معلومة

هل مواقع انقسام الحمض النووي الريبي (RNA) دائمًا ما تكون متعددة الأدينيلات؟

هل مواقع انقسام الحمض النووي الريبي (RNA) دائمًا ما تكون متعددة الأدينيلات؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أثناء معالجة RNA (بما في ذلك كل من mRNA و RNAs غير المشفر) ، هل نهاية 3'UTR دائمًا متعدد الأدينيلات بعد الانقسام؟

لم أتمكن من العثور على إجابة لسؤالي في مدخل ويكيبيديا الخاص بعديد الأدينيل.

إذا أمكن توفير مرجع حديث ، فسيكون ذلك رائعًا. لقد أجريت القليل من البحث ولم أجد مصدرًا جيدًا حتى الآن.

بعض المعلومات الأساسية عن هذا السؤال: نحن نطور أدوات المعلوماتية الحيوية للتنبؤ بمواقع الانقسام المحتملة ، نحتاج إلى فهم هذه المشكلة بشكل أفضل من أجل تصميم خوارزمية مناسبة


تحاول هذه الإجابة تغطية فقط مسألة معالجة مرنا. نعم هو كذلك ليس معالجة عديد الأدينيل من الحمض النووي الريبي غير المشفر.

بقدر ما أستطيع أن أرى من الاستعراض الأخير من قبل Neve وآخرون. (2017) الانقسام والبولي أدينيل مقترن بإحكام. من المثير للاهتمام ، في هذا الصدد ، أن الهيستونات mRNAs التي تفتقر إلى ذيول polyA ، لها بنية مختلفة ، تفتقر إلى AAUAAA الكنسي ، في نهاياتها 3ʹ (انظر المراجعة بواسطة Marzluff) وآخرون.).

نظرًا لأن أنشطة الإنزيم المتميزة متورطة في الانقسام وبولي أدينيل ، فقد أتخيل أنه من الممكن (إما وراثيًا أو كيميائيًا) تعطيل مركب البروتين المسؤول عن تعدد الأدينيل وبالتالي منع حدوثه (ربما تم القيام بذلك). لكن هذا لن يكون ذا صلة من الناحية الفسيولوجية.

هناك مراجعة سابقة قام بها Tian and Graber (2007) لمتطلبات التسلسل لموقع الانقسام والتي لا تميز بين الانقسام وعديد الأدينيل.

ومع ذلك ، هذا ليس مجال تخصصي ، لذلك قد يكون لدى الآخرين معلومات إضافية فاتني.


Mitochondrial mRNA 3 انشقاق / عديد الأدينيل وتحرير RNA في المثقبية البروسية هي أحداث مستقلة

تنظيم جينوم الدائرة القصوى للميتوكوندريا المثقبية البروسية فريد من نوعه في التعبئة القريبة لجينات الرنا المرسال. بالنسبة للكثيرين منهم ، تتداخل طرفي 5 و 3 للنصوص المجاورة ويمكن أن يؤدي تكوين الطرف المناسب 3 أو 5 إلى إزالة جزء من تسلسل الترميز للجين المجاور. تم اكتشاف نسخ كبيرة متعددة الجينات ، مما يشير إلى أن آليات الانشقاقات الدقيقة في حدود الجينات 5 ′ و 3 يجب أن توجد. ومع ذلك ، لم يتم اكتشاف تسلسلات شائعة بالقرب من نهايات الرنا المرسال التي يمكن أن تكون مرشحة لمناطق التحكم. بالإضافة إلى ذلك ، لا يُعرف أي شيء عن كيفية تفاعل تحرير RNA مع معالجة 5 ′ و 3 و / أو تعلقها بعديد الأدينيل وتأثيرهما. تم الكشف عن نصوص السلائف المحررة ، مما يشير إلى أن مجمعات التحرير يمكن أن تتجمع قبل تقسيم النص. نظرًا لأن التحرير يبدأ غالبًا بالقرب من نهاية 3 من الرنا المرسال ، فإن تجميع مجمع التحرير في هذه المنطقة قد يؤثر على عملية اختيار الانقسام. من أجل تحديد مدى تفاعل تحرير RNA و 3 end-Processing ، تم تحليل RNAs لتحديد مدى التحرير في السلائف RNAs ولتحديد ما إذا كان يمكن شق النصوص غير المحررة و polyadylated. تم تحليل تقاطعات RNA متداخلة بين الوحدة الفرعية NADH dehydrogenase (ND) والوحدة الفرعية الثالثة السيتوكروم أوكسيديز (CO) ، والتقاطع بين الوحدة الفرعية CO II وإطار القراءة غير المحدد maxicircle (MURF) II. لكل من هذين الرنا ، يؤثر التحرير على تسلسل التعرف على نوكلياز التقييد ، مما يسمح لنا بتحليل أنماط التحرير عن طريق هضم التقييد التفاضلي. تشير هذه التحليلات إلى أنه عندما يتم توفير جرنا في عبريعد تحرير الحمض النووي الريبي (RNA) والانقسام / تعدد الأدينيل أحداثًا مستقلة ، وفي حين أنها قد تؤثر على بعضها البعض ، فإن أحد الأحداث لا يعتمد على الآخر. على العكس من ذلك ، بالنسبة لنسخة COII ، حيث يقع gRNA في نهاية 3 من mRNA ويبدو أنه يتم توفيره في رابطة الدول المستقلة، لم يتم الكشف عن السلائف المحررة. يشير هذا إلى الحاجة إلى تفاعل دقيق داخل الجزيء لتحرير COII لا يمكن أن يتشكل قبل النضج النهائي 3.


