معلومة

ما الذي يفصل الجينات؟

ما الذي يفصل الجينات؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

الإنترونات هي أقسام من الحمض النووي غير المشفر تفصل الإكسونات داخل موضع الجين. ومع ذلك ، بين مواضع الجينات المختلفة ، أفترض أيضًا وجود مناطق غير مشفرة من الحمض النووي. ماذا تسمى هذه المناطق؟ (وإذا كان افتراضي خاطئًا ، فالرجاء تصحيحه.)


هذه المناطق ، إذا لم يتم توضيحها ، تسمى ببساطة المناطق الجينية.

في بعض الأحيان ، إذا تم تنظيم قسم كبير من الكروماتين بواسطة عنصر تحكم محسن / كاتم صوت / موضع ، فهناك عناصر حدودية تحدد منطقة الكروماتين هذه وتمنع انتشار حالة الكروماتين إلى المناطق المجاورة.


قد يكون من الصحيح تسميتها "مناطق بين الجينات" ، لكن هذه مجرد طريقة أخرى للقول إنها مناطق بين الجينات. لا أعتقد أنه يمكنك فعل الكثير لأنها ليست متجانسة في طبيعتها. قد يكون بعضها قصيرًا وربما يفتقر إلى أي وظيفة أخرى غير تلك التي وصفهاWYSIWYG ، والبعض الآخر قد يكون طويلًا جدًا ويحتوي على معززات وعناصر تنظيمية للجينات القريبة أو البعيدة ، والتسلسلات المتكررة البسيطة ، والجينات الكاذبة ، وأصول النسخ المتماثل وما إلى ذلك.


من الرابط إلى علم الأحياء: علم الجينوم الوظيفي لرابطة الجينوم على نطاق واسع لمرض الشريان التاجي

قدمت دراسات الارتباط على مستوى الجينوم مجموعة غنية من ≈ 58 موقعًا لمرض الشريان التاجي (CAD) التي تشير إلى وجود بيولوجيا جديدة غير متوقعة سابقًا ذات صلة بتصلب الشرايين. ومع ذلك ، فإن هذه الدراسات تحدد فقط المواقع الجينومية المرتبطة بـ CAD ، وتبقى العديد من الأسئلة حتى بعد أن يكون الموضع الجيني متورطًا بشكل قاطع ، بما في ذلك طبيعة المتغير (المتغيرات) السببية والجين (الجينات) السببية ، بالإضافة إلى اتجاهية التأثير . هناك العديد من الأدوات التي يمكن استخدامها للتحقيق في الجينوميات الوظيفية لهذه المواقع ، وقد تم إحراز تقدم في عدد محدود من مواقع CAD الجديدة. سيتم تعلم علم الأحياء الجديد المتعلق بتصلب الشرايين و CAD من خلال الجينوميات الوظيفية لهذه المواقع ، والأمل هو أن تسفر بعض هذه المسارات الجديدة ذات الصلة بإمراض CAD على الأقل عن أهداف علاجية جديدة للوقاية من CAD وعلاجها.

الكلمات الدالة: تصلب الشرايين مرض الشريان التاجي الجينوم الوظيفي على نطاق الجينوم.

© 2016 American Heart Association، Inc.

الأرقام

الشكل 1. الآلية التي من خلالها مخاطر عدم الترميز ...

الشكل 1. آلية يمكن بواسطتها أن تؤثر النيوكلوتايد غير المشفرة على النمط الظاهري

أعلى: تعدد أشكال النيوكلوتايد المرتبطة ...

الشكل 2. الأدوات التجريبية لوظيفة GWAS ...

الشكل 2. الأدوات التجريبية لدراسات المتابعة الوظيفية GWAS

يمكن شرح نتائج GWAS وظيفيًا ...

الشكل 3. جينات خطر CHD GWAS هي ...

الشكل 3. جينات خطر CHD GWAS نشطة في أنواع الخلايا الانتقائية المشاركة في تصلب الشرايين


الفصل 13 إتقان علم الأحياء

يأتي أحد الكروموسومات المتجانسة من الأب ، والآخر يأتي من الأم. الكروماتيدات الشقيقة هي نسخ متطابقة من بعضها البعض.

في نهاية الانقسام الاختزالي ، توجد خليتان فرديتان.

في نهاية الانقسام الاختزالي الثاني ، توجد عادة 4 خلايا أحادية العدد.

في نهاية الطور النهائي I و cytokinesis ، توجد خليتان أحاديتان مع كروموسومات تتكون كل منهما من كروماتيدات أختين.

Synapsis ، اقتران الكروموسومات المتجانسة ، يحدث خلال المرحلة الأولى.

خلال الطور الأول ، تظل الكروماتيدات الشقيقة مرتبطة في مركزها ، وتتحرك الكروموسومات المتجانسة إلى أقطاب متقابلة.

الطور الثاني هو في الأساس نفس الطور الانقسامي فيما عدا أن الخلية أحادية العدد.

في نهاية الطور الثاني والطور الخلوي توجد أربع خلايا أحادية الصيغة الصبغية.

Prophase II هو في الأساس نفس الطور الانقسامي فيما عدا أن الخلايا أحادية العدد.

في الانقسام ، تنقسم الخلية التي ضاعفت مادتها الجينية لإنتاج خليتين ابنتيتين ثنائي الصبغيات. في الانقسام الاختزالي ، تخضع الخلية التي ضاعفت مادتها الوراثية إلى جولتين من الانقسام ، مما ينتج عنه أربع خلايا أحادية العدد.

يُطلق على اقتران الكروموسومات المتجانسة التي تحدث فقط أثناء الطور الأول من الانقسام الاختزالي اسم المشابك.


اكتشاف الجينات المستهدفة ومسارات مواقع سمات الدم باستخدام شاشات CRISPR المجمعة وتسلسل الحمض النووي الريبي أحادي الخلية

غالبية المتغيرات المرتبطة بالسمات المعقدة والأمراض الشائعة التي حددتها دراسات الارتباط على مستوى الجينوم (GWAS) ترسم خريطة للمناطق غير المشفرة من الجينوم مع تأثيرات تنظيمية غير معروفة في رابطة الدول المستقلة و عبر. من خلال الاستفادة من بيانات GWAS على نطاق البنك الحيوي ، وشاشات CRISPR المتوازية بشكل كبير وتسلسل نسخة الخلية المفردة ، اكتشفنا الجينات المستهدفة للمتغيرات غير المشفرة لمواقع سمات الدم. غالبًا ما كان الجين الأقرب هو الجين المستهدف ، لكن لم يكن هذا هو الحال دائمًا. حددنا أيضا عبر-تأثير شبكات المتغيرات غير المشفرة عندما رابطة الدول المستقلة الجينات المستهدفة عوامل النسخ المشفرة ، مثل GFI1B و NFE2. لاحظنا أن GFI1B عبر- تم إثراء الجينات المستهدفة لمواقع ربط GFI1B ومتغيرات GWAS المعينة بدقة ، وتم التعبير عنها في خلايا سلف نخاع العظم البشري ، مما يشير إلى أن GFI1B يعمل كمنظم رئيسي لصفات الدم. ستتيح هذه المنصة إجراء فحوصات متوازية على نطاق واسع لفهرسة الجينات المستهدفة للمتغيرات البشرية غير المشفرة في كليهما رابطة الدول المستقلة و عبر.


