معلومة

هل الببتيد إشارة دائما مشقوق أثناء تخليق البروتين في ER؟

هل الببتيد إشارة دائما مشقوق أثناء تخليق البروتين في ER؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

قال مشرف جامعتي إن تسلسل الإشارة دائمًا ما يكون مشقوقًا ، لكن كتابي النصي يختلف.

ما أجمعه من كتابي النصي (على الرغم من أنه لم يتم ذكره بوضوح لذا لست متأكدًا) هو:

  • سيكون للبروتين الذي من المفترض أن يكون خارج الخلية تمامًا (أو يدخل في عضية مرتبطة بغشاء) تسلسل إشارة فقط والذي سيتم قطعه بواسطة إشارة الببتيداز.
    • إذا كان هناك بروتين من المفترض أن يكون له مجال غشاء واحد فقط ، فيمكنه إما:

أ) لها تسلسل إشارة واحد ، ولكن هذا لن يكون في بداية المحطة N التي يتم ترجمتها. إذا كان هناك المزيد من الأحماض الأمينية ذات الشحنة السالبة قبل تسلسل الإشارة ، فعندما يرتبط تسلسل الإشارة بمركب الترانكون ، فإن هذا "الذيل" الذي يبدأ من خلال يتم صده من داخل الخلية الأكثر سالبة الشحنة. ستكون الأحماض الأمينية التي تتبع التسلسل أكثر إيجابية في الشحنة للبقاء في العصارة الخلوية بدلاً من المرور عبر تجويف ER. سيحدد هذا اتجاه هذا المجال أحادي الغشاء. // بدلاً من ذلك ، يمكن أن يكون هناك تسلسل إشارة واحد وتكون الأحماض الأمينية من قبل مشحونة بشكل أكثر إيجابية وبعدها تكون أكثر سالبة الشحنة ، لذلك تحصل على الوضع العكسي حيث يظل الخيط المركب بالفعل في العصارة الخلوية ويتم تمرير بقية البوليبتيد من خلاله يتم تصنيعه. في كلتا الحالتين ، يتضمن هذا تسلسل إشارة واحد فقط.

ب) يمكن أن يحتوي البولي ببتيد على تسلسل إشارة واحد وتسلسل إيقاف نقل واحد ، مع تحديد الشحنات الموجودة على الأحماض الأمينية المحيطة في الاتجاه ، ومن ثم قد يتم شق أحد تسلسل الإشارة أو تسلسل إيقاف النقل بواسطة ببتيداز الإشارة.

  • تحتوي بروتينات Multipass على سلسلة من ببتيدات الإشارة / نقل بدء النقل وإيقاف النقل.

ولكن إذا كان كتابي المدرسي (أو بالأحرى ما أفهمه منه!) صحيحًا ، فإن بعض سلاسل الإشارات وليس كلها مشقوقة. إذن ، كيف تعرف إشارة الببتيداز أيها تلتصق؟

سأكون ممتنًا حقًا لو أخبرني أحدهم بالإجابة على هذا وكذلك تصحيح لي أين أخطأت في فهمي.


نظام الغشاء الداخلي

ملخص: يتكون نظام الغشاء الداخلي من الشبكة الإندوبلازمية وجهاز جولجي والليزوزومات والجسيمات الداخلية والحويصلات الإفرازية. تشارك هذه الأجزاء في معالجة البروتينات للتصدير من الخلية ، والبروتينات الموجهة إلى الجسيمات الحالة ، والبروتينات التي تدخل الخلية من سطح الخلية. بمجرد دخول البروتينات إلى الشبكة الإندوبلازمية ، فإنها لا تعود أبدًا إلى حجرة العصارة الخلوية ، يتم نقلها عن طريق نقل الحويصلات إلى الأجزاء الأخرى من النظام. يتم تنظيم تدفق الحويصلات هذا بشكل كبير.

هناك ثلاثة أقسام فرعية رئيسية لنظام الغشاء الداخلي

  • المسار الإفرازي
  • المسار الليزوزومي و
  • مسار الالتقام

يتم تصنيع البروتينات التي تدخل إلى الإفراز أو الليزوزومات على الريبوسومات في العصارة الخلوية ثم يتم نقلها إلى التوليف الإندوبلازمي


الكود الجيني

الشكل 1. الشيفرة الجينية. الكودونات المميزة باللون الأحمر هي أكواد الإيقاف. يحدد الكودون المظلل باللون الأخضر (AUG) ميثيونين الأحماض الأمينية (Met) ، وهو دائمًا أول كودون لتسلسل تشفير البروتين ويشار إليه باسم كود البدء.