التحكم في طول بولي (أ)

عامل الانقسام وعديد الأدينيل (CPF)

CPF (يُطلق عليه أيضًا SF ، عامل الخصوصية ، أو PF2 ، عامل polyadenylation 2) يمنح خصوصية تسلسل AAUAAA للمرحلة الأولى من polyadenylation (Christofori and Keller ، 1988 Gilmartin and Nevins ، 1989 Takagaki وآخرون. ، 1989) ، وتحفيز نشاط البلمرة لـ PAP. تم تنقية العامل مؤخرًا إلى التجانس القريب من كل من خلايا العجل التوتة وخلايا هيلا (Bienroth وآخرون. ، 1991) ، ويتكون من مجمع كبير ، ما يقرب من 500 كيلو دالتون ، يتكون من أربعة عديد ببتيدات مختلفة. يتعرف CPF ويرتبط مباشرة بتسلسل AAUAAA (Keller وآخرون., 1991) .


نسخة من الأجزاء الفرعية النووية

بالنسبة لخط الخلية K562 ، قمنا أيضًا بتحليل الحمض النووي الريبي المعزول من ثلاث حجرات تحت النواة (الكروماتين والنواة والنيوكليوبلازم التكميلي 5). تم تحديد ما يقرب من نصف (18،330) جينات Gencode (v7) المشروحة التي تم اكتشافها لجميع خطوط الخلايا الخمسة عشر (35،494) في تحليل هذه الأجزاء الفرعية النووية الثلاثة فقط. بالإضافة إلى ذلك ، كان هناك العديد من الجينات الجديدة غير المشروحة الموجودة في الأجزاء الفرعية K562 كما كانت موجودة في جميع مجموعات البيانات الأخرى مجتمعة (الجدول التكميلي 5 والجدول 1 ب). بالنسبة لجميع العناصر المشروحة (الجدول التكميلي 5.1) أو العناصر الجديدة (الجدول التكميلي 5.2) ، كان جزء صغير فقط في كل جزء فرعي فريدًا لتلك المقصورة (الجدول التكميلي 6).


آلية التحلل التفضيلي للحمض النووي الريبي متعدد الأدينيلات في البلاستيدات الخضراء. يُظهر فوسفوريلاز exoribonuclease 100RNP / polynucleotide تقاربًا عاليًا للربط لتسلسل بولي (A)

لقد ثبت مؤخرًا أن عملية تعدد الأدينيل في الرنا المرسال في البلاستيدات الخضراء تستهدف جزيء الحمض النووي الريبي من أجل التحلل السريع للنووية. تم اقتراح نموذج يبدأ فيه تحلل البلاستيدات الخضراء mRNA عن طريق الانقسام (الانقسامات) الحال للنووية متبوعًا بإضافة متواليات غنية بالبولي (A) والتحلل السريع للنووية. عندما تم تحضين الحمض النووي الريبي المنسوخ في المختبر مع مستخلص بروتين البلاستيدات الخضراء ، أدت المنافسة بين الحمض النووي الريبي متعدد الأدينيلات وغير متعدد الأدينيلات من أجل التحلل إلى التدهور السريع للجزيئات المتعددة الأدينيلات وتثبيت نظيراتها غير المتعددة الأدينيلات. لتوضيح الآلية الجزيئية التي تحكم هذا التأثير ، حددنا ما إذا كان البلاستيدات الخضراء exoribonuclease 100RNP / polynucleotide phosphorylase (PNPase) يحلل بشكل مفضل الحمض النووي الريبي متعدد الأدينيل. عند الحضانة بشكل منفصل مع كل جزيء ، يتم عزل 100RNP / PNPase المعزول متعدد الأدينيلات وغير متعدد الأدينيل بنفس المعدل. ومع ذلك ، عندما تم خلط كلا الجزيئين معًا ، يتحلل الحمض النووي الريبي متعدد الأدينيلات ، بينما تم تثبيت الحمض النووي الريبي غير متعدد الأدينيلات. في تجارب ربط RNA ، ربط 100RNP / PNPase تسلسل بولي (A) بتقارب أعلى بكثير من جزيئات الحمض النووي الريبي الأخرى ، وبالتالي تحديد بولي (A) -RNA كركيزة تفضيلية للإنزيم. لذلك ، قد يكون 100RNP / PNPase متورطًا في آلية يتم فيها إضافة تسلسل غني بالبولي (A) بعد النسخ يستهدف الحمض النووي الريبي البلاستيدات الخضراء من أجل التحلل السريع للنووية.


المواد والأساليب

إجراءات الخميرة

تم تحويل سلالات الخميرة وفقًا لـ Gietz و St Jean (1992). تم إجراء تجارب الحث كما وصفها Fatica et al. (2000) مع W303 من النوع البري & # x000a0cells (حصيرةأ, ura3-1، trp1-1، ade2-1، leu2-3 112، his3-11،15) تحمل البلازميدات كما هو موضح في الشكل & # x000a0 7 والجدول & # x200B TableI.

الجدول الأول.

قالب الجين3 & # x02032-UTR تسلسل أ البلازميد لنسخ الجريان ب البلازميد في الجسم الحي التحليل ج
CYC1sCYC1 (نوع بري)pBD101pBD256
CYC1& # x00394EE5 & # x02032pBD140& # x000a0
CYC1& # x00394EE3 & # x02032pBD141& # x000a0
CYC1& # x00394PEpBD139& # x000a0
CYC1& # x00394512pBD138pBD263
CYC13GIpBD165& # x000a0
CYC13GIIpBD166pBD257
CYC13GIIIpBD167& # x000a0
CYC13GIVpBD168& # x000a0
CYC13GVpBD169& # x000a0
CYC13GIV & # x0002bV& # x000a0pBD259
CYC13GI & # x0002bIIIpBD170& # x000a0
CYC13GI & # x0002bIVpBD171& # x000a0
CYC13GI & # x0002bVpBD172& # x000a0
CYC13GII & # x0002bIVpBD173& # x000a0
CYC13GII & # x0002bVpBD174& # x000a0
CYC13GII & # x0002bIV & # x0002bVpBD176pBD262
CYC1CUGpBD208pBD258
CYC13GII & # x0002bCUGpBD209pBD260
CYC13GIV & # x0002bV & # x0002bCUGpBD210pBD261
ADH1sADH1 (نوع بري)pBD159& # x000a0
ADH13GIIpBD192& # x000a0
ADH13GIV & # x0002bVpBD194& # x000a0
ADH1CUGpBD205& # x000a0
ADH13GII & # x0002bCUGpBD206& # x000a0
ADH13GIV & # x0002bV & # x0002bCUGpBD207& # x000a0
GAL7sGAL7 (نوع بري)pBD142& # x000a0
GAL73UIIpBD198& # x000a0
GAL73UIIIpBD199& # x000a0
GAL73UIV & # x0002bVpBD200& # x000a0
GAL73UII & # x0002bIIIpBD201& # x000a0
GAL73UII & # x0002bIV & # x0002bVpBD202& # x000a0
GAL73UIII & # x0002bIV & # x0002bVpBD203& # x000a0

يشار إلى متواليات 3 & # x02032-UTR و RNAs المتحولة المقابلة في الأشكال.

ب تم استنساخ التسلسلات في ملف هينdIII & # x02013سابقة بمعنى البيئةمواقع RI لـ pGEM3 (Promega).

تم تضخيم تسلسل c 3 & # x02032-UTR باستخدام PCR باستخدام بلازميدات نسخ الجريان كقوالب واستنساخها في زهوأنا & # x02013Kpnأنا مواقع P414 (GAL1-U24 & # x0002a-CYC1-terminator Fatica et al. ، 2000).

البلازميدات

pGDV1 مشتق من pGEX-4T-3 (فارماسيا). تم استبدال موقع الاستنساخ المتعدد (MCS) لـ pGEX-4T-3 بـ MCS لـ pRS315-LEU2-ProtA & # x02013TEV (Senger et al. ، 1998) ، مقدمًا تسلسل التعرف على TEV protease 3 & # x02032 لمنطقة تشفير GST . pBD71 (ضريبة السلع والخدمات # x02013Ydh1p-H6) تم إنتاجه بواسطة تضخيم PCR لـ YDH1 & # x0002fCFT2 منطقة ترميز تحتوي على أليغنوكليوتيدات YDH1 (AATGGCCATGGAGATGACTTATAAATACAATTGC) و YDHCH6 (TTTTTGATCCTCAGTGGTGGTGTGGTGGTGGATTTTTGC) واستنساخ Ncoأنا & # x02013باممرحبا (حادة) في جزء Ncoأنا & # x02013زهوأنا (غير حاد) مواقع pGDV1. تم الحصول على قوالب الحمض النووي للنصوص القصيرة بواسطة PCR وتم تلخيصها في الجدول & # x200B TableI. أنا . عمليات الحذف أو التغييرات الأساسية كذلك هينdIII و سابقة بمعنى البيئةتم ترميز مواقع تقييد RI التمهيدي. تم استخدام هذه المواقع لاستنساخ الأجزاء في pGEM3 (Promega). تم التحقق من البنى عن طريق التسلسل على جهاز التسلسل الشعري Perkin-Elmer. الانشاءات المستخدمة ل في الجسم الحي تم الحصول على التحليل عن طريق تضخيم PCR لتسلسل 3 & # x02032-UTR باستخدام البلازميدات لنسخ الجريان السطحي كقوالب (انظر الجدول & # x200B TableI). أنا ). تم استنساخ التسلسلات المعنية في ملف زهوأنا & # x02013Kpnأنا مواقع P414 (فاتيكا وآخرون ، 2000) مع مواقع تقييد مشتقة من قليل النوكليوتيد.

قوالب الحمض النووي والنسخ في المختبر

داخليًا تم إنتاج 32 P المسمى CYC1 و CYC1-512 و CYC1-Pre و GAL7-1 و GAL7-3 RNAs كما هو موصوف (Minvielle-Sebastia et al. ، 1998). قوالب النصوص القصيرة (الجدول & # x200B (TableI) I) كانت خطية باستخدام سابقة بمعنى البيئةRI ، منسوخ بواسطة SP6 RNA polymerase في وجود & # x0005b & # x003b1- 32 P & # x0005dUTP وتنقيته على 8.3 & # x000a0M urea & # x0002f12 & # x00025 polyacrylamide gel. بالنسبة إلى وضع العلامات 5 & # x02032-end ، تم الحصول على RNAs عن طريق النسخ البارد ، ومعالجتها بالفوسفاتيز القلوي وتم تمييزها بـ & # x0005b & # x003b3- 32 P & # x0005dATP و T4 polynucleotide kinase.

فحوصات الانقسام في المختبر

تم الحصول على عامل CPF من مستخلصات الخميرة MO20 كما هو موصوف سابقًا (Ohnacker وآخرون، 2000). تم استكمال جزء 1 & # x000a0 & # x000b5l من CPF بـ 0.4 & # x000a0 & # x000b5l من جزء CF & # x000a0IA المنقى (MonoQ Minvielle-Sebastia وآخرون. ، 1998) واحتضانها بـ 20 & # x000a0fmol من الحمض النووي الريبي المسمى تحت ظروف المعالجة القياسية لـ 1 & # x000a0h عند 30 & # x000b0C (Minvielle-Sebastia وآخرون. ، 1994). للسماح بالانقسام فقط ، تم استبدال MgAc بـ EDTA وتم استبدال ATP بـ CTP. مائة نانوجرام من GST & # x02013Nab4p (Minvielle-Sebastia وآخرون. ، 1998) إلى ردود الفعل كما هو مبين في الأشكال.

عزل الحمض النووي الريبي والتحليلات الشمالية

تم عزل مجموع الحمض النووي الريبي من 10.0 OD600 نانومتر من مزارع الخميرة عن طريق إجراء استخراج الفينول الساخن (Collart and Oliviero ، 1994). تم حل RNAs على 8.3 & # x000a0M urea & # x0002f8 & # x00025 polyacrylamide gel ، وتم إجراء التهجين الشمالي وفقًا لـ Tollervey (1987) باستخدام oligonucleotide anti-U24-tag (TGCGGACTGCCTGGATGCCGGTT) و Anti-U14 (TCACTC) x003b3- 32 P & # x0005dATP و T4 عديد النوكليوتيد كيناز.

تعبير البروتين المؤتلف وتنقيته

الإشريكية القولونية BL21 pLysS (Studier ، 1991) تحول مع plasmid pBD71 (GST & # x02013Ydh1p-H6) عند 25 & # x000b0C إلى OD600 2.0 & # x020134.0. بعد الحث باستخدام 0.5 & # x000a0mM isopropyl - & # x003b2- d -thiogalactopyranoside ، استمرت الحضانة لمدة 6 & # x000a0h. تم إجراء تحلل الخلايا وتنقيتها عن طريق الارتباط بـ Ni-NTA (حمض النيكل-نتريلوترياسيتيك- agarose Qiagen) وفقًا لتعليمات الشركة المصنعة & # x02019s. تم استكمال الكسور بـ 100 & # x000a0m KCl وتنقيتها على الجلوتاثيون Sepharose 4B على النحو الموصى به (Pharmacia) ، ومع ذلك ، تم تنفيذ جميع الخطوات عند 4 & # x000b0C أو على الجليد. تمت التصفية من البروتينات باستخدام المخزن المؤقت & # x000a0G (10 & # x000a0mM مخفض الجلوتاثيون ، 50 & # x000a0mM Tris-HCl pH 8.0 ، 0.01 & # x00025 NP-40 ، 0.1 & # x000a0mg & # x0002fml مصل الأبقار الزلال ، 10 & # x00025 الجلسرين).

تفاعلات RNA & # x02013 البروتين

تم تعديل قائمة سحب ضريبة السلع والخدمات (GST) من Murthy and Manley (1995): 500 & # x000a0ng من GST أو GST & # x02013Ydh-H6 كان البروتين مرتبطًا بـ 15 & # x000a0 & # x000b5l من الجلوتاثيون Sepharose 4B عند 4 & # x000b0C لـ 60 & # x000a0min والراتنج مغسول بـ 1 & # x000a0ml من المخزن المؤقت لربط الحمض النووي الريبي & # x0005bRBB 13 & # x000a0mM HEPES & # x0.9 #32013 # x000a0mM (NH4)2وبالتالي4، 33 & # x000a0mM KCl، 1 & # x000a0mM MgCl2، 0.1 & # x000a0mM EDTA، 0.2 & # x000a0mM dithiothreitol (DTT)، 0.01 & # x00025 NP-40 & # x0005d. قسامة 50 & # x000a0 & # x000b5l من RBB تحتوي على 50 & # x000a0fmol من RNA المسمى ، 0.5 & # x000a0U من RNAguard (Pharmacia) و 1 & # x000a0mg & # x0002fml بكتريا قولونية تمت إضافة tRNA ، متبوعًا بالتناوب عند 4 & # x000b0C لـ 120 & # x000a0min. تم غسل الراتينج ثلاث مرات (1 & # x000a0ml من RBB) لمدة 5 & # x0201315 & # x000a0min بالتناوب عند 4 & # x000b0C ومعالجتها بـ 50 & # x000a0 & # x000b5l من البروتين & # x000a0K-mix & # x0005b1 & # x000a0 & # x000 20 & # x000a0mg & # x0002fml)، 0.5 & # x000a0 & # x000b5l glycogen (20 & # x000a0mg & # x0002fml) ، 100 & # x000a0mM Tris pH & # x000a07.5، 12.5 & # x000a0mM EDTA، 1 & # x00025 (wsdSv & # x00025) x000a0mM NaCl & # x0005d لـ 30 & # x000a0min عند 42 & # x000b0C. بعد الاستخلاص بحجم واحد من الفينول & # x0002fchloroform & # x0002fisoamylalcohol (25: 24: 1) ، تم ترسيب الإيثانول RNA وحلّه في 8.3 & # x000a0M اليوريا & # x0002f6 & # x00025 polyacrylamide هلام.

رسم خرائط RNase H: لكل مقايسة 0.5 & # x020131.0 & # x000a0 & # x000b5g من البروتين كان مرتبطًا بـ 50 & # x000a0fmol من RNA المسمى في RNase H buffer # x0005b100 & # x000a0mM KCl، 50 & # x000aH0mM Tris & # x0.5 #3Cla ، 5 & # x000a0mM MgCl2، 1 & # x000a0mM DTT ، 2 U TEV protease (Gibco-BRL) ، 2 U RNAguard & # x0005d لـ 15 & # x000a0min عند 30 & # x000b0C. تمت إضافة قسامات (10 & # x000a0 & # x000b5l) من هذا المزيج إلى 2 & # x000a0 & # x000b5l من مزيج مسبق (0.5 U RNase H و 20 & # x000a0pmol oligonucleotide) واستمرت الحضانة لمدة 60 & # x000a0min عند 30 & # x000b0C. بعد العلاج بالبروتينيز & # x000a0K (انظر أعلاه) ، تم ترسيب الإيثانول من الحمض النووي الريبي وحلها على مادة هلامية من مادة البولي أكريلاميد 8.3 & # x000a0M & # x0002f12 & # x00025 polyacrylamide.


3 وفرة البولي ادينيل البديل في الدماغ يدعم الوظيفة العصبية

3.1 التحكم في الربط وعديد الأدينيل تعبير CGRP

يعبر الدماغ والخلايا العصبية الطرفية عن نسبة أكبر من الجينوم من أي نسيج آخر ، مما يؤدي إلى مستوى عالٍ من تنوع الرنا المرسال. يُعزى معظم هذا التنوع إلى التضفير البديل ومواقع بدء النسخ والبولي أدينيل. في الواقع ، كانت أول حالة موصوفة للمعالجة البديلة لجين الثدييات هي بروتين ألفا الببتيد المرتبط بجين كالسيتونين (CGRP). يتم التعبير عن CGRP من كالكا الجين ، الذي ينتج الكالسيتونين في الأنسجة غير العصبية. اقترحت التقارير الأولى أن نمط معالجة CGRP سببه APA (Amara ، Evans ، & Rosenfeld ، 1984) ، لكن الدراسات اللاحقة حددت أن المعالجة العصبية لـ CGRP من الكالسيتونين كانت عبارة عن مجموعة معقدة من الربط البديل وبولي أدينيل لا يزال يحمل أسرارًا ( Zhou، Baraniak، & Lou، 2007).

مثل CGRP ، HuR (رمز الجين إيلافل 1) عديد الأدينيلات بدلاً من ذلك في الخلايا العصبية مما يؤدي إلى غلبة الشكل الإسوي مع قمع أطول بكثير 3 ′ للمنطقة غير المترجمة (UTR) للشكل الإسوي الأقصر قد يتضمن ارتباط RNA للعديد من أعضاء عائلة بروتين Hu (مانسفيلد وكين ، 2012). على الرغم من أنه ليس دائمًا ميكانيكيًا ، فقد كشفت العديد من الدراسات الاستقصائية عالية الإنتاجية لـ mRNAs في الأنسجة العصبية أن APA في الدماغ ينتج عنه 3 ′ UTRs أطول من الأنسجة الأخرى (Fontes et al. ، 2017 Miura ، Shenker ، Andreu-Agullo ، Westholm ، Lai ، 2013). في الخلايا العصبية ، غالبًا ما ينتج عن 3 UTRs الأطول ترجمة انتقائية لتلك الأشكال الإسوية من الرنا المرسال في التشعبات والمحاور (Ainsley ، Drane ، Jacobs ، Kittelberger ، & Reijmers ، 2014 Terenzio et al. ، 2018) أو تكشف عن exons الأخير البعيد الذي يمكنه ترجمة النصوص إلى نيريتس (Taliaferro et al. ، 2016). نعتقد أيضًا أن تقنيات مثل c-Tag-PAPERCLIP ، حيث يمكن ربط علامات الحاتمة ببروتينات ربط الحمض النووي الريبي (RNA) ذات الأهمية في أنواع معينة من خلايا الفأر (Hwang et al. ، 2017) ، ستزيد من فهم APA في الدماغ وغيرها. مناديل.

3.2 يتم التعبير عن ثلاثة أشكال من CstF-64 في الدماغ

أظهرت الدراسات من مختبرنا أن CstF-64 (الذي يتم التعبير عنه في جميع الأنسجة) ومتغيرين ، τCstF-64 و CstF-64 (الشكل 2) ، يتم التعبير عنها في الدماغ. τCstF-64 (اسم الجين Cstf2t) هو نظير إعادة نقل لـ CstF-64 يتم التعبير عنه بأعلى المستويات في الخصية ، ولكن يتم اكتشافه أيضًا في خلايا الدماغ والمناعة (والاس وآخرون ، 1999 والاس ، دينيسون ، عطايا ، وماكدونالد ، 2004). تم العثور على τCstF-64 بمستويات مختلفة في أنسجة أكثر من الخصية والدماغ ، بما في ذلك القلب والكبد (Yao et al. ، 2013) ، والخلايا الجذعية الجنينية (Youngblood، Grozdanov، & MacDonald، 2014 Youngblood & MacDonald، 2014). الحذف المستهدف لـ Cstf2t لم ينتج عن مشاكل مناعية واضحة (داس وآخرون ، 2007) ، ولكن خسارته زيادة أداء إناث الفئران وليس الذكور في مهام تتضمن التعلم المكاني والذاكرة (Harris et al. ، 2016). يشير هذا إلى أنه ، في حين أنه ضروري لتكاثر الذكور ، فإن وجود τCstF-64 ضار بالإدراك الأنثوي.

34 يومًا). يشار إلى الخلايا التي تخضع للانقسام الانقسامي (الحيوانات المنوية) ، والانقسام الاختزالي (الخلايا المنوية) ، وتطور ما بعد الانقسام (الحيوانات المنوية المستديرة أو المستطيلة ، الحيوانات المنوية). فترات التعبير لـ CstF-64 و CstF-64 و CPSF-160 و CFIم25 ، CFIم68 و Wdr33 / WDR33 موضحة في الشكل السفلي. يشير تعطيل XY إلى فترة تعطيل كروموسوم الجنس الذكري

من ناحية أخرى ، يبدو أن βCstF-64 يلعب دورًا أساسيًا في مادة عديد الأدينيل الخاصة بالدماغ. βCstF-64 (تم اختيار الحرف اليوناني β لتعيين تعبيره في الدماغ) هو متغير لصق خاص بالخلايا العصبية ينتج عنه إضافة 49 حمضًا أمينيًا داخل المجال الغني بالبرولين / الجليسين لـ CstF-64 (شانكارلينج ، كوتس ، داس ، وماكدونالد ، 2009). يتم التعبير عن βCstF-64 في جميع مناطق الدماغ والأعصاب المحيطية ، مما يشير إلى أن لها وظيفة في كل مكان في الجهاز العصبي. علاوة على ذلك ، فهو موجود في جميع الفقاريات ، مما يوحي بأن وظيفته قديمة ومهمة. أخيرًا ، يحفز التعبير خارج الرحم عن βCstF-64 في الخلايا الجسدية التعبير عن mRNAs مراسل لوسيفيراز مع مواقع تعدد الأدينيل العصبية (Shankarling & MacDonald ، 2013) ، مما يدل على تورطه المحتمل في معالجة mRNA. ومع ذلك ، لم يتم بعد إثبات الدور المباشر لـ βCstF-64 في التحكم في APA.

تؤدي المنافسة بين CstF-64 و hnRNP H (انظر الشكل 1) إلى تغيير كل من تعدد الأدينيل والربط في أسيتيل كولينستراز والنصوص الأخرى في الخلايا الشبيهة بالخلايا العصبية البشرية (ناظم وآخرون ، 2016). وبالمثل ، يتنافس HuR / Elavl1 مع CstF-64 للارتباط بتسلسلات U-rich (H. Zhu، Zhou، Hasman، & Lou، 2007) ، والتي قد يكون لها عواقب في الخلايا العصبية (K. Sun et al. ، 2018). بينما يتم التعبير عن HuR في كل مكان ، يشير التعبير عن أشكاله المتخصصة في الدماغ إلى أنه قد يكون مرشحًا كعامل متعدد الأدينلة خاص بالأنسجة. وكشف ، نسخ عدد الاختلافات (إما الازدواجية أو الحذف) من NUDT21 الجين الذي يشفر CFIمينتج 25 عن إعاقة ذهنية بسبب APA من MeCP2 mRNA (Gennarino et al. ، 2015).

3.3 تتحكم نوفا في عملية الربط بالبولي أدينيل البديل وكذلك الربط البديل

بروتينات المستضد البطني العصبي للأورام (Nova) هي عائلة من البروتينات المرتبطة بالـ RNA التي تم العثور عليها مرتبطة بترنح الرمع العضلي المصاحب للأورام ، وهو اضطراب عصبي يرتبط أيضًا بالورم الأرومي العصبي. تحليلات مواقع Nova-1 (اسم الجين: نوفا 1) أظهر الارتباط في الحمض النووي الريبي للدماغ ارتباطًا قويًا بـ Nova-1 مع مناطق intronic بالقرب من exons البديل ، بالإضافة إلى التغييرات في أنماط لصق الجينات الرئيسية (Ule et al. ، 2003). اكتشفت التحليلات اللاحقة ارتباطًا إضافيًا لـ Nova-1 مع 3 UTRs من pre-mRNAs بالقرب من مواقع polyadenylation (Licatalosi et al. ، 2008). أدى إدراج تلك المواقع في 3 نهاية جينات المراسل إلى خفض تعدد الأدينيل في وجود Nova-1. Licatalosi et al. (المرجع السابق) يتكهن أن Nova-1 يمكن أن يثبط عملية تعدد الأدينيل في بعض المواقع عن طريق الارتباط المجاور لعناصر CPSF أو CstF في pre-mRNA ، أو يمكن أن يعزز polyadenylation في مواقع أخرى عن طريق استعداء ارتباط "عوامل مساعدة" غير معروفة. الاحتمال الثالث الذي لم يعدده المؤلفون هو أن نوفا قد تجتذب عوامل التضفير المساعدة إلى مواقع عديد الأدينيل ، وتؤثر على اختيار الموقع بهذه الطريقة. باستخدام تقنية الربط المتشابك والترسيب المناعي (cTag-PAPERCLIP ، المذكورة أعلاه) ، Hwang et al. (2017) تحديد أدوار NOVA2 و PTBP2 بشكل أفضل في APA في الخلايا العصبية والدبقية الدبقية. على الرغم من أن الآلية لا تزال غير محددة ، فقد ارتبطت بروتينات نوفا بالتحكم العصبي في APA.


الملخص

تعد مادة عديد الأدينيل البديلة (APA) آلية معالجة الحمض النووي الريبي (RNA) التي تولد 3 نهايات متميزة على mRNAs وغيرها من نسخ RNA polymerase II. إنه منتشر في جميع الأنواع حقيقية النواة ومعترف به كآلية رئيسية لتنظيم الجينات. يعرض APA خصوصية الأنسجة وهو مهم لتكاثر الخلايا والتمايز. في هذه المراجعة ، نناقش أدوار APA في العمليات الخلوية المتنوعة ، بما في ذلك استقلاب mRNA ، وتنويع البروتين وتوطين البروتين ، وبشكل أكثر عمومية في تنظيم الجينات. نناقش أيضًا الآليات الجزيئية الكامنة وراء APA ، مثل التباين في تركيز عوامل المعالجة الأساسية والبروتينات المرتبطة بـ RNA ، وكذلك التنظيم القائم على النسخ.


RNA الربط ومعالجة أمبير

• يتم التعرف على هيكل الغطاء من خلال عوامل البروتين للتأثير على استقرار الرنا المرسال ، والربط ، والتصدير ، والترجمة.

• الوظيفة الرئيسية هي حماية mRNA من التدهور.
• يتم التعرف على الغطاء عن طريق مغاير البروتين الملزم للغطاء (CBP20 / 80) لتسهيل التصدير من النواة.

• تتم عملية السد أثناء النسخ وقد تكون مهمة للإفراج عن التوقف المؤقت للنسخ.

• يتشكل الوعر عندما يتم شق الإنترون في موقع لصق 5 ، ويتم ربط الطرف 5 بموضع 2 في A عند موقع الفرع في intron.

• الحمض النووي الريبي النووي الصغير (snRNA snurps) - واحد من العديد من أنواع الحمض النووي الريبي الصغيرة المحصورة في النواة ، يشارك العديد منها في التضفير أو تفاعلات معالجة الحمض النووي الريبي الأخرى. توجد snRNAs كجسيمات بروتين نووي (snRNA + عدة بروتينات) = snRNP أو snurp.

• رنا نووي صغير (snoRNA) - رنا نووي صغير موضعي في النواة.

• كل snRNA موجود في جسيم بروتين نووي صغير خاص به.

• snRNPs الخمسة المشاركة في الربط هي U1 و U2 و U5 و U4 و U6.

• جنبا إلى جنب مع بعض البروتينات الإضافية ، تشكل snRNPs spliceosome.

12 MDa. تمثل خمسة snRNPs ما يقرب من نصف الكتلة.

• عامل التضفير - مكون بروتيني في جسيم لصق ليس جزءًا من أحد snRNPs.


مقدمة

إحدى الآليات المركزية في تنظيم الجينات هي مرسال الحمض النووي الريبي (mRNA) متعدد الأدينيل ، أي تراب عديد الأدينيل [poly (A)] في نهاية 3 [1] - [3] ، مما يؤثر بشدة على تصدير الرنا المرسال واستقراره ووظائفه وهو أمر بالغ الأهمية لتنمية الكائنات الحية [4] - [6]. خطوة أساسية في نضج جميع الرنا المرسال ، المعالجة 3 عبارة عن تفاعل ثنائي الخطوتين مقترن بإحكام: انشقاق داخل النواة في موقع poly (A) (أي موقع الانقسام) ، متبوعًا بالإضافة المباشرة لذيل بولي (A) [7] - [9]. لا يوجد سوى عدد قليل من الاستثناءات: إضافة النيوكليوتيدات غير المفترضة إلى النهاية 3 في بعض أرابيدوبسيس mRNAs [10] و mRNAs البشرية [11] ، بما في ذلك بعض RNAs الريبوزومية (rRNAs) [12] ونقص polyadenylation بعد الانقسام في هيستون mRNAs في بعض أنواع metazoan [7] ، [8] ، [13]. يشارك معقد RNA polymerase II في معالجة ما قبل mRNA ، وغالبًا ما يظل الحمض النووي الريبي الناشئ مرتبطًا بالموضع الكروموسومي الذي يتم نسخه حتى تكتمل المعالجة [14]. عامل الانقسام هو أيضًا منظم رئيسي لطول المنطقة غير المترجمة 3′ (3′UTR) [15]. تحدث مواقع الانقسام في UA أو CA ثنائي النوكليوتيد في mRNA لسبعة جينات نازعة هيدروجين الكحول الخميرة [16] وبشكل إيجابي في CA أو UA في علامات التسلسل المعبر عنها (ESTs) كرمة العنب الاوروبي [17]. عندما تمت معالجة جزء نيوكليوتيد فيروسي لفيروس القرد 40 (SV40) يحمل نموذج إشارة AAUAAA متعدد الأدينيل في المختبر في مستخلص الخلايا البشرية ، تم إثراء CA في موقع الانقسام [18] ، مما يشير إلى أن ثنائي النوكليوتيد CA في موقع poly (A) هو مفضل لانقسام الرنا المرسال البشري. ومع ذلك ، لم يجد التحليل الطفري لموقع poly (A) لـ SV40 أي دليل على تورط نموذج CA ثنائي النوكليوتيد في اختيار موقع الانقسام في خلايا HeLa الدوار [19]. ومع ذلك ، فإن ظاهرة التخصيب CA ثنائي النوكليوتيد في موقع الانقسام مدعومة ببيانات موقع بولي (A) مجمعة من خمسة ثدييات [20]. لوحظت اختلافات كبيرة في التركيب الأساسي بين مواقع بولي (A) وقواعد قليلة بعيدة عن المواقع في mRNAs البشرية [21]. تميل مواقع الارتباط بالعديد من الأدينيل إلى أن تكون أقل حساسية تجاه ديوكسي ريبونوكلياز 1 ، وفقًا لتحليل المعلومات الحيوية للعناصر الوظيفية للحمض النووي البشري [22]. ومع ذلك ، لا تزال الاختلافات في تواتر النوكليوتيدات في مواقع بولي (A) بين الحكام الفرعية مثل الحيوانات غير الثديية ونباتات الديكوت والنباتات أحادية النواة غير واضحة. علاوة على ذلك ، يتوفر القليل من المعلومات حول ما إذا كانت هذه الاختلافات في قاعدة موقع poly (A) بين المجالات الفرعية هي انعكاسات بسيطة لاختلافات تكوين قاعدة mRNA بين نطاقات فرعية أو هي بالفعل اختيار إيجابي أو سلبي.

لقد أثرى البحث معرفتنا بشكل كبير حول إشارات عديد الأدينيل في بداية أو أسفل موقع بولي (أ). من المحتمل أن يتفاعل عامل خصوصية الانقسام وبولي أدينيل وعامل تحفيز الانقسام مع سداسي AAUAAA المنبع [غالبًا ما يُعتبر إشارة بولي (A)] والعنصر الغني بـ U / GU في منطقة موقع بولي (A) [23] ، [24 ]. العديد من mRNAs البشرية والفأرية التي تحتوي على AAUAAA أو شكل متنوع تؤوي مواقع انقسام متعددة ، وبالتالي تعتبر عملية الانقسام من مادة البولي أدينيل غير دقيقة إلى حد كبير [25]. بعض من أحدث حزم البرامج للتنبؤ بالمواقع المتعددة (A) تعتمد بشكل أساسي على الشكل الأولي AAUAAA أو الزخارف المماثلة ، بمساعدة من مختلف الزخارف النهائية الأقل حفظًا [24] ، [26] ، [27]. يمكن لنهج التعلم الآلي أن يحسن التنبؤ بعنصر بولي (A) [28]. تم العثور على الحمض النووي الريبي الخميرة التي تحتوي على عناصر تنظيمية ، من المحتمل أن تكون RNAs غير مشفرة تنظم التعبير الجيني ، كما تم العثور عليها متعددة الأدينيلات [21]. في المشعرات المهبلية، وهو طفيلي أولي ، فإن رباعي النوكليوتيد UAAA له دور مكافئ لدور إجماع الميتازوان AAUAAA في إشارة عديد الأدينيل mRNA [29]. على الرغم من أن العديد من mRNAs لها مواقع انشقاق بديلة لعديد الأدينيل كآلية في تنظيم التعبير الجيني [20] ، [25] ، [30] - [32] ، ما يقرب من 78 ٪ من mRNAs تستخدم إشارات A [A / U] UAAA المتعارف عليها في التنقية الخلايا الجذعية للجلد الجنيني للفأر وسلالات ابنتهم [30]. في تحليل أشكال إشارات عديد الأدينيل في ستة أنواع حقيقية النواة ، تنوع استخدام عنصر AAUAAA الأساسي والحفاظ عليه على نطاق واسع وكان ضعيفًا بشكل خاص في النباتات والخميرة ، وهو اكتشاف يؤدي إلى فرضية أن الكفاءة الكلية لعديد الأدينيل هي دالة لجميع العناصر و أنه لا يوجد عنصر واحد مطلوب عالميًا للمعالجة [33]. حفزت هذه المعرفة الغنية بزخارف إشارة mRNA poly (A) الحاجة إلى مزيد من البحث لتحديد ما إذا كانت مواقع poly (A) نفسها تلعب أي دور مهم في تحديد مواقع poly (A) وما إذا كانت المواقع مرتبة ببساطة بواسطة أشكال إشارة عديد الأدينيل. قد يوفر تحليل البيانات المقارنة على نطاق واسع لمواقع poly (A) بين مجموعات مختلفة من mRNAs الثدييات (غنية بـ AAUAAA) والنباتات mRNAs (فقيرة في AAUAAA) دليلًا على ما إذا كانت مواقع poly (A) محددة بشكل أساسي بواسطة AAUAAA وما شابه. الزخارف.

تُستخدم مجموعات من ESTs لدراسة الزخارف متعددة المواقع (A) عن طريق تجميع EST [17] ، [34] - [38]. على الرغم من أنه مفيد جدًا لدراسة المواقع المتعددة (A) ، إلا أن نهج EST غير مصمم لإجراء مقارنات بين الأنواع والممالك. والسبب هو أن معظم مكتبات EST خاصة بالأنسجة أو خاصة بحالة النمو وبالتالي تحتوي على تمثيل مفرط لمجموعة الجينات المعبر عنها في هذا النسيج أو حالة العلاج. علاوة على ذلك ، يتم إنشاء تسلسلات EST من تسلسل واحد يتم تشغيله دون التحقق ، وجودة تسلسل EST لا يمكن مقارنتها بجودة تسلسل النصوص في قاعدة بيانات mRNA للمركز الوطني لمعلومات التكنولوجيا الحيوية (NCBI). يمكن أن تتلوث مكتبات ESTs من الرنا الريباسي الداخلي وعديد الأدينيلات ، لأن الرنا الريباسي البشري يمكن أحيانًا أن يكون متعدد الأدينيلات [12] ولأن ليس كل مجموعات EST المقدمة إلى NCBI قد تم التخلص منها مسبقًا. في المقابل ، تم التحقق من تسلسل mRNA في قاعدة بيانات NCBI Nucleotide (www.ncbi.nlm.nih.gov) عن طريق التسلسل المتكرر من كل من نهايتي 5 ′ و 3 لاستنساخ الحمض النووي التكميلي (cDNA) ، وبالتالي بولي صناعي. (أ) يمكن القضاء إلى حد كبير على المواقع الناتجة عن فتيلة داخلية.

افترضنا أن الموقع الدقيق لموقع poly (A) لا يتم تحديده بشكل صريح أو عشوائي من خلال الزخارف الأولية أو النهائية ، كما أن ميزات النوكليوتيدات الصحيحة في مواقع poly (A) مطلوبة أيضًا أثناء تحديد مواقع الموقع أو ضبطها بدقة. يجب أن تختلف ميزات موقع poly (A) أيضًا أثناء التطور ، بمعنى آخر ، من المحتمل أن يكون لها أنماط عامة تختلف بين الممالك الكبيرة مثل النباتات والحيوانات. يجب أن يوفر توصيف اختيار تكوين النوكليوتيدات ومواقع بولي (A) الدقيقة في العديد من الأنواع عبر الممالك معرفة قيمة للغاية فيما يتعلق بفهم عملية وآليات عديد الأدينيل mRNA ، وتنظيم التعبير الجيني ، ودراسة إنهاء الجينات ، وتحسين دقة poly ( أ) توقع الموقع. افترضنا أيضًا أن تحديدات معينة لمواقع poly (A) سائدة في بعض الأنواع أو الممالك ، لأنها مرتبطة تطوريًا. واحدة من أفضل الطرق للتحقق من فرضياتنا هي تعيين تسلسلات mRNA متعددة الأدينيلات إلى الجينومات المقابلة لها في العديد من الأنواع عبر الممالك. يجعل هذا النهج من الممكن فحص الاختلافات التطورية بين الأنواع ودراسة كل من موضع ارتباط النوكليوتيدات وموضع بدء الذيل المتعدد (A) في موقع الانقسام.

كان الهدف من هذه الدراسة هو مقارنة تركيبات النيوكليوتيدات لمواقع انقسام بولي (A) عبر الأنواع والممالك الرئيسية. قمنا بفحص معظم mRNA في قاعدة بيانات NCBI Nucleotide ، وحددنا poly (A) الذيل mRNA ، وأزلنا جميع التسلسلات المكررة [وفقًا للمنطقة 100-base المنبع من موقع poly (A)] ، وقمنا بتعيين هذه التسلسلات الفريدة لأنواعها المقابلة الجينومات (الجدول S1 لقائمة معرف الكروموسوم والجينوم). Since we applied zero tolerance to mismatch during mapping, we eliminated the transcripts that had non-templated synthesis of non-adenosine nucleotides prior to polyadenylation.

To facilitate the description of the poly(A) site, we call the mRNA nucleotide that is directly in attachment with the poly(A) tail “the poly(A) tail attachment position of the poly(A) site” and call the pre-mRNA nucleotide that corresponds to the first adenosine of the poly(A) tail “the poly(A) tail starting position of the poly(A) site". We also compared the two groups of poly(A) sites: A-type poly(A) sites, which have a pre-mRNA adenosine at the poly(A) tail starting position, and non-A-type poly(A) sites, which do not have an adenosine at the pre-mRNA poly(A) tail starting position. For the A-type poly(A) site, the poly(A) tail attachment position and the starting position correspond likely to the 5′ nucleotide and the 3′ nucleotide covering the potential cleavage site (bond), respectively. For the non-A-type poly(A) site, the poly(A) tail attachment position and the starting position correspond exactly to the 5′ nucleotide and the 3′ nucleotide covering the cleavage site (bond), respectively. We present the nucleotide composition features of all these positions or groups of poly(A) sites in the eukaryote kingdoms.


شاهد الفيديو: الـ DNA هو حامل المادة الوراثية وليس الـ RNA.. لكن لماذا (شهر فبراير 2023).