الطرق الحسابية لعلم الوراثة من الصفات المعقدة

روبرت كلفرهاوس ، التقدم في علم الوراثة ، 2010

1 مثالان

الأول هو توضيح نظري لحقيقة أن حجم تأثير التفاعل في التحليل الجيني ليس خاصية متأصلة في النموذج الجيني ، ولكنه يعتمد على ترددات الأليل في البيانات. أنشأ تمبلتون (2000) نموذجًا وراثيًا ثنائي الموضع لإجمالي الكوليسترول في الدم (TSC) بما يتوافق مع البيانات التي تم الإبلاغ عنها مسبقًا والتي تشير إلى وجود تفاعل بين ApoE و LDLR (بيدرسن وبيرج ، 1989 بيدرسن وبيرج ، 1990). تحليل هذا النموذج بناءً على ترددات الأليل الأوروبية (ApoE ترددات 0.078 و 0.77 و 0.152 لـ ε2 و ε3 و 4 على التوالي و LDLR ترددات 0.22 و 0.78 من أجل أ1 و أ2، على التوالي) ، سيقترح ذلك ApoE هو "الجين الرئيسي" لـ TSC ، حيث يمثل 77.7٪ من التباين الجيني (52.8 مجم 2 / ديسيلتر 2) ، بينما LDLR هو لاعب ثانوي يمثل 5.5٪ فقط من التباين الجيني. يمكن أن تُعزى نسبة 16.8٪ المتبقية من التباين الجيني إلى تفاعل ، ولن يتم اكتشافها إلا إذا تم تحليل المتغيرات بشكل مشترك.

ثم قام تمبلتون بتقييم نفس النموذج الجيني في مجموعة سكانية افتراضية بترددات أليل مختلفة (ApoE ترددات 0.02 و 0.03 و 0.95 لـ ε2 و ε3 و 4 على التوالي و LDLR ترددات 0.5 لكليهما أ1 و أ2). أشار تحليل هذا المجتمع الافتراضي إلى ذلك ApoE كان فقط مساهمًا طفيفًا في السمة (يمثل 11.9 ٪ من التباين الجيني) ذلك LDLR كان موضع "الجين الرئيسي" (يمثل 81.4٪ من التباين) وأن التفاعل ليس قويًا جدًا (يمثل 6.4٪ فقط من التباين).

تشير هذه النتائج إلى أنه عند دراسة الأمراض المعقدة ، قد يكون التركيز على تحديد المساهمين في تباين السمات أكثر أهمية من التركيز على تقدير معلمات معينة ، مثل حجم مصطلح التفاعل.

تم العثور على مثال ثان لكيفية تفويت شيء مهم من خلال التركيز المفرط على أهمية معامل التفاعل في فحص حديث للبيانات المتعلقة بالتدخين. حدد التحليل القياسي أحادي المتغير ارتباطًا بين الاعتماد على النيكوتين وترميز غير متزامن SNP ، rs16969968 ، في CHRNA5، وهو جين وحدة فرعية لمستقبلات النيكوتين. حددت RPM أيضًا أن SNP هذا مهم للغاية (يمثل 1.22 ٪ من اختلاف النمط الظاهري). ومع ذلك ، في التحليل الزوجي لـ SNPs لمستقبلات النيكوتين ، حدد RPM متغيرًا قريبًا ثانيًا ، rs3743075 ، والذي لم يكن مهمًا بمفرده (إما عن طريق RPM أو التحليل القياسي أحادي المتغير) ، ولكن عند دمجها مع rs16969968 تمثل 1.83 ٪ من التباين. ومع ذلك ، فإن الانحدار اللوجستي باستخدام هذا الزوج من المتنبئين يشير إلى أن rs3743075 لم يكن مهمًا بمفرده (ص = 0.36) ، ولم يكن التفاعل (ص = 0.27).

ومع ذلك ، حتى بدون مصطلح التفاعل ، فإن النموذج اللوجيستي الذي يشتمل على كل من تعدد أشكال النوكليوتيدات SNPs يمثل 25٪ أكثر من تباين السمات مقارنة بمجموع التأثيرين أحادي المتغير. في الواقع ، أصبح كل عنصر SNP أكثر أهمية في التحليل المشترك مما كان عليه في التحليل أحادي المتغير.

والسبب في هذه النتيجة المفاجئة هو أن أليلات المخاطرة لـ 16969968 و 3743075 روبية مترابطة بشكل سلبي. نظرًا لأن rs16969968 له تأثير أكبر من rs3743075 ، عندما يتم تحليل rs3743075 من تلقاء نفسه ، يتم إخفاء تأثيره بالكامل تقريبًا بواسطة rs16969968. عندما يتم تحليل rs16969968 بمفرده ، يتم تقليل تأثيره قليلاً بواسطة rs3743075 ، ولكن لا يزال يظهر من خلال.

في هذه الحالة ، فإن طلب تأثير رئيسي مهم أو تأثير تفاعل كبير كان سيؤدي إلى فشل في تحديد مساهمة rs3743075 في الاعتماد على النيكوتين. كما اتضح ، على الرغم من أن rs3743075 لا يرتبط بالاعتماد على النيكوتين في التحليلات أحادية المتغير ، إلا أنه يرتبط بالتعبير عن CHRNA5، الجين الذي يغير البروتين من أجله rs16969968.


ما الذي يفصل الجينات؟ - مادة الاحياء

"التعبير عن السمة الكمية Loci حساسة للغاية لحالة التمايز الخلوي ". PLOS Genetics 5 (10): e1000692. doi: 10.1371 / journal.pgen.1000692. PMC 2757904. PMID 19834560.
^ Michaelson JJ ، Loguercio S ، Beyer A (يوليو 2009).

لاحظ أن الأليلات الثلاثة مختلفة مكان لا تتداخل. تُظهر اللوحة السفلية الأليلات الخاصة بأم بوب بلاكت نورما لـ D3S1358 و vWA و FGA مكان. تمت مقارنة أليلات نورما بواسطة الكمبيوتر بمعايير التبريد ، وتم تصنيفها.

Loci: انظر الموقع.
موقع (رر. مكان): الموضع على كروموسوم الجين أو علامة كروموسوم أخرى أيضًا ، الحمض النووي في هذا الموضع. يقتصر استخدام الموضع أحيانًا على مناطق الحمض النووي التي يتم التعبير عنها. الموقع المادي المحدد للجين على الكروموسوم. من اللاتينية "مكان".

)
الموضع على الكروموسوم حيث توجد سمة وراثية معينة. تستخدم أحيانًا لوصف جينات متعددة تؤثر على نفس الوظيفة.
LPS
عديد السكاريد الدهني. مكون رئيسي من الطبقة الخارجية للغشاء الخارجي للبكتيريا سالبة الجرام.

(loh-kus) [L.، place]
مكان معين على طول كروموسوم معين حيث يوجد جين معين.

بالنسبة للمحصول ومكونات الغلة وتاريخ العنوان وارتفاع النبات والصفات الفسيولوجية والنمائية في ظل الجفاف ، فقد تم تحديدها أيضًا في رسم خرائط السكان (Maccaferri et al. ، 2008DZ Habash et al. ، بيانات غير منشورة).
دراسات تحليل QTL للسمات الزراعية.

على نفس الكروموسوم
المصدر: Jenkins، John B. 1990. Human Genetics، 2nd Edition. نيويورك: هاربر وأمبير رو
.

تتكون من تسلسل زعيم غني بـ AT متبوعًا بتكرار نيوكليوتيد قصير ومتعدد مفصولة بمناطق مباعدة. العديد من التكرارات متناغمة ، مع بنية ثانوية لدبابيس الشعر RNA متوقعة ، في حين أن البعض الآخر يفتقر إلى التناظر ومن المتوقع أن يشكل RNA غير منظم.

ينتج عنه تأثير مشترك يسمى تعدد الجينات.)
مثال:
تخيل أن الطول يتحكم فيه اثنان فقط من الجينات (رغم أنه في الواقع ، فإن العديد من الجينات ستسهم في الارتفاع). لكل منها أليلين E و e و F و f.

(عام) مكان أو مساحة أو مكان ، خاصة مركز نشاط ما.
(رياضيات) مجموعة من جميع النقاط التي تفي إحداثياتها بمعادلة أو شرط معين.

)
مكان معين على طول كروموسوم معين حيث يوجد جين معين.
مغطاة في BIOL1020 Lab 7 علم الوراثة
الايسوسوم
كيس مغلق بغشاء من الإنزيمات المتحللة للماء الموجودة في سيتوبلازم الخلايا حقيقية النواة.

7) توجد الجينات في مواقع معينة على كروموسوم يسمى أ

. يمكن أن تكون هناك إصدارات مختلفة من الجين موجودة في مجموعة تسمى الأليلات.

) التنميط الجيني لجميع سلالات الفأر التي تم تحليلها.
كروموسوم
عدد النيوكلوتايد.

تقع على الحمض النووي للميتوكوندريا
3. الارتباط الجيني النمط الظاهري.

في أحد الأنواع (مثل الفأر) لها متماثلات مرتبطة أيضًا بأنواع أخرى (مثل البشر).
انظر Synteny في مسرد MGI.

هيكل رباعي
(التاريخ: 28/3/2011). أكملوا أول تجربة بشرية معشاة ذات شواهد. يستخدم مسبارًا قائمًا على القسطرة يتم إدخاله في الكلى. الأعصاب القريبة من الكلى (أو في الكلى. يقول الباحثون أن هذه النتائج تؤكد أن RDN.

يتم تحديد المسافات عن طريق تحليل الارتباط ، والذي يحدد التردد الذي يتم عنده جينين

تنفصل أثناء إعادة التركيب الكروموسومي. (انظر رسم الخرائط). الواسم الجيني. جين أو مجموعة من الجينات تستخدم "لتمييز" أو تتبع عمل الميكروبات. الجينوم.

متجانسة الزيجوت - وجود أليلات متطابقة في واحد أو أكثر

في مقاطع كروموسوم متجانسة. جينات التدبير المنزلي - تلك الجينات المعبر عنها في جميع الخلايا لأنها توفر الوظائف اللازمة لتغذية جميع أنواع الخلايا. HUGO - منظمة الجينوم البشري.

عندما تكون تأثيرات الأليلات مجتمعة مختلفة

مساوية لمجموع آثارها الفردية. (ORNL)
الأدينين (أ)
قاعدة نيتروجينية ، أحد أعضاء الزوج الأساسي AT (الأدينين - الثايمين).
أنظر أيضا: زوج القاعدة (ORNL)
الخوارزمية
إجراء ثابت يتجسد في برنامج حاسوبي. (NCBI)
انتقام .

يقيس متوسط ​​تغاير الزيجوت التباين الجيني ، متوسط ​​النسبة المئوية للجين

متماثلة اللواقح (ثابتة).
حوالي 14 ٪ (1800 جين) متغاير الزيجوت.

في الخميرة ، مطلوب Sir2 لإسكات الجينوم عند ثلاثة

والتيلوميرات والحمض النووي الريبوزومي (rDNA).

هم أقرب إلى بعضهم البعض أقل عرضة للانفصال على كروماتيدات مختلفة أثناء التقاطع الكروموسومي ، وبالتالي يقال إنهم مرتبطون وراثيًا. (wikipedia.org) 3. يشير المصطلح إلى حقيقة أن بعض الجينات تميل إلى التوارث معًا ، لأنها على نفس الكروموسوم.

حالة واحدة من هذه الظاهرة تحدث في

في معقد التوافق النسيجي الرئيسي (MHC) حيث ترتبط بعض الأليلات البشرية ارتباطًا وثيقًا ببعض أليلات الشمبانزي أكثر من ارتباطها بالأليلات البشرية الأخرى (الشكل 7).

التفاعل الجيني: الحالة التي تتوارث فيها الجينات عند اختلاف

تتفاعل لإنتاج أنماط ظاهرية للخلايا الحمراء ، على سبيل المثال ، تتفاعل جينات Le le مع جينات Hh و Se se لإنتاج أنماط ظاهرية مختلفة لخلايا لويس الحمراء.