ترجمة هي عملية استخدام الكود الجيني للـ mRNA لتحديد تسلسل الأحماض الأمينية للبروتين. هذا حرفيا ترجمة من لغة إلى أخرى ، من رمز النوكليوتيدات المكون من أربعة أحرف إلى رمز عشرين حمضًا أمينيًا. لا يوجد تطابق واحد لواحد بين النيوكليوتيدات والأحماض الأمينية بدلاً من ذلك ، هناك 3 نيوكليوتيدات متتالية في الرنا المرسال (يطلق عليها الكودونات) إلى حمض أميني واحد. هناك 64 مجموعة محتملة من النوكليوتيدات الثلاثية ، وبالتالي 64 كودونًا ممكنًا. الشكل 1 هو جدول كودون يوضح الكود الجينيوالكودونات والأحماض الأمينية التي يحددونها. هذا الكود الجيني عالمي ، مع استثناءات قليلة في الميتوكوندريا (التي لها جينوماتها الخاصة). هناك ثلاثة أشياء جديرة بالملاحظة في الشكل 1. أولاً ، الكودونات الثلاثة المميزة باللون الأحمر (UAA و UAG و UGA) لا ترمز للأحماض الأمينية ، فهي وقف الكودونات التي تشير إلى إنهاء الترجمة. ثانيًا ، يُشار إلى الكودون AUS (المميز باللون الأخضر) باسم ابدأ الكودونلأنه دائمًا أول كودون في تسلسل تشفير البروتين. ثالثًا ، الشفرة الوراثية زائدة عن الحاجة ، مما يعني أن بعض الأحماض الأمينية محددة بأكثر من كودون واحد. في الواقع ، هناك 61 كودون و 20 حمض أميني فقط. يحدد كل كودون حمض أميني واحد فقط ، ولكن يمكن تحديد حمض أميني واحد بواسطة عدة أكواد. على سبيل المثال ، يترجم الكودون GCA دائمًا إلى الأحماض الأمينية ألانين ، ومع ذلك ، يمكن أيضًا تحديد الألانين بواسطة الكودونات GCC و GCG و GCU.


توطين البروتين

من أجل تنفيذ العمليات دون الخلوية داخل مقصورات محددة أو مناطق خلوية ، يجب أن توجد آليات لضمان وجود مكونات البروتين المطلوبة في المواقع وبتركيز مناسب. يُعرف تراكم البروتين في موقع معين باسم توطين البروتين.

يتفاعل SRP (جسيم التعرف على الإشارة) مع تسلسل الإشارة بمجرد ظهوره من نفق خروج عديد الببتيد الريبوزومي (1-2). في حقيقيات النوى ، يتوقف استطالة الببتيد مؤقتًا عند تكوين معقد سلسلة وليدة SRP / الريبوسوم ، ثم يتم استهداف الغشاء ER من خلال التفاعل مع مستقبل SRP (3). يعد ارتباط GTP بمستقبلات SRP و SRP شرطًا أساسيًا لتكوين مستقبلات SRP / SRP. بعد الوضع المعقد (3) ، ينفصل مجمع مستقبلات SRP / SRP عن الببتيد بسبب التحلل المائي GTP. يتم نقل الببتيد المتنامي تدريجياً عبر القناة الموصلة للبروتين (الترانكون) إلى تجويف ER (4). عادةً ما يتم قطع تسلسل الإشارات بشكل مشترك بواسطة SPases (ببتيدات الإشارة) ، وتسمى تسلسلات الإشارات المشقوقة الناتجة ببتيدات الإشارة (4-5).

يعد تجنيد البروتين في الأساس شكلاً من أشكال التعرف على البروتين ، والذي أصبح ممكنًا من خلال وجود تسلسلات محددة من الأحماض الأمينية داخل بنية البروتين. على سبيل المثال ، تحمل العديد من البروتينات المرتبطة بالغشاء ببتيدات الإشارة التي تتعرف عليها مستقبلات الإشارة التي توجهها إلى الموقع المستهدف. إشارة التوطين النووي هي أحد الأمثلة على ذلك. تحمل البروتينات الموجهة للشبكة الإندوبلازمية أيضًا إشارة ببتيد.

في حالات أخرى ، قد تحمل البروتينات رقعة إشارة. يتكون هذا عادة من حوالي 30 من الأحماض الأمينية غير موجودة في تسلسل خطي ، ولكنها على مقربة مكانية في الفضاء ثلاثي الأبعاد.

ومن المثير للاهتمام أن تنظيم الخلية ومناطقها المختلفة يلعب دورًا في توجيه تجنيد البروتينات إلى موقع معين. على سبيل المثال ، في الخلايا الظهارية ، المستقطبة ، يختلف تكوين البروتين في الغشاء القمي اختلافًا كبيرًا عن تلك الموجودة في الغشاء القاعدي. يتم تحقيق ذلك من خلال التعرف على تسلسلات الإشارات المميزة التي تستهدف البروتينات لكل منطقة من هذه المناطق. على سبيل المثال ، غالبًا ما يتم ربط بروتينات الغشاء القمي بـ GPI (glycophosphatidylinositol) بينما تحتوي البروتينات القاعدية على diLeu (N ، N-Dimethyl Leucine) أو سلاسل التوقيع المعتمدة على التيروزين من الأحماض الأمينية [1].

غالبًا ما يتم توطين بروتينات العصارة الخلوية المرتبطة بأغشية البلازما بناءً على تفاعلها مع الدهون الغشائية مثل الفوسفوينوسيتيدات. فوسفاتيديلينوسيتول 4،5 ثنائي الفوسفات (PIP2) هو أكثر أنواع فوسفو إينوسايتيد وفرة في خلايا الثدييات. يتم إثراء PIP2 في مناطق معينة على الغشاء ، وبسبب قدرته على التفاعل مