء الكيمياء الحيوية ، فإن التعريف التشغيلي للكروماتين هو الحمض النووي والبروتين ومركب الحمض النووي الريبي المستخرج من نوى الطور البيني حقيقية النواة. وفقا لهم ، فإن الكروماتين هو المنتج المكون من البروتينات الخاصة المعبأة المعروفة باسم الهيستونات. ببساطة ، الكروماتين هو في الأساس مزيج من حمض الديوكسي ريبونوكليك أو الحمض النووي وأنواع أخرى من البروتين. الكروماتين هو المسؤول عن تجميع الحمض النووي في أحجام أصغر بحيث يمكن وضعها داخل الخلية. كما أنها مسؤولة عن تقوية الحمض النووي من أجل الانقسام والانقسام الاختزالي. يمنع الكروماتين أيضًا إتلاف الحمض النووي ويتحكم في التعبير الجيني وتكرار الحمض النووي.

هناك نوعان من الكروماتين. هم euchromatin و heterochromatin. يتم تمييز هذين الشكلين بطريقة خلوية تتعامل مع مدى كثافة تلطيخ كل شكل. الكروماتين الحقيقي أقل كثافة من الكروماتين المتغاير. يشير هذا فقط إلى أن الهيتروكروماتين يحتوي على عبوات DNA أكثر إحكامًا. لمعرفة المزيد حول الفرق بين euchromatin و heterochromatin ، ستوفر لك هذه المقالة نظرة سريعة بخصوص هذين الشكلين من الكروماتين.

تسمى المادة المعبأة بشكل خفيف كروماتين حقيقي. على الرغم من أنها معبأة بشكل خفيف في شكل DNA و RNA والبروتين ، إلا أنها غنية بالتأكيد بتركيز الجينات وعادة ما تكون تحت النسخ النشط. إذا كنت ستفحص حقيقيات النوى وبدائيات النوى ، فستجد وجود كروماتين حقيقي. تم العثور على الهيتروكروماتين فقط في حقيقيات النوى. عند تلطيخها وملاحظتها تحت المجهر الضوئي ، فإن الكروماتين الحقيقي يشبه العصابات ذات الألوان الفاتحة بينما يكون الكروماتين المغاير داكن اللون. الهيكل القياسي للكروماتين الحقيقي مكشوف ، ممدود ، وحجمه فقط حوالي 10 نانومتر من الألياف الدقيقة. يعمل هذا الكروماتين الدقيق في نسخ الحمض النووي إلى منتجات الرنا المرسال. البروتينات المنظمة للجينات ، بما في ذلك معقدات RNA polymerase ، قادرة على الارتباط بتسلسل الحمض النووي بسبب البنية غير المطوية للكروماتين الحقيقي. عندما تكون هذه المواد مرتبطة بالفعل ، تبدأ عملية النسخ. تساعد أنشطة كروماتين حقيقي في بقاء الخلية.

من ناحية أخرى ، فإن الهيتروكروماتين هو شكل معبأ بإحكام من الحمض النووي. توجد عادة في المناطق المحيطية للنواة. وفقًا لبعض الدراسات ، من المحتمل وجود حالتين أو أكثر من الهيتروكروماتين. تسلسلات الأقمار الصناعية غير النشطة هي المكونات الرئيسية للكروماتين المتغاير. يعتبر الكروماتين المغاير مسؤولاً عن تنظيم الجينات وحماية سلامة الكروموسومات. أصبحت هذه الأدوار ممكنة بسبب التعبئة الكثيفة للحمض النووي. عندما يتم فصل خليتين ابنتيتين من خلية أصل واحد ، فإن الكروماتين المتغاير عادة ما يتم توريثه ، مما يعني أن الكروماتين المتغاير المستنسخ حديثًا يحتوي على نفس مناطق الحمض النووي التي ينتج عنها وراثة لاجينية. قد يكون هناك حدوث قمع للمواد القابلة للنسخ بسبب المجالات الحدودية. قد يؤدي هذا الحدوث إلى تطوير مستويات مختلفة من التعبير الجيني.

يوفر لك الملخص التالي فهمًا أوضح بشأن شكلي الكروماتين: euchromatin و heterochromatin.

يشكل الكروماتين النواة. وهي مكونة من الحمض النووي والبروتين.

للكروماتين شكلين: كروماتين حقيقي وكروماتين مغاير.

عندما تلطخ وتلاحظ تحت المجهر البصري ، فإن euchromatins هي العصابات ذات اللون الفاتح بينما تكون heterochromatins هي العصابات ذات اللون الداكن.

يشير التلوين الداكن إلى تغليف أكثر إحكامًا للحمض النووي. وبالتالي فإن الهيتروكروماتين لديها تغليف DNA أكثر إحكامًا من euchromatins.

Heterochromatins هي مناطق ملفوفة بشكل مضغوط بينما euchromatins عبارة عن مناطق ملفوفة بشكل فضفاض.

يحتوي الكروماتين الحقيقي على عدد أقل من الحمض النووي بينما يحتوي الهيتروكروماتين على المزيد من الحمض النووي.

كروماتين حقيقي هو التكاثر المبكر في حين أن الهيتروكروماتين يتكاثر في وقت متأخر.

تم العثور على كروماتين حقيقي في حقيقيات النوى ، والخلايا ذات النوى ، وبدائيات النوى ، وهي خلايا بدون نوى.

تم العثور على الهيتروكروماتين فقط في حقيقيات النوى.

وظائف euchromatin و heterochromatin هي التعبير الجيني ، وقمع الجينات ، ونسخ الحمض النووي.


هيكل الهيتروكروماتين: دروس من الخميرة في مهدها

يمكن تقسيم جينوم حقيقيات النوى تقريبًا إلى نطاقات كروماتين حقيقي وكروماتين مغاير متمايزة هيكليًا ووظيفيًا. يتميز الهيتروكروماتين بانضغاطه العالي وتأثيره المثبط على معاملات الحمض النووي مثل التعبير الجيني. يتضمن تكوين الكروماتين المغاير تعديلات خاصة للهيستون وتجنيد وانتشار مجمعات إسكات ويسبب تغييرات في الهياكل الأساسية والعليا للكروماتين. شهد العقدان الماضيان تطورات كبيرة في تشريح الجوانب الجزيئية للكروماتين المغاير بسبب تحديد كود هيستون للكروماتين المغاير وكذلك كتابه ومحاياته (إنزيمات معدلة للهيستون) والقراء (عوامل إسكات تتعرف على تعديلات الهيستون). كيف ساهمت تعديلات الهيستون غير المتجانسة وعوامل الإسكات في الهياكل الخاصة الأولية والعالية من الهيتروكروماتين. لطالما استخدمت الخميرة في مهدها Saccharomyces cerevisiae ككائن حي نموذجي لدراسات الكروماتين المتغاير. ساهمت نتائج هذه الدراسات بشكل كبير في توضيح المبادئ العامة التي تحكم تكوين الكروماتين المغاير وصيانته ووظيفته. تركز هذه المراجعة على التحقيقات في الجوانب الهيكلية للكروماتين المغاير في S. cerevisiae. يتم تلخيص الفهم الحالي للجوانب الأخرى للكروماتين المغاير بما في ذلك كيفية تعزيزه لإسكات الجينات ووراثة الوراثة اللاجينية.

الكلمات الدالة: Saccharomyces cerevisiae Sir بروتينات الكروماتين المتغايرة الترتيب العالي للكروماتين لإسكات النسخ.


الاختلافات الرئيسية بين Heterochromatin و Euchromatin

فيما يلي النقاط الأساسية للتمييز بين الكروماتين المتغاير والكروماتين الحقيقي:

  1. يسمى الشكل المعبأ بإحكام من الحمض النووي في الكروموسوم باسم الهيتروكروماتين، بينما يسمى الشكل غير المحكم من الحمض النووي في الكروموسوم باسم كروماتين حقيقي.
  2. في الهيتروكروماتين ، كثافة الحمض النووي يكون عالي و هي ملطخة داكنة، بينما في كروماتين حقيقي كثافة الحمض النووي القليل و هي بخفةملطخ.
  3. الهيتروكروماتين هو وجدت في محيط النواة في الخلايا حقيقية النواة فقط ، و Euchromatin هو تقع في الجسم الداخلي لنواة بدائية النواة وكذلك في الخلايا حقيقية النواة.
  4. يظهر الهيتروكروماتين القليل أو لا يوجد نشاط نسخي كما هم غير نشط وراثيا، من ناحية أخرى ، كروماتين حقيقي بنشاط يشارك في عملية النسخ ويتم نشطة وراثيا أيضا.
  5. الهيتروكروماتين هو ملفوف بشكل مضغوط وهو النسخ المتماثل المتأخر، في حين أن Euchromatin هو ملفوف بشكل فضفاض و التكرار المبكر.
  6. المناطق من الكروماتين المتغاير لزجة ، لكن مناطق الكروماتين الحقيقي غير لزجة.
  7. في الجزء الهيتروكروماتين ، فإن النمط الظاهري يبقى دون تغيير في الكائن الحي ، على الرغم من إمكانية ملاحظة الاختلاف ، بسبب التأثير في الحمض النووي أثناء العملية الجينية في Euchromatin.
  8. Heterochromatin يسمح لـ تنظيم التعبير الجيني ويحافظ أيضًا على السلامة الهيكلية للخلية على الرغم من أن ينتج عن Euchromatin الاختلافات الجينية، ويسمح بالنسخ الجيني.

استنتاج

من المعلومات الواردة أعلاه بخصوص الكروماتين & # 8211 هيكلها وأنواعها. يمكننا القول أن Euchromatin فقط هو الذي يشارك بقوة في عملية النسخ على الرغم من أن الهيتروكروماتين وأنواعه لا تلعب مثل هذا الدور المهم.

يحتوي الهيتروكروماتين التأسيسي على الحمض النووي الساتلي ، ويحيط بالسنترومير ، ويتم تفكيك الهيتروكروماتين الاختياري. من الواضح أنه يمكن القول إن الخلايا حقيقية النواة وبنيتها الداخلية معقدة نسبيًا.


الاقتباس: Hughes SE ، Hawley RS (2009) الهيتروكروماتين: حاجز الأنواع سريع التطور. بلوس بيول 7 (10): e1000233. https://doi.org/10.1371/journal.pbio.1000233

نشرت: 27 أكتوبر 2009

حقوق النشر: © 2009 هيوز ، هاولي. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ بأي وسيلة ، بشرط ذكر المؤلف الأصلي والمصدر.

تضارب المصالح: وقد أعلن الباحثون إلى أن لا المصالح المتنافسة موجودة.

منذ ما يقرب من 100 عام ، قسم علماء الأحياء مناطق الكروموسومات إلى نوعين ، كروماتين حقيقي وكروماتين مغاير ، على أساس مظهرها (تمت مراجعته في [1]). استند التصنيف الأولي للحمض النووي إلى ملاحظة أن المناطق المتجانسة اللون غيرت درجة تكثيفها أثناء دورة انقسام الخلية ، في حين ظلت المناطق غير المتجانسة مكثفة للغاية طوال معظم دورة الخلية. على الرغم من أن الأهمية البيولوجية للكروماتين المغاير ظلت غامضة لسنوات عديدة ، فمن الواضح الآن أن الهيتروكروماتين يلعب عددًا من الأدوار البيولوجية ، بما في ذلك الدور الذي تم تحديده مؤخرًا في الانتواع. بالإضافة إلى الاختلافات في توقيت تكثيف الكروموسوم ، تم تحديد العديد من الاختلافات الأخرى بين euchromatin و heterochromatin. يتم إثراء Euchromatin بتسلسلات تشفير فريدة ، وعادة ما يتم نسخ الجينات داخل euchromatin بنشاط. من ناحية أخرى ، يعتبر الهيتروكروماتين فقيرًا في الجينات ، حيث يتكون أساسًا من مصفوفات من المتواليات البسيطة شديدة التكرار ، مثل متواليات الأقمار الصناعية و / أو العناصر القابلة للنقل. يتم إثراء الهيتروكروماتين في السنتروميرات (انظر الشكل 1) وتيلوميرات الكروموسومات.

الظاهر هو عبارة عن كروموسوم تمثيلي مركزي يحتوي على كل من متغاير اللون مكثف (رمادي غامق) ومناطق متجانسة اللون أقل كثافة (رمادي فاتح). بجانب كل منطقة خصائص نموذجية لكل نوع من الكروماتين.