إذا استخدمنا الطول كمثال ، فيمكننا القول إنه يتم التحكم فيه بواسطة جينات مضافة في أربعة مختلفة

. إذا حصلت على جميع الأليلات الثمانية مقابل "الطول" ، فستكون أقصى ارتفاع واحد ، وإذا حصلت على ثمانية أليلات "للقصر" ، فستكون في الطرف الآخر من طيف الارتفاع.

عدة أنماط مثيلة مرتبطة بـ X

الموجود على الكروموسوم X يصبح ميثيلًا بدرجة عالية عندما يكون غير نشط ولكنه يظل غير ميثيل على كروموسوم X النشط (فرضية ليون).

.
يُعرف HE (تغاير الزيجوت المتوقع) أيضًا بالتنوع الجيني (= D المفضل ، مصطلح أقل غموضًا) ويتم حسابه على أنه 1.

على سبيل المثال ، MHC Class II هي جين

. لذلك فهي طريقة مفيدة لتمييز مدى قرب ارتباط شخصين.

أكبر المسافة بين

من اثنين من الجينات في الكروموسوم ، كلما زاد معدل إعادة التركيب بين هذه الجينات. هذا صحيح لأنه عندما تكون الأليلات قريبة من بعضها داخل الكروموسوم ، فمن المرجح أن تظل متحدة عندما يتم تبادل النهايات الصبغية عن طريق العبور.

. مسافة الخريطة التي تبلغ 1 سنتي موغان (سم) تعادل معدل إعادة التركيب البالغ 1٪. للمسافة الصغيرة ، يتناسب تردد إعادة التركيب (RF) مع مسافة الخريطة.

linkage / LINK-əj / الميل المتزايد لأليلين مختلفين

هم أقرب إلى بعضهم البعض على كروموسوم معين (أي

أنفسهم.
العودة إلى صفحة البحث
إذا كنت تعرف أي مصطلحات تم حذفها من هذا المسرد وترى أنه من المفيد تضمينها ، فيرجى إرسال التفاصيل إلى مكتب التحرير في GenScript.

نتيجة لذلك ، أليلات محددة في نوعين مختلفين

تم العثور عليها معًا أكثر أو أقل من المتوقع عن طريق الصدفة. قد توجد نفس الحالة لأكثر من أليلين. يتم التعبير عن حجمها كقيمة دلتا (D) ويتوافق مع الفرق بين تردد النمط الفرداني المتوقع والتردد المرصود.

، حيث يتم تحديد ارتباط نمط ظاهري معين كميًا وإحصائيًا.
سلالة عشوائية. يتم الحفاظ على مخزون الفئران من خلال نظام التوزيع العشوائي المنتظم. الفئران العشوائية غير متجانسة وراثيا ، ولكنها مستقرة وراثيا مقارنة بالفئران الفطرية.

في علم الوراثة ، ميل اثنين مختلف

هي ، كلما زاد ارتباطهم وانخفض تواتر إعادة التركيب بينهم.
مسرد كامل.

بالطبع ، المثال أعلاه هو مثال مبسط يعتمد على موضع واحد مع قمتين للياقة البدنية في المشهد التكيفي. في العالم الحقيقي ، كثير ، كثير

عائلة الجينات: مجموعة من الجينات ذات الصلة تشغل عدة جينات

في الحمض النووي ، يتشكل بشكل شبه مؤكد عن طريق ازدواج جين أسلاف وله تسلسل مشابه يمكن تمييزه. قد يكون أعضاء عائلة الجينات متشابهين جدًا وظيفيًا أو يختلفون على نطاق واسع. الأسرة الجينية غلوبين مثال على ذلك. (مسرد تطور PBS).

الترتيب الأليلي لاثنين من الزيجوت المتخالف

، حيث يحتوي كل كروموسوم متماثل على أليل متحور واحد (أ أو ب) وواحد من النوع البري (أ أو ب) أليل (أي Ab / aB). اثنان من أزواج الجينات غير المتجانسة في الترتيب ، Ab / aB.

مثل جينات الغلوبولين المناعي أو مستقبلات الخلايا التائية (TCR) حيث تحدث إعادة الترتيب الوظيفي بين الجينات. يتم إعادة ترتيب أحد الأليلات إما بشكل غير وظيفي أو غير كامل ولا يتم التعبير عنه. بهذه الطريقة ، تعبر كل خلية T عن مجموعة واحدة فقط من جينات TCR.

التهجين ثنائي الهجين عبارة عن تقاطع بين أفراد متغاير الزيجوت عند شخصين مختلفين

.
يُعرف قانون مندل الثاني أيضًا باسم قانون التشكيلة المستقلة. ينص قانون الصنف المستقل على أن أليلات أحد الجينات تصنف إلى أمشاج بشكل مستقل عن أليلات جين آخر.

(الجينات أو العلامات الجينية الأخرى) على طول الكروموسوم.
إعادة التركيب الجيني
مصطلح عام لإنتاج النسل الذي يجمع سمات الوالدين.

والتي تكون قادرة على الاقتران أثناء الانقسام الاختزالي.
الزيجوت المتماثل حالة يكون فيها أليل جين معين متطابقًا.
الدبال مادة شبيهة بالعلكة السوداء ، مشتقة من بقايا نباتات وحيوانات فاسدة.

السمة الكمية صفة وراثية يتم تحديدها من خلال تفاعلات متعددة

، والتي يوجد لها مجموعة من الأنماط الظاهرية بين النهايات المظهرية.
كوارك جسيم دون ذري يوجد في نواة الذرة.

- مقياس لميل بعض الجينات إلى أن يتم توريثها كمجموعة بدلاً من كونها فردية بسبب قربها من

في الكروموسوم
الليكوبين
- مادة كيميائية نباتية ، وهي أحد مضادات الأكسدة القوية التي ثبت أنها تحيد الجذور الحرة. ينتمي اللايكوبين إلى عائلة الكاروتينات.

تنتشر جينات بيتا-غلوبين البشرية عند خمسة

على الكروموسوم البشري 11. يتم التعبير عن هذه الجينات بالتسلسل أثناء التطور ، وهي متشابهة مع الإنترونات بنفس الطول في مواقع متشابهة في كل جين. بعض الجينات عبارة عن نسخ معطلة ، والبعض الآخر يعمل فقط خلال مراحل معينة من التطور.

الجينات المعدلة: الجينات التي تؤثر على مستوى التعبير عن جين آخر. ليس له مكان على

يعلقون أنفسهم بجينات أخرى.
النمط الظاهري: المظهر الخارجي للفرد
النمط الجيني: التركيب الجيني للفرد.

اتحاد دولي يسعى لتحديد الجينات

التي تعدل حجم وشكل جسم الإنسان:
كونسورتيوم عملاق
موسوعة الطب الرياضي والعلوم:
الأنسجة الدهنية .

التطور الأحدث في علم الوراثة الكمي هو تحليل السمة الكمية

موضع متسلسل متسلسل

تشمل مناطق مكتوبة تم التنبؤ بها والتي تم التحقق منها تجريبياً.

النواة. منطقة أو "حجرة" مرئية مجهرياً داخل نواة الخلية. يحتوي على تركيز من البروتينات والحمض النووي

المطلوبة لنسخ) تسلسل الحمض النووي المناسب إلى الحمض النووي الريبي الريبوسومي (الرنا الريباسي). مثل المقصورات النووية الأخرى ، أو "الأجسام" ، فإن النواة ليست مرتبطة بالغشاء.

الموضع هو الموقع المادي المحدد للجين أو تسلسل الحمض النووي الآخر على الكروموسوم ، مثل عنوان الشارع الجيني. صيغة الجمع هي "


أوجه التشابه بين رسم الخرائط الجينية والفيزيائية

  • رسم الخرائط الجينية والفيزيائية نوعان من تقنيات رسم خرائط الجينوم ، تنتج أنواعًا مختلفة من خرائط الجينوم.
  • يستخدمون مجموعة من الواسمات الجزيئية ذات المواضع الخاصة على الجينوم.
  • كلاهما يسمح بتحديد الجينات ، مما يؤدي إلى ظهور نمط ظاهري معين أو طفرة مسؤولة عن متغير معين.
  • أيضًا ، رسم خرائط الجينوم هو العملية الأولية للعديد من العمليات النهائية.
  • على سبيل المثال ، يساعد في تحديد العناصر الجينية المرتبطة بالأمراض.

مبادئ رسم الخرائط الجينية ومشاكل الممارسة # 038

الخريطة الجينية هي ببساطة تمثيل لتوزيع مجموعة من المواقع داخل الجينوم. قد لا يكون للمواقع التي يتضمنها المحقق في أي مشروع رسم خرائط أي علاقة ببعضها البعض على الإطلاق ، أو قد تكون مرتبطة وفقًا لعدد من المعلمات بما في ذلك التناظرات الوظيفية أو الهيكلية أو تخصيص الكروموسومات المحدد مسبقًا. يمكن إنجاز تعيين هذه المواقع على العديد من مستويات الدقة المختلفة. في أدنى مستوى ، يتم تخصيص موضع ببساطة لكروموسوم معين دون أي توطين إضافي. في خطوة أعلاه ، قد يتم تعيين منطقة معينة من الصبغيات. عند مستوى دقة أعلى ، يمكن تحديد الترتيب النسبي والمسافات التقريبية التي تفصل المواقع الفردية داخل مجموعة مرتبطة. مع مستويات الدقة المتزايدة باستمرار ، يمكن تحديد مسافات الترتيب والتداخل البؤري بدقة أكبر وأكبر. أخيرًا ، يتم الوصول إلى الدقة النهائية عندما يتم تعيين المواقع على تسلسل الحمض النووي نفسه.

يمكن أن تحتوي أبسط الخرائط الجينية على معلومات عن عدد قليل مثل موقعين مرتبطين. في الطرف المقابل ، ستكون هناك خرائط مادية كاملة تصور الموقع المادي الدقيق لجميع آلاف الجينات الموجودة على طول كروموسوم كامل. تم تحقيق الخطوة الأولى نحو إنشاء هذه الخرائط المادية الكاملة مؤخرًا من خلال إنشاء contigs واحد من الحيوانات المستنسخة المتداخلة عبر طول ذراعي كروموسوم بشريين كاملين.

لا يوجد في الواقع نوع واحد ، بل ثلاثة أنواع مختلفة من الخرائط الجينية التي يمكن اشتقاقها لكل كروموسوم في الجينوم (بخلاف Y). تتميز الأنواع الثلاثة للخرائط - الربط ، والكروموسومات ، والفيزيائية - بالطرق المستخدمة لاشتقاقها والمترية المستخدمة لقياس المسافات داخلها.

خرائط الربط
كانت خريطة الربط ، التي يشار إليها أيضًا باسم خريطة إعادة التركيب ، هي الأولى التي تم تطويرها بعد فترة وجيزة من إعادة اكتشاف عمل Mendel & # 8217s في بداية القرن العشرين. لا يمكن إنشاء خرائط الارتباط إلا للمواضع التي تحدث في شكلين أو أكثر قابلين للتوريث ، أو أليلات. وبالتالي ، لا يمكن تعيين المواضع أحادية الشكل - تلك التي تحتوي على أليل واحد فقط - بهذه الطريقة. يتم إنشاء خرائط الارتباط عن طريق حساب عدد النسل الذي يتلقى إما مجموعات أليل أبوية أو مؤتلفة من أحد الوالدين يحمل أليلين مختلفين في موقعين أو أكثر. تسمح تحليلات هذا النوع من البيانات للفرد بتحديد ما إذا كانت المواقع & # 8220 مرتبطة & # 8221 ببعضها البعض ، وإذا كانت كذلك ، ترتيبها النسبي والمسافات النسبية التي تفصل بينها.

خريطة الارتباط

يتم تنفيذ تخصيص الكروموسومات عندما يتم العثور على موضع جديد ليكون في ارتباط مع موضع معين مسبقًا. تُقاس المسافات بالسنتيمورجان ، حيث يعادل سنتيمورجان واحد معدل عبور 1٪. خريطة الربط هي النوع الوحيد الذي يعتمد على تحليل التربية الكلاسيكي. يستخدم المصطلح & # 8220 genetic map & # 8221 أحيانًا كمرادف خاطئ لـ & # 8220 linkage map & # 8221 الخريطة الجينية في الواقع يتم تعريفها على نطاق أوسع لتشمل خرائط الكروموسومات والفيزيائية أيضًا.

خرائط الكروموسوم
تعتمد خريطة الكروموسوم (أو الخريطة الوراثية الخلوية) على النمط النووي لجينوم الفأر. يتم تحديد جميع كروموسومات الفأر على المستوى الخلوي الوراثي وفقًا لحجمها ونمط النطاقات ، وفي النهاية ، يتم إجراء جميع التخصيصات الصبغية عن طريق التحليل الوراثي الخلوي المباشر أو عن طريق الارتباط بموقع تم تعيينه مسبقًا بهذه الطريقة. يشار إلى مواقع خريطة الكروموسومات باستخدام أسماء النطاق. متأصل في مخطط التسمية هذا هو وسيلة لترتيب المواقع على طول الكروموسوم.

خريطة الكروموسوم

اليوم ، يمكن استخدام عدة طرق مختلفة ، بمستويات مختلفة من الدقة ، لإنشاء خرائط كروموسوم. أولاً ، في بعض الحالات ، يمكن إجراء رسم الخرائط غير المباشر باستخدام واحد أو أكثر من الخطوط الهجينة للخلية الجسدية التي تحتوي فقط على أجزاء من النمط النووي للفأر داخل بيئة الأنواع الأخرى & # 8217 الجينوم. من خلال ربط وجود أو التعبير عن جين فأر معين مع وجود كروموسوم فأر أو منطقة صبغية فرعية في هذه الخلايا ، يمكن للمرء الحصول على تخصيص صبغية أو صبغية.

يمكن استخدام النهج الثاني في تلك الحالات الخاصة حيث تظهر تشوهات النمط النووي بالاقتران مع أنماط ظاهرية متحولة معينة. عندما تصنف آفة الكروموسومات والنمط الظاهري معًا ، من جيل إلى جيل ، فمن المحتمل أن الأول يسبب الأخير. عندما تكون الآفة عبارة عن حذف أو إزاحة أو انعكاس أو ازدواج ، يمكن للمرء أن يعين موضع متحور إلى الفرقة الصبغية التي تم تعطيلها.

أخيرًا ، مع توفر مسبار DNA الخاص بالموقع ، يصبح من الممكن استخدام طريقة التهجين في الموقع لتصور مباشرة موقع التسلسل المقابل داخل نطاق كروموسومي معين. لا يعتمد هذا النهج على الارتباطات أو الافتراضات من أي نوع ، وعلى هذا النحو ، فهو النهج الأكثر مباشرة لرسم الخرائط. ومع ذلك ، فهي تتطلب الكثير من الناحية الفنية ، كما أن حلها ليس بنفس مستوى الدقة التي يتم الحصول عليها من خلال طرق الربط أو الأساليب المادية.

الخرائط المادية
النوع الثالث من الخرائط هو خريطة مادية. تستند جميع الخرائط المادية على التحليل المباشر للحمض النووي. يتم قياس المسافات المادية بين وداخل المواقع في أزواج القاعدة (bp) أو الكيلوبازبير (kb) أو الميجاباسيبيرز (mb). يتم تقسيم الخرائط المادية بشكل تعسفي إلى مدى قصير وطويل المدى. عادة ما يتم متابعة رسم الخرائط قصيرة المدى عبر مسافات تصل إلى 30 كيلو بايت. بعبارات تقريبية للغاية ، هذا هو متوسط ​​حجم الجين وهو أيضًا متوسط ​​حجم الإدخالات المستنسخة التي تم الحصول عليها من مكتبات الجينوم الكونية. يمكن تعيين المناطق المستنسخة بهذا الحجم بسهولة إلى دقة عالية باستخدام إنزيمات تقييدية ، ومع التقدم في تقنية التسلسل ، أصبح من الشائع أكثر تسلسل مناطق مثيرة للاهتمام بهذا الطول بالكامل.

يمكن إجراء رسم خرائط فيزيائية بعيدة المدى مباشرة على مناطق بحجم قاعدة الميجا باستخدام إنزيمات تقييد القطع النادرة جنبًا إلى جنب مع طرق مختلفة من الرحلان الكهربائي للهلام يشار إليها عمومًا باسم الرحلان الكهربائي للهلام النبضي أو PFGE ، والتي تسمح بفصل أجزاء الحمض النووي وتحجيمها 6 ميغا بايت أو أكثر في الطول. يمكن إجراء دراسات رسم خرائط PFGE مباشرة على الحمض النووي الجيني متبوعًا بتحليل اللطخة الجنوبية مع تحقيقات لمواقع معينة. يصبح من الممكن إثبات الارتباط المادي عندما تكتشف مجسات لموقعين نفس مجموعة شظايا التقييد الكبيرة عند التهجين المتسلسل إلى نفس البقعة.

خريطة البدنية

يمكن أيضًا إجراء رسم الخرائط بعيد المدى باستخدام الحيوانات المستنسخة التي تم الحصول عليها من مكتبات إدراج جينية كبيرة مثل تلك المستندة إلى نواقل استنساخ الكروموسوم الاصطناعي (YAC) للخميرة ، حيث يمكن عزل المناطق داخل هذه الحيوانات المستنسخة بسهولة لمزيد من التحليل. في المستقبل ، ستغطي الخرائط المادية طويلة المدى التي تتكون من نسخ متداخلة كل كروموسوم في جينوم الفأر. سيتم دمج خرائط التقييد قصيرة المدى ذات الدقة العالية معًا على طول كل طول كروموسومي ، وفي النهاية ، ربما ، سيتم تحقيق أعلى مستوى من دقة رسم الخرائط مع تسلسل الحمض النووي الصبغي الكامل.

اتصالات بين الخرائط
من الناحية النظرية ، يجب أن توفر خرائط الارتباط والكروموسومات والفيزيائية نفس المعلومات حول تخصيص الكروموسومات وترتيب المواقع. ومع ذلك ، يمكن أن تكون المسافات النسبية التي يتم قياسها داخل كل خريطة مختلفة تمامًا. فقط الخريطة المادية يمكنها تقديم وصف دقيق للطول الفعلي للحمض النووي الذي يفصل المواقع عن بعضها البعض. هذا لا يعني أن النوعين الآخرين من الخرائط غير دقيقين. بدلاً من ذلك ، يمثل كل منها نسخة من الخريطة المادية التي تم تعديلها وفقًا لمعامل مختلف. يتم تعديل المسافات الخلوية الوراثية عن طريق التعبئة النسبية لجزيء الحمض النووي في مناطق صبغية مختلفة. يتم تعديل مسافات الارتباط من خلال الميل المتغير لمناطق الحمض النووي المختلفة للمشاركة في أحداث إعادة التركيب.

من الناحية العملية ، غالبًا ما تكون الخرائط الجينية للماوس عبارة عن اندماج للكروموسومات والروابط والخرائط المادية ، ولكن في وقت كتابة هذا التقرير ، لا تزال دراسات إعادة التركيب الكلاسيكية توفر الجزء الأكبر من البيانات المدمجة في مثل هذه الخرائط المتكاملة. وبالتالي ، فإن المقياس الأساسي المستخدم لرسم مسافات البؤرة البؤرية كان السنتيمورجان. ومع ذلك ، يبدو من المعقول توقع أنه في غضون السنوات الخمس المقبلة ، ستتفوق القاعدة الضخمة على السنتيمورجان كوحدة للقياس على طول الكروموسوم.


نموذج

نحن نركز على النموذج الأساسي للعزلة مع الهجرة مع ستة معايير ديموغرافية: ثلاثة أحجام سكانية فعالة للمجموعات السكانية الثلاثة (للسكان 1 و 2 والأسلاف) ، ومعدلي الهجرة (واحد لكل اتجاه) ، و الوقت الذي انفصل فيه السكان الأسلاف إلى مجموعتين سليلتين. نميز وقت التقسيم ، ر، من تلك المعلمات التي توفر معدلات أنواع معينة من الأحداث في عملية الاندماج (بمعنى آخر.، ومعايير الهجرة وحجم السكان التي نشير إليها مجتمعة باسم Φ). يتم تحجيم المعلمات من خلال متوسط ​​معدل الطفرة عبر المواقع ميكرومتر، ومن ثم يتم إعطاء الأحجام الفعالة بواسطة 4نأناميكرومتر، ومعدلات الهجرة حسب مأناي = مأناي/ميكرومترووقت التقسيم ر = ، أين نأنا هو الحجم الفعال لـ أناعدد السكان ، مأناي هو معدل الهجرة لكل جيل بين السكان أنا و ي، و تي هو وقت الانقسام (بالأجيال) (Hey and Nielsen 2004). في حالة وجود مواقع متعددة ، كل موضع ل سيكون له أيضًا معدل طفرة عددية شل وعدد الميراث حل، ومن ثم نمذجة التباين الواضح في معدلات الطفرات وأنماط الوراثة عبر المواقع (Hey and Nielsen 2004). لا يُفترض إعادة التركيب داخل الموقع وإعادة التركيب الحر بين المواقع.

أظهرت الدراسات النظرية أن تأثيرات الانتقاء على المواقع المحايدة المرتبطة تقترب جيدًا من خلال عملية محايدة تمامًا مع انخفاض في معدل الهجرة ، بما يتناسب مع حاجز تدفق الجينات الناجم عن الانتقاء (Petry 1983 Barton and Bengtsson 1986 Charlesworth وآخرون. 1997 نافارو وبارتون 2003 أ فوسكو وأوينوياما 2011). وبالمثل ، فإن المواقع المحايدة المرتبطة بمناطق الجينوم الخاضعة لاختيار الاتجاه أو الخلفية تعاني من انخفاض في أحجامها الفعالة بما يتناسب مع القوة الانتقائية (Charlesworth) وآخرون. 1993 جالتير وآخرون. 2000 تشارلزورث 2009 جوسمان وآخرون. 2011). وبالتالي يمكن نمذجة أنماط الاختيار المختلفة من خلال المعلمات الديموغرافية المتغيرة. على سبيل المثال ، سينعكس الاختيار ضد تدفق الجينات ، الناتج إما عن التكيف المحلي أو عدم التوافق الجيني في الهجينة ، على أنه انخفاض في معدلات الهجرة. من ناحية أخرى ، سيؤدي التقديم التكيفي إلى زيادة معدلات الهجرة. وبالمثل ، فإن المناطق الجينومية التي تخضع لعمليات مسح انتقائية متكررة قد يُنظر إليها على أنها ذات حجم فعال مخفض. لذلك ، نفترض أنه يمكن وصف تأثيرات التحديد على المواقع المرتبطة من حيث معدلات الترحيل المتغيرة و / أو أحجام السكان الفعالة. نحن نعتبر نموذجًا يتم فيه تصنيف المواقع إلى مجموعات حيث يكون لكل مجموعة مجموعتها الخاصة من معدل الترحيل و / أو معلمات حجم السكان الفعالة ، وبالتالي تخفيف الافتراض القائل بأن جميع المواقع تشترك في نفس التركيبة السكانية. في هذا الإطار العام ، فإن المعامل الوحيد من بين المعلمات الديموغرافية الستة التي تظل مشتركة بين جميع المواقع هو ر.

من حيث المبدأ ، يمكن التعامل مع عدد مجموعات المواقع على أنها غير معروفة ، ومع ذلك ، فإننا نركز على الحالة التي يكون فيها الحد الأقصى لعدد المجموعات ك is set by the investigator and specifically on the simplest case where loci can be classified into two groups (ك = 2) representing (1) loci with histories affected by linkage to genes under selection and (2) loci not affected by selection. It is important to appreciate that the identification of a group as having loci affected by selection depends entirely upon how the investigator interprets the parameter estimates of the different groups of loci. Here we focus on the case of selection against gene flow, and hence the group of loci with reduced migration rate estimates corresponds to loci potentially linked to sites under selection. The assignment of loci to groups is represented by an assignment vector أ، أين أل is the group to which locus ل belongs, ل = (1, … , إل). For instance, in a case with four loci and two groups, أ = (1, 1, 2, 2) indicates that loci 1 and 2 belong to group 1 and loci 2 and 3 belong to group 2. With more than one group of loci the set of migration and effective population size parameters, Φ, will include additional terms. In the above example, instead of one set of effective sizes (three parameters) and one pair of migration rates (two parameters), the model includes one set for each group, that is, two sets of effective sizes (six parameters) and two sets of migration rates (four parameters).

Given genetic data from إل independent loci, sampled from each of two closely related populations or species, the goal is to obtain an estimate of the vector of locus assignments, , as well as the demographic parameters of the IM model, and . To connect the data to these unknowns we consider for locus ل a genealogy, جيل, and for all loci the set of genealogies, جي = (جيل, … , جيإل), that describe the historical coancestry of the sampled sequences, including the tree topologies, as well as the times of coalescent and migration events (Hey and Nielsen 2004). As conceptualized by Felsenstein (1988) and now common practice in population genetics inference (على سبيل المثال, Kuhner وآخرون. 1998 Beaumont 1999 Beerli and Felsenstein 1999 Hey and Nielsen 2004 Kuhner 2006), we consider the range of possible genealogies by approximating an integration over the genealogical space. Following the approach developed by Hey and Nielsen (2007) this integration provides for the posterior probability of the parameters of interest, (1) where π(Φ|جي, ر, أ) is the conditional probability of the parameters given the genealogies, the splitting time, and the assignment, and π(جي, ر, أ|X) is the probability of genealogies, splitting time, and assignment given the data. Although this integral is not analytically tractable except for the very small sample sizes, as noted by Hey and Nielsen (2007), Equation 1 suggests a two-step Monte Carlo integration approximation. This works by first sampling genealogies, times of split, and assignment vectors from π(جي, ر, أ|X), which are then used to approximate the posterior of the demographic parameters π(Φ|X) in a second step (Hey and Nielsen 2007). Although this approach does not provide an estimate of the joint posterior π(Φ, ر, أ|X), it does provide estimates of the marginal posterior for أ و ر (first step), as well as the marginal posterior for Φ, which includes all of the rates parameters for genetic drift and gene flow (second step).

In the first step, a Markov chain Monte Carlo (MCMC) simulation is used to collect samples of <جي, ر, أ> from the posterior π(جي, ر, أ|X) ∝ F(X|جي)π(جي|ر, أ)π(ر)π(أ)، أين F(X|جي) is the likelihood of the data given the genealogies, π(جي|ر, أ) is the prior probability of the genealogies conditional on the times of split and assignment, π(ر) is the prior of the times of split, and π(أ) is the prior of the assignment vector. The likelihood F(X|جي) is computed using conventional methods, such as by mapping mutations onto جي in the case of the infinite-sites mutation model or by parameterizing the mutation process under a finite-sites model and using the pruning algorithm (Felsenstein 1981a). The prior probability π(جي|ر, أ) is obtained by integrating over Φ (Hey and Nielsen 2007), (2) where π(Φ) is the prior distribution for the migration rates and effective population sizes, and π(جي|Φ, ر, أ) is the probability of the genealogies conditional on the parameters and assignment. The calculation of this last term, π(جي|Φ, ر, أ), is based on coalescent theory (Hey and Nielsen 2007 Hey 2010 Sousa وآخرون. 2011) and is actually a fairly tractable function of quantities determined from جي, including for each rate component of Φ (1) a count of the number of events across جي that the rate pertains to and (2) a sum of the total rate for that parameter across جي (see, على سبيل المثال, the appendix to Hey 2010). So too is the solution to the integration in Equation 2 analytical and straightforward. The sample of <جي, ر, أ> values can be used directly to estimate the marginal posterior distributions for ر و أ. Thus, this first step approximates the marginal posterior π(ر, أ|X), providing estimates for the times of split and assignment of loci into groups.

The second step consists of using the sample of <جي, ر, أ> values to estimate the marginal posterior for Φ. Applying Bayes’ theorem, the conditional probability of the parameters given the genealogies can be simplified to π(Φ|جي, ر, أ) = π(جي|Φ, ر, أ)π(Φ)/π(جي|ر, أ). Given a sample of n genealogies, times of split and assignment from the posterior, (جي ( أنا ) , ر ( أنا ) , أ ( أنا ) ) ∼ π(جي, ر, أ|X) (أنا = 1, …, n), we estimate the marginal posterior distribution of the drift and migration parameters as (3) Note that the marginal posterior π(Φ|X) is not conditioned on particular values for ر أو أ, but is in effect estimated by integrating over these other parameters. In sum, given that the joint posterior π(Φ, ر, أ|X) can be expressed by Equation 1, we can apply the above two-step procedure to obtain the marginal posterior distributions π(ر, أ|X) (first step) and π(Φ|X) (second step) and hence estimate all the parameters of interest, including ر, أ, and Φ.


The data

In our exhaustive search for studies that have compared estimates of سشارع و Fشارع indices between different populations, we were able to find 18 studies of 20 species, including four unpublished ones, which reported سشارع estimates (Table 2 see also: 73 83 ). Most of these studies have been conducted in plants (55%), whereas invertebrate (30%) and vertebrate (15%) studies in particular, were scarce (Table 2). سشارع estimates in a given study have been based, on average, on eight different traits (min–max=1–24), growth related morphological and (juvenile) life history traits dominating (Table 2). Fشارع estimates in most of studies have been based on allozymes, but a few microsatellite, RAPD, as well as one nuclear RFLP and one ribosomal DNA based studies have been conducted (Table 2). One study also reported an estimate of Fشارع based RFLP analysis of mtDNA, which was in agreement (after taking account that the نه for mtDNA genome is 1/4 of that for nuclear markers see, e.g. 18 ) with values returned from analyses of allozymes and microsatellites ( 55 ). Those few studies which have used more than one marker system to estimate Fشارع return qualitatively ( 34 40 ), or even quantitatively ( 55 see also: 34 Table 2), similar conclusions based on estimates from different marker types. Hence, in accordance with data from a number of studies ( 1 ), this suggests that the choice of markers to estimate Fشارع-values may not be of great concern (but see: 62 29 ).


Why Are They Important in Conservation Genetics?

Microsatellite markers are inherited from both parents, making them useful for parentage analysis (think paternity testing) and population genetic studies. Microsatellite markers are useful for population genetic studies because many are considered highly polymorphic. If a microsatellite locus is polymorphic, it means that there is more than one potential allele at a single locus (a specific marker site). Polymorphic loci can have more than 10, even more than 20 potential alleles in that given population. If populations are truly separate from each other, then these alleles are likely to be present in different frequencies in each population. These different allele frequencies increase the potential to observe genetic differences between populations if they exist.

For example, let’s assume we have two populations that are reproductively isolated, but the microsatellite marker we are using only has one or two alleles present for that locus. In addition, the alleles occur at similar frequencies in both populations. The microsatellite data would suggest that these two populations are either one continuous population, or at least had high levels of gene flow between the populations. In this case, the lack of allelic diversity would limit our ability to detect reproductive isolation. Now, let’s assume we are using a microsatellite marker that has 20 possible alleles (highly polymorphic). This large number of alleles increases the odds that allele frequencies will differ between the populations if reproductive isolation is occurring, thus increasing the likelihood of properly identifying the two populations as separate (reproductively isolated from each other). In addition, if the data from the highly polymorphic locus still leads to the conclusion that the two populations are not reproductively isolated, then there would be stronger genetic support suggesting the two populations were either one population or had large amounts of gene flow. In reality, data from multiple microsatellite markers, not just one locus, are used to characterize populations.

Similarly, in parentage analysis, highly polymorphic loci increase our ability to identify individuals. In this case, the large number of alleles increases the likelihood that each individual will have a unique genotype (considering their genotype across multiple loci) relative to other individuals in the population. Similar to population studies, multiple loci are typically used in parentage analysis.

What can cause these differences in allele frequency between populations? Gene flow between populations can act to make allele frequencies more similar, even at low rates of exchange. Genetic drift, a random process, can cause allele frequencies to fluctuate within a population from one generation to the next. New alleles also can arise as a result of a mutation, resulting in the alteration in the number of repeating segments (increasing or decreasing the number of repeats). For example, the ATAGATAGATAGATAGATAGATAGATAGATAG in the figure above could be shortened to ATAGATAGATAG.


شاهد الفيديو: ما هي الجينات وكيف تعمل (شهر فبراير 2023).