يرتبط عدد من تعديلات الكروماتين على وجه التحديد إما بالكروماتين المغاير أو الكروماتين الحقيقي ، مثل أنماط المثيلة المحددة على الهستونات. البروتينات المشاركة في تكوين أنماط مثيلة الهيستون المرتبطة بالكروماتين المغاير ، وكذلك البروتينات ، مثل بروتين الهيتروكروماتين 1 (HP1) التي تشارك في تكوين الكروماتين المغاير وإسكات الجينات ، تم العثور عليها بشكل تفضيلي مترجمة إلى الحمض النووي غير المتجانس. أخيرًا ، يبدو أن الهيتروكروماتين يتطور بسرعة ، لذلك غالبًا ما يكون التركيب المتسلسل للمناطق غير المتجانسة من الأنواع ذات الصلة الوثيقة مميزة. قادت ندرة الجينات في الكروماتين المغاير ، بالإضافة إلى تطورها السريع ، العديد من علماء القرن العشرين إلى النظر إلى الكروماتين المغاير على أنه ليس أكثر من دنا "غير مرغوب فيه" ذو أهمية بيولوجية قليلة ، بخلاف احتواء ، وربما حماية ، القسيمات المركزية والتيلوميرات.

ذبابة الفاكهة ذبابة الفاكهة سوداء البطن وأقربها كانت نماذج شائعة لدراسة طبيعة وتكوين الكروماتين المغاير (تمت مراجعته في [1]). في هذه الأنواع ، يمكن بسهولة تمييز الكروماتين الحقيقي عن الهيتروكروماتين المحيط بالمركز ، والذي يحيط بوسط الكروموسومات الانقسامية ، عن طريق علم الخلايا بسبب الاختلافات في تكثيف نوعي الحمض النووي. علاوة على ذلك ، تفشل المناطق غير المتجانسة في التكاثر في الكروموسومات متعددة الخطوط ، وهي كروموسومات مكررة للغاية تظل مرتبطة ارتباطًا وثيقًا بالغدد اللعابية اليرقية. هذا يسمح بترسيم دقيق بشكل معقول للتقاطع بين euchromatin و heterochromatin. بالإضافة إلى، D. melanogaster هو نظام يمكن تتبعه بشكل كبير لإجراء الفحص الجيني ولإجراء عمليات التلاعب الجيني إلى الأمام. لأن كلا من الهيتروكروماتين والكروماتين الحقيقي يتم تشريحهما وراثيا في D. melanogaster، تمت دراسة بيولوجيا الهيتروكروماتين بشكل مكثف باستخدام هذا الكائن الحي.

في الواقع ، العمل في D. melanogaster بدأت تتحدى وجهة نظر الكروماتين المغاير على أنها دنا "غير مرغوب فيه" وأثبتت أن الكروماتين المغاير يلعب عددًا من الوظائف الخلوية المهمة. جاءت المؤشرات الأولى لـ "وظيفة" للكروماتين المتغاير من دراسات الأدوار المتعددة للكروماتين المغاير في التوسط في إعادة التركيب أثناء الانقسام الاختزالي [2] ، [3]. ولعل الأمر الأكثر أهمية هو أن وضع الجينات المتساوية اللون بالقرب من الكروماتين المتغاير يتسبب في إسكات متغير لهذه الجينات ، وهو تأثير يُعرف باسم تنوع تأثير الموضع أو PEV (تمت مراجعته في [1]). يشير تأثير الإسكات هذا وحقيقة أن بعض الجينات يجب أن تكون في الهيتروكروماتين من أجل نسخها بشكل صحيح إلى أن الهيتروكروماتين قد يلعب دورًا مهمًا في التحكم العالمي في تنظيم الجينات [4] - [6].

علاوة على ذلك ، أظهرت التجارب التي أجراها كاربين وديرنبرج وهاولي والمتعاونون معهم أن الاقتران بين المناطق غير المتجانسة ضروري للفصل المناسب للكروموسومات التي تفشل في إعادة التركيب أثناء الانقسام الاختزالي للإناث [7] - [9]. أظهر العمل اللاحق أن الكروموسومات التي تفشل في الخضوع لإعادة التركيب ( X و 4 عشر ) بواسطة خيوط غير متجانسة اللون أثناء الطور الأول في البويضات ، ومن المحتمل أن تكون هذه الخيوط جزءًا من الآلية التي يسهل بها الكروماتين المتغاير الفصل الصبغي غير المترابط [10].

دليل على وجود خيوط تربط الكروموسومات أثناء الانقسام الاختزالي في الحيوانات المنوية لكليهما D. melanogaster يقترح ذباب الرافعة وظيفة محفوظة للتركيبات الشبيهة بالخيوط في فصل الكروموسومات أثناء الانقسام الاختزالي [11] ، [12]. على الرغم من أنه لم يتم تحديد ما إذا كانت هذه الخيوط تتكون من هيتروكروماتين ، فإن منطقة المباعدة المتكررة بين الجينات لـ rDNA ، والتي توجد في الهيتروكروماتين ، مطلوبة من أجل الاقتران الصحيح للكروماتين المتغاير. ص الكروموسوم مع X الكروموسوم أثناء الانقسام الاختزالي الذكري في D. melanogaster [13]. أخيرًا ، لوحظت أنواع مماثلة من الخيوط المنبثقة من مناطق السنترومير غير المتجانسة للكروموسومات أثناء الانقسام في خلايا الثدييات ، مما يشير إلى أن الخيوط غير المتجانسة تلعب دورًا مهمًا في الفصل الكروموسومي أثناء الانقسام الفتيلي أيضًا [14] ، [15].

بالنظر إلى الوظائف الحاسمة للتسلسلات غير المتجانسة في كل من الانقسام الاختزالي والانقسام الفتيلي وتغيرها السريع في التسلسل خلال التطور ، فقد لا يكون مفاجئًا إذا كانت الاختلافات في التسلسلات غير المتجانسة أو البروتينات التي تحافظ عليها قد تلعب بالفعل دورًا في عزل الأنواع [16]. يؤدي تزاوج الأنواع ذات الصلة أحيانًا إلى موت أو عقم أحد الجنسين من النسل أو كلاهما ، وهو ما يُعرف باسم عدم التوافق الهجين. على الرغم من دراسة عدم التوافق الهجين لعقود من الزمن ، لم يكن هناك سوى عدد قليل من الأفكار حول الآليات الجزيئية التي تكمن وراءه ، وفي تلك الحالات المعروفة بـ ذبابة الفاكهة من الأنواع ، تضمن عدم التوافق الهجين جينات ترميز البروتين [17] ، [18]. ومع ذلك ، في هذا العدد من بلوس علم الأحياء يوضح فيري وبارباش أن الاختلاف السريع للكروماتين المتغاير يلعب أيضًا دورًا مهمًا في الحفاظ على العزلة الإنجابية لـ D. melanogaster من الأنواع الشقيقة سيمولانس ذبابة الفاكهة [16]. الصليب بين D. simulans الإناث و D. melanogaster يعتبر الذكور غير معتاد في أن ذرية الذكور قابلة للحياة ولكن الإناث تموت أثناء التطور الإيمبيروني [19]. (عادةً في حالات عدم التوافق الهجين ، يكون الذكور غير المتجانسين هم الجنس المصاب إذا كان جنس واحد فقط عقيمًا أو مميتًا).

وجد فيري وبارباش أن نسبة الوفيات بين الأجنة الأنثوية الهجينة ناتجة عن فشل أثناء الانقسامات الانقسامية 10-13 [16]. في هؤلاء الإناث ، غالبًا ما تظهر المناطق الكروموسومية شديدة التمدد ومتخلفة عن الكروموسومات الأخرى أثناء طور هذه الانقسامات الانقسامية [16]. فشل الحمض النووي المتأخر في الانفصال بشكل صحيح عن أخته أثناء الانقسام الفتيلي ، مما أدى إلى فصل كروموسوم غير لائق ، وانقسامات انقسامية شاذة ، وفي النهاية موت الأجنة الأنثوية.

باستخدام التهجين الفلوري في الموقع ، قرر المؤلفون أن الكروماتين المتأخر كان يتألف أساسًا من متغاير اللون ومتكرر بدرجة عالية 359 نقطة أساس. X كروموسوم من D. melanogaster الأب [16]. نوع التكرار غير المتجانس هذا له تركيبة تسلسلية مختلفة وهو أقل وفرة في D. simulans. المنطقة التي تحتوي على 359 نقطة أساس على امتداد D. melanogaster X يتداخل الكروموسوم أيضًا مع ذر locus ، وهي منطقة وراثية تم تحديدها بسبب حذفها من D. melanogaster X يسمح الكروموسوم D. melanogaster الذكور لإنتاج بنات هجينة قابلة للحياة عند عبورهم D. simulans إناث [19].

اكتشاف أن معدل الوفيات لدى الإناث المهجنة ناتج عن الفشل في الحفاظ على سلامة منطقة غير متجانسة اللون في D. melanogaster X يشير الكروموسوم الذي يحتوي على تسلسل تكرار 359-bp إلى احتمال مثير للاهتمام ، ألا وهو أن الكروموسوم متأخر وفتك D. melanogaster X يحدث الكروماتين المغاير الكروموسومي في الإناث الهجينة لأن D. simulans فشل الأم في توفير بروتين أو جزيء RNA مطلوب للصيانة المناسبة و / أو الفصل أثناء الانقسام في منطقة التكرار 359-bp التي يوفرها D. melanogaster الأب (انظر الشكل 2). قد يتخيل المرء حتى أن الفشل في الفصل الانقسامي الذي لوحظ هنا يعكس فشلًا في حل الخيوط غير المتجانسة الملحوظة بشكل صحيح لتوصيل الكروماتين المتغاير حول المركز في كل من الخلايا الانقسامية والانقسام الاختزالي (انظر أعلاه).

يعتمد هذا النموذج على نتائج المقال الذي نشره فيري وبرباش في هذا العدد من بلوس علم الأحياء [16]. خليط بين D. melanogaster الذكور و D. simulans تظهر الإناث ، التي ينتج عنها إناث هجينة تموت مبكرًا في مرحلة التطور الجنيني ، على اليمين. الرسم على اليسار يصور تقاطعًا بين D. melanogaster الذكور D. melanogaster إناث للمقارنة. من أجل البساطة ، فقط ملف X تظهر الكروموسومات ويتم تحديد المنطقة غير المتجانسة بلون أغمق. في كلا الهجينين ، ينتج عن اندماج الحيوانات المنوية والبويضة أن تحمل زوجًا من البيضة الملقحة X الكروموسومات. الصليب مع D. melanogaster تؤدي الإناث إلى الفصل الطبيعي للكروموسوم أثناء طور الانقسامات الانقسامية 10-13 في الأجنة الأنثوية. في الصليب مع D. simulans فشل الانقسام الأنثوي في أن يكتمل بشكل طبيعي في أجنة الإناث الهجينة. بينما كانت الأم X تنفصل الكروموسومات بشكل طبيعي نحو أقطاب المغزل المعاكسة ، وهي مراكز الفصل التي تشتق أبويًا X ترتبط الكروموسومات بجسر من الكروماتين. هذا الجسر ، وهو غير متجانس اللون ويتألف من منطقة غنية بالتكرار 359-bp ، يتسبب في الفصل غير المناسب للكروماتيدات الشقيقة في X الكروموسوم ، وهو حدث يؤدي في النهاية إلى انقسامات انقسامية شاذة وفي النهاية موت الأجنة الهجينة الأنثوية. من المحتمل أن يكون التأخير أو التجسير في منطقة 359-bp بسبب عدم وجود عامل محمّل أمومي في D. simulans بيضة (كما هو موضح في الماس الأصفر في D. melanogaster بيضة). نتخيل أن هذا العامل قد يكون متورطًا في حل الخيوط غير المتجانسة التي ثبت أنها تربط المناطق المحيطة بالكروموسومات الانقسامية والكروموسومات الانقسامية في الخلايا الطبيعية (انظر النص للحصول على وصف). يمنع غياب هذا العامل التكوين المناسب أو الحفاظ على بنية الكروماتين في منطقة التكرار 359-bp في الأجنة الهجينة الأنثوية.

يشتبه المؤلفون في ذلك D. simulans يفتقر إلى عامل مطلوب إما للحفاظ على الاستقرار غير المتجانس أو لحل الروابط غير المتجانسة في D. melanogaster X الكروماتين الكروموسومي المتغاير أثناء الانقسامات الانقسامية الجنينية. في الواقع ، وجدوا أن توبويزوميراز II ، وهو إنزيم مطلوب للانقسام السليم ، أظهر توطينًا شاذًا للحمض النووي المتأخر في الأجنة الهجينة. ستكون هناك حاجة إلى مزيد من العمل لتحديد ما إذا كانت البروتينات الأخرى أو جزيئات الحمض النووي الريبي غير موجودة أو مترجمة بشكل شاذ من D. simulans السيتوبلازم الأمومي ، وإذا كان غيابها كافياً لإحداث عيوب في منطقة التكرار 359-bp في الأجنة الأنثوية الهجينة.

في حين أن هذا هو المثال الأول لتسلسل غير متجانس يتسبب في عدم توافق هجين ، فمن المحتمل أن توجد أمثلة أخرى في الطبيعة. في الواقع ، لا يسعنا إلا أن نلاحظ وجود تشابه بين هذا المثال للثبات الهجين والظاهرة الجينية المعروفة باسم تشويه الفصل ، والتي تمت دراستها جيدًا أيضًا في D. melanogaster [20]. في هذا النظام رواية متحولة تعرف باسم SD، والذي يقع في كروماتين الكروموسوم الحقيقي 2، يمنع الانتقال الانتصافي للمتماثل 2 و تحمل الكروموسومات عددًا كبيرًا من النسخ لعنصر مغاير اللون يُعرف باسم المستجيب (رسب) [21]. الأساس الجيني لهذه الظاهرة ، والتي تسبب التكثيف غير السليم ووظيفة رسب- تحمل الحيوانات المنوية ، مفهومة جيدًا ، والفهم الجزيئي الكامل لهذه العملية في متناول اليد. في حين أن تشويه الفصل هو بالفعل مثال على "محرك الانقسام الاختزالي" ، وليس آلية عزل الأنواع ، فإنه يجدر ذكره هنا لأنه يوضح حالة ثانية يضعف فيها طفرة في إحدى السلالات وظيفة عنصر غير متجانس في سلالة أخرى ، وبالتالي يوضح الآليات قد يكون "عدم التوافق غير المتجانس" أكثر شيوعًا مما قد يتوقعه المرء.

مع تغير الكروماتين المغاير بسرعة ، قد تتباعد الآليات التي تحافظ عليه عندما تصبح المجموعات السكانية معزولة بآليات مختلفة. إذا تغيرت هذه الآليات بطريقة لا يمكن فيها الحفاظ على الكروماتين المغاير للمجموعة A بواسطة بروتينات الصيانة في المجموعة B ، فإن الكروماتين المغاير نفسه يصبح حاجزًا بين تلك المجموعات مع استمرار الانتواع. هناك العديد من الأسئلة الأخرى التي تنتظر التحقيق ، سواء من حيث نظام الثبات الهجين الموصوف أعلاه أو من حيث تقييم الدرجة التي يستند إليها الحراسة الآمنة للسلامة غير المتجانسة لأمثلة أخرى من الانتواع. ولكن هناك أمر واحد واضح: إذا كان أي جزء من الكروماتين المتغاير "خردة" بالفعل ، فإن "الخردة" هي التي يحتاج كلاهما إلى العناية الجيدة بها و "غير المرغوب فيه" هو ما يميز نوعًا واحدًا عن جيرانه.


ينظم النسخ كروماتين حقيقي مشابه للمستحلب الدقيق النشط

يتم تنظيم الكروماتين إلى كروماتين مغاير ، وهو غير نشط نسبيًا ، وكروماتين حقيقي ، والذي يمكنه التبديل بين الحالات النشطة نسبيًا وغير النشطة. هذا التبديل في نشاط كروماتين حقيقي مصحوب بتغييرات في توزيعه المكاني. كيف يتم إنشاء إعادة ترتيب كروماتين حقيقي غير معروف. هنا نستخدم الفحص المجهري عالي الدقة والخلية الحية لإظهار أن كروماتين حقيقي غير نشط نسبيًا يتحرك بعيدًا عن euchromatin النشط نسبيًا. هذه الحركة مدفوعة بتكوين البيئات الدقيقة المخصبة بالـ RNA التي تستبعد euchromatin غير النشط. باستخدام النظرية ، نظهر أن الفصل في البيئات الدقيقة المخصبة بالـ RNA ومجالات euchromatin يمكن اعتباره مستحلبًا دقيقًا نشطًا. يشكل ربط النصوص بالكروماتين عبر RNA polymerase II أمفيفيلات فعالة تتخلل المرحلتين المنفصلتين. بالاقتران مع التجارب السابقة ، تشير بياناتنا إلى أن الكروماتين يتم تنظيمه بالطريقة التالية: يتم فصل الكروماتين المتغاير عن الكروماتين الحقيقي عن طريق فصل الطور ، بينما ينظم النسخ كروماتين حقيقي مشابه للمستحلب الدقيق النشط.


الملخص

الهيتروكروماتين هو سمة معمارية رئيسية للكروموسومات حقيقية النواة ، والتي تمنح مجالات جينومية معينة بخصائص وظيفية محددة. تعد قدرة الهيتروكروماتين على تقييد نشاط العناصر المتحركة وعزل إصلاح الحمض النووي في المناطق المتكررة وضمان الفصل الدقيق للكروموسوم أمرًا ضروريًا للحفاظ على الاستقرار الجيني. تعرض النيوكليوسومات في مناطق الكروماتين المتغايرة تعديلات هيستون بعد الترجمة التي تساهم في التنظيم التنموي عن طريق تقييد التعبير الجيني الخاص بالنسب. آليات إنشاء الهيتروكروماتين وصيانة الكروماتين المتغاير قابلة للفصل وتتضمن قدرة العوامل الخاصة بالتسلسل المرتبطة بالنصوص الوليدة لتجنيد الإنزيمات المعدلة للكروماتين. يمكن أن ينتشر الهيتروكروماتين على طول الكروماتين من مواقع التنوي. يتم إبطال ميل الهيتروكروماتين لتعزيز انتشاره ووراثته بواسطة عوامل مثبطة. نظرًا لأهميتها لوظيفة الكروموسوم ، فإن الكروماتين المغاير له أدوار رئيسية في التسبب في الأمراض البشرية المختلفة. في هذه المراجعة ، نناقش المبادئ المحفوظة لتكوين الكروماتين المتغاير والوظيفة باستخدام أمثلة مختارة من دراسات مجموعة من حقيقيات النوى ، من الخميرة إلى الإنسان ، مع التركيز على الرؤى التي تم الحصول عليها من الكائنات الحية أحادية الخلية.


تنظيم الكروموسومات

Natella I. Enukashvily، Nikita V. Ponomartsev، in Advances in Protein Chemistry and Structural Biology، 2013

1 المقدمة

في عام 1928 ، اقترح هيتز المصطلحين euchromatin و heterochromatin (HC) للاختلافات التي يمكن اكتشافها بواسطة صبغ الكروموسومات المناسبة (Heitz ، 1928). قام بتلوين خلايا من عدة أنواع من الطحالب بحمض الخليك القرمزي ولاحظ نوعًا من الكروماتين في النواة ظل مكثفًا طوال دورة الخلية. وصف هيتز هذا الجزء من الكروماتين النووي على أنه كروماتين مغاير ، والذي حافظ على حالة مكثفة (أي ظهر ملطخًا بشكل غامق) طوال الطور البيني للخلية ، في حين أن ما تبقى من الكروماتين النووي كان يمتد إلى ما أسماه حالة euchromatin. تمكن Cooper (1959) من تلخيص البيانات من ذبابة الفاكهة واقترح أن الهيتروكروماتين والكروماتين الحقيقي يختلفان في تطابقهما الفيزيائي الحيوي وفي التعبير الأيضي عن جيناتهما ، ولكن ليس في تركيبهما الأساسي للحمض النووي المرتب داخل الكروموسومات. الآن ، مفهوم جينوم حقيقيات النوى المكون من نوعين من الكروماتين المعبأ بشكل مختلف مقبول على نطاق واسع وهو مدرج في الكتب المدرسية في علم الأحياء. على الرغم من أن مصطلح الهيتروكروماتين قد تم تعريفه في الأصل من الناحية الخلوية على أنه مناطق من الكروموسومات الانقسامية التي تظل مكثفة في الطور البيني ، إلا أنه يتم الآن تطبيقه بشكل فضفاض ليشمل مناطق الكروموسومات التي تظهر خصائص مميزة مثل ، على سبيل المثال ، قمع الجينات وإسكات (راجعه كريج ، 2005 Lohe & amp Hilliker ، 1995).

من المقبول عمومًا أن هناك نوعين من الهيتروكروماتين - التكويني والاختياري. يُعتقد أن HC التأسيسي يتكثف طوال دورة الخلية بأكملها على عكس HC الاختياري الذي يتم تنظيمه من الناحية التطورية. في الكروموسومات الانقسامية ، يتم وضع المناطق التكوينية غير المتجانسة في أغلب الأحيان في مناطق مركزية ومحيط مركزية وكذلك بالقرب من التيلوميرات. تحتوي الكروموسومات 1 و 9 و 16 و Y على كتل كبيرة من الهيتروكروماتين. يمكن تشكيل HC الاختياري في مناطق كروموسومات مختلفة. في إناث الثدييات ، يتم تعطيل كروموسوم X واحد (مشتق من الأم أو الأب) بشكل عشوائي في الخلايا الجنينية المبكرة ، مع تثبيط ثابت في جميع الخلايا السليفة (ليون ، 1961). يمكن تكوين HC الاختياري في مناطق المروج للجينات غير المكتوبة (Rand & amp Cedar ، 2003). يمكن أن تخضع بعض النوى المركزية الجديدة (مناطق الحمض النووي المتساوي اللون التي اكتسبت خصائص السنتروميرات) المعروفة حتى الآن لعملية التباين اللوني على الرغم من أنها تتشكل داخل مناطق متجانسة اللون (Amor & amp Choo ، 2002 Saffery et al. ، 2003).


وظيفة كروماتين حقيقي

على الرغم من البحث النشط ، إلا أن بنية الكروماتين لا تزال غير مفهومة جيدًا على الرغم من أنه يبدو أن الدورة التي تكون فيها الخلية في وقت معين تحدد بنية الكروماتين. ليس من المستغرب أن توفر بنية euchromatin تلميحات بخصوص وظيفتها وسبب وجودها في الخلايا النشطة نسبيًا. كما ذكرنا سابقًا ، يُطلق على الكروماتين الحقيقي أيضًا خرزات على سلسلة بسبب التشابه بين عقد من الخرزات المتصلة من خلال خيط والجسيمات النووية المتصلة من خلال الحمض النووي الرابط. في هذا التشكل ، يكون الكروماتين الحقيقي سائبًا وبالتالي يترك الحمض النووي للرابط مكشوفًا بحيث يمكن نسخه بهذه الطريقة ، يمكن لـ RNA و DNA polymerases وكذلك البروتينات الأخرى الوصول إلى DNA. بسبب بنيته الفضفاضة ، يصعب رؤية كروماتين حقيقي تحت المجهر ويظهر بشكل خافت عند تلطيخه - على عكس الكروماتين المغاير المرئي بسهولة ، والمكدس بكثافة.


المواد والأساليب

نظام التصوير OI-DIC للعينات البيولوجية

يظهر المخطط الرئيسي لنظام الفحص المجهري OI-DIC في الشكل 1A. يشتمل المجهر على مصدر ضوئي مع مرشح ممر النطاق ، ومستقطب ومحلل خطي متقاطع ، ومبدل طور ، وعدسات مكثف وموضوعية ، وعدسة أنبوبية ، وكاميرا رقمية للجهاز المقترن بالشحن (CCD). للتغلب على قيود التصوير التقليدي لمدينة دبي للإنترنت ، يحتوي المجهر على مجموعتين لقص الحزمة (شريباك ، 2014). تتكون كل مجموعة من منشورين متطابقين لمدينة دبي للإنترنت ودوار استقطاب بزاوية 90 درجة. يسمح استقطاب الضوء الدوار بواسطة الدوارات بتبديل اتجاهات القص بسرعة بمقدار 90 درجة دون تدوير العينات ميكانيكيًا (على سبيل المثال ، الخلايا الحية) أو المنشورات. لقد التقطنا ست صور أولية باستخدام الفحص المجهري OI-DIC ، مع اتجاهين قص عموديين وثلاثة تحيزات ± 0.15 و 0 ، حيث λ هو الطول الموجي. تمت معالجة صور OI-DIC التي تم التقاطها في صور OPD (خرائط) تقابل شدتها خطيًا قيمة OPD. تم إجراء معالجة الصور باستخدام برنامج محلي الصنع (OIDIC.exe). تم وصف هذه الخوارزميات وغيرها من خوارزميات المعالجة سابقًا (Shribak and Inoue، 2006 Shribak، 2013 Shribak وآخرون., 2017).

لمقارنة OI-DIC مع مجهر رسم الخرائط CellVista SLIM Pro ، المصنوع من قبل Phi Optics (Champaign ، IL) ، قمنا بتضمين قضبان زجاجية بقطر 7 ميكرون ، والتي تُستخدم كفواصل في شاشات الكريستال السائل ، في تركيب Fisher Permount متوسط ​​(Fisher Scientific ، https://www.fishersci.com). RIs للقضبان الزجاجية ووسيط Permount عند الطول الموجي 546 نانومتر هي 1.56 و 1.524 ، على التوالي. تم الحصول على الصور باستخدام عدسات غمر الزيت 100 × / 1.4 NA. التقطت كاميرا CellVista SLIM أربع صور ذات تباين طوري في التحيزات المختلفة وعالجتها.

تقدير كثافة المحتويات الخلوية

للحصول على منحنيات معايرة لـ RIs للبروتينات والأحماض النووية (الشكل التكميلي S3) ، تم إذابة ألبومين مصل الأبقار (BSA Sigma A-9418) ، والحمض النووي للحيوانات المنوية من سمك السلمون (Fisher Scientific BP-2514) في وسط استنبات الخلية بتركيزات 0 –200 و0–30 مجم / مل على التوالي. تم قياس RIs للحلول المعيارية المعدة باستخدام مقياس الانكسار Abbé-3L (Bausch & amp Lomb). The measured RIs and solution densities were plotted and fitted with linear functions to obtain calibration curves.

We estimated intracellular density distribution from obtained OPD maps using the following two steps (Figure 1B). First, we calculated the RI from the OPD. Because the OPD is proportional to the thickness of a sample and the difference in RI between the sample and the surrounding solution, as shown in Figure 1B, we calculated the RI of samples on the basis of the RI of the surrounding solution and sample thickness. Second, we obtained the dry mass density (“density” for short) of the sample from its RI, because the RI of a sample is proportional to its density. For proteins and nucleic acids, which are the dominant materials in mammalian cells (>60% of dry mass) (Alberts وآخرون., 2007), our calibration curves (Supplemental Figure S3 see above) of RI versus dry mass density using BSA and salmon sperm DNA showed that both were well fitted to linear functions and were almost identical (RI = 1.3375 + 1.4 × 10 –4 × ج، أين ج is dry mass density). Therefore, dry mass density in live cells, which consists mainly of proteins and nucleic acids, was calculated from their RI using a single calibration curve (Supplemental Figure S3). To estimate the densities of the total cell contents, we measured the average thickness of the cytoplasm and nucleus in each cell line (Supplemental Figure S1, A and B). The pericentric foci were assumed to be spherical (Supplemental Figure S1C). To obtain the RI of cytoplasm (RIcy), we used the RI of the surrounding culture medium (RImed, 1.3375) (Supplemental Figure S2). For the RIs of the nucleus and the pericentric foci, we used our calculated values of RIcy and RInuc, respectively (Supplemental Figure S2). These estimates were created using ImageJ software.

EGFP-MeCP2 construction

A plasmid containing MeCP2-EGFP was kindly provided by M.C. Cardoso (Brero وآخرون.، 2005). The moiety of MeCP2-EGFP was cut by Xhoانا و XbaI enzymes and blunted. The blunted fragment was inserted into the سابقة بمعنى البيئةRV site of the pEF5/FRT/VS-DEST Gateway Vector (Invitrogen) to generate pEF5-MeCP2-EGFP-FRT.

EGFP-mH3.1p-H3.1 construction

A mouse histone H3.1 promoter (∼840 base pairs)-H3.1 fragment was amplified from mouse embryonic stem (ES) cell genomic DNA by PCR using the following primer set:

5′-AGCCCTCTCCCCGCGGATGCGGCGGGCCAGCTGGATG­TCC-3′. The amplified fragment was cloned into an EGFP vector to obtain pmH3.1p-H3.1-EGFP. Then two more insert sequences were prepared. One was the H3.1promoter-H3.1-EGFP amplified from the pmH3.1p-H3.1-EGFP vector using the following primer set:

and 5′-TTACTTGTACAGCTCGTCCATGCCGAGAGT-3′. The other was the 3′ untranslated region of H3.1 (∼500 base pairs) amplified from the mouse ES genome using the primer pair: 5′-TGGACGAGC­TGTACAAGTAAAGTTCGTCTTTCTGTGTTTTTCAAA­GGCTC-3′

For backbone vector preparation, the region from the EF1α-promoter to the BGH polyadenylation signal sequence was removed from pEF5/V5-FRT Gateway (Invitrogen) to create the pFRT-Hygromycin vector. The pFRT-Hygromycin vector, H3.1promoter-H3.1-EGFP sequence, and 3′ untranslated region sequence were ligated by SLIC (Li and Elledge, 2007) to prepare the pmH3.1p-H3.1-EGFP-3′UTR-FRT plasmid. In addition, upstream of the H3.1 promoter, an insulator fragment (tandem cHS4 kindly provided by G. Felsenfeld) was inserted to obtain pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT.

EGFP-fibrillarin construction

To clone the fibrillarin gene, total RNA was isolated from NIH3T3 cells using the RNeasy Mini Kit (Qiagen), and first-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Thermo) with oligo(dT). The coding region of fibrillarin was amplified from the first-strand cDNA using the following primer pair: 5′-GGGGTACCATGAAGCCAGGTTTCAGCCC-3′ and 5′-GCGGGA­TCCTCAGTTCTTCACCTTGGGAG-3′. The amplified fragment was digested with Kpnانا و بامHI and ligated into KpnI/بامHI-digested pEGFP-C1 (Clontech, Palo Alto, CA). EGFP-fibrillarin fragments were excised, blunt-ended using T4 DNA polymerase (Takara, Japan), and inserted into سابقة بمعنى البيئةRV-precut pEF1-FRT to generate pEF1-EGFP-fibrillarin-FRT.

Cell culture and stable cell lines

We used RPE1, a human cell line, and NIH3T3, a mouse cell line. All of the cell lines were maintained in DMEM (Lonza) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 0.584 g/l l -glutamine (Sigma) at 37°C with 5% CO2 in air in a humidified incubator. To establish NIH3T3 cells expressing MeCP2-EGFP, EGFP-fibrillarin, or H3.1-EGFP, we used the Flp-In system (Invitrogen) as previously described (Maeshima وآخرون., 2010 Hihara وآخرون., 2012).

OI-DIC microscopy system

Details of the microcopy system are provided in the Supplemental Material.

Live-cell OI-DIC microscopy imaging

Cells were seeded on 24 mm × 24 mm square glass coverslips coated with poly d -lysine (Sigma) and cultured for 1–2 d. Then 30 min before imaging, 500 ng/ml Hoechst 33342 was added into the media and incubated further. The cells were mounted on a glass slide with a thin silicone spacer. We observed the mounted cells by OI-DIC and fluorescence imaging.

OI-DIC imaging of glass rods

A small number of glass rods 4 µm in diameter were suspended in two types of mineral oil with refractive indices of 1.54 and 1.58. Approximately 2 µl of the suspended solution was sandwiched between a glass slide and a coverslip, and then sealed with nail polish. The glass rods in the mineral oil were analyzed by OI-DIC microscopy using the same procedure as the live cell imaging.

تثبيت

For formaldehyde fixation, cells on the square glass coverslips were washed once with phosphate-buffered saline (PBS), and then fixed in 4% formaldehyde at room temperature for 15 min. The fixed cells were washed with 10 mM HEPES-KOH, pH 7.5, 100 mM KCl, and 1 mM MgCl2 (HMK) (Maeshima وآخرون., 2006) and permeabilized with 0.5% Triton X-100 in HMK at room temperature for 5 min. The treated cells were washed with HMK, stained with 500 ng/ml Hoechst 33342 in HMK at room temperature for 10 min, and then washed again with HMK. For MeOH fixation, cells on coverslips were fixed in ice-cold MeOH at –20°C for 30 min. Then the fixed cells were washed with HMK at room temperature for 15 min, stained with 500 ng/ml Hoechst 33342 in HMK for 10 min, and washed again with HMK. Finally, the cells were mounted on a glass slide and observed as described above.

Immunostaining of histone H3K9me3

Immunostaining was performed as previously described (Maeshima وآخرون., 2010 Hihara وآخرون.، 2012). Cells were fixed in 2% formaldehyde (Wako) and permeabilized with Triton X-100. The primary and secondary antibodies were mouse anti-H3K9me3 (a generous gift from Hiroshi Kimura) and Alexa-Fluor-594-conjugated goat anti-mouse immunoglobulin G (Invitrogen) used at dilutions of 1:500 and 1:1000, respectively. Then DAPI (500 ng/ml) was added to the cells for 5 min, followed by washing with PBS prior to DNA staining. Images were obtained using a DeltaVision microscopy imaging system (Applied Precision) or a FLUOVIEW FV1000 confocal laser scanning microscope (OLYMPUS).

Measurements of cell thicknesses

Live RPE1 and NIH3T3 cells were seeded on 35 mm glass-bottom dishes. To fluorescently label DNA and cytoplasm, cells were incubated in culture medium containing 0.5 µg/ml Hoechst 33342 (Dojindo) and 5 µg/ml Calcein-AM (Dojindo) for 30 min. After washing out excess fluorescent dye, the stained cells were observed under an OLYMPUS FLUOVIEW FV1000 confocal laser scanning microscope equipped with a 60 ×/1.2 NA water objective. Hoechst 33342 and Calcein-AM fluorescence signals were acquired as three-dimensional image stacks (500 nm × 32 sections). The thicknesses of three regions (nucleus, cytoplasm, entire cell see Supplemental Figure S1) were measured in each cell line from the acquired stack images by ImageJ software.

Measurement of nuclear volume of live cells

Image stacks of live NIH3T3 and RPE1 cells acquired to measure cell thickness (described above) were used. The images were converted into binary images by auto thresholding in ImageJ software. Then the volumes of binary image stacks were analyzed using the 3D Objects Counter ImageJ plugin (Bolte and Cordelieres, 2006).

Quantification of fluorescence from Hoechst-stained DNA, MeCP2-EGFP, and α-H3K9me3

Image stacks of live or immunostained NIH3T3 cells (described above) were used. The middle sections of Hoechst-stained nuclei were selected from the z-stack images. The highest intensity of a focal plane of heterochromatin and the mean intensity of the surrounding low-intensity region in a nucleus were taken as the intensities of heterochromatin and the surrounding euchromatin. These values were adjusted to account for the background intensity.

Composition estimation of euchromatin and heterochromatin in live cells

The genome size of diploid mouse cells is 5.6 × 10 9 base pairs. Because 1 pg of DNA is 978 × 10 6 base pairs (978 × 10 6 base pairs/pg), the mass of the whole mouse genome is 5.73 pg. If we assume that nucleosomes (core histones + DNA) form every 200 base pairs of the genome and that the mass ratio of core histones to DNA is around 1:1, the mass of the nucleosomes in a mouse nucleus is 11.5 pg (5.73 × 2). The average mouse nuclear volume was calculated to be ∼1000 µm 3 (Supplemental Figure S6B), and the density of nucleosomes in mouse euchromatin was calculated to be 11.5 mg/ml. Further estimates are described under نتائج.

Monte Carlo simulation

Monte Carlo simulation is a computational algorithm that performs a numerical integration by making a random movement and evaluating whether the movement is acceptable based on the change in potential energy (Hibino وآخرون., 2017). All of the molecules in the simulations were treated as hard spherical bodies. We employed a Metropolis Monte Carlo method without long-range potential or hydrodynamic interactions to determine the diffusive motion of molecules (Morelli and ten Wolde, 2008). The diameters and diffusion coefficients (دs) of the crowding agents used in the simulations were 9.6 nm and 9 µm 2 s −1 , respectively, which are comparable to those of a single nucleosome molecule. ال دs of tracers (spheres with diameters of 5, 10, 15, and 20 nm) were 18, 9, 6, and 4.5 µm 2 s −1 , respectively. هؤلاء دs were determined by the Stokes–Einstein relationship based on parameters from the EGFP monomer, the diameter and د of which were 3.8 nm and 23.5 µm 2 s −1 , respectively (Hihara وآخرون.، 2012). Simulations were conducted in a 210-nm cubic box with two compartments (left and right halves) with periodic boundaries to avoid problems caused by finite space, and make the system more like an infinite one. For the “nucleosomes only” scenario, which corresponds to 11.5 mg/ml (euchromatin) and 85.9 mg/ml (heterochromatin), 134 and 968 copies of 9.6 nm spheres (crowding agents) were randomly placed in the left and right halves of the box, respectively. These crowding agents mimicked nucleosomes displaced less than 5 nm from their initial positions at t = 0 s (the “dog on a leash” model see also Hihara وآخرون., 2012, and Maeshima وآخرون.، 2015). Then 50 tracers that could diffuse freely were placed in the left (euchromatin) region. The motion of the molecules was iteratively simulated following previously described procedures (Hihara وآخرون., 2012 Maeshima وآخرون.، 2015). For the second simulation (nucleosomes + nonnucleosomal materials), 1578 and 1578–3945 9.6 nm spheres (crowding agents) were randomly placed in the left and right regions of the box, respectively, to represent euchromatin and heterochromatin (1.53–2.5-fold density differences). To represent nucleosomes, 134- and 968 9.6-nm spheres were randomly placed in the left and right regions, with their behavior following the “dog on a leash” model. The rest of the spheres moved freely only in each half, to represent diffusing proteins and RNAs. Then 50 tracers were placed in the left (euchromatin) region. Although the simulation process was similar to the first simulation, we restricted the movements of crowding agents to within their regions to keep the density of each region constant. Results were obtained by averaging 150 samples from three independent trials. The simulation time step, Δt, was 10 ns.

تحاليل احصائية

All of the statistical analyses were performed using the two-tailed Student’s ر اختبار. ص values less than 0.05 were considered statistically significant.


شاهد الفيديو: Euchromatin and Heterochromatin Constitutive vs Facultative. Chromatin Regulation (ديسمبر 2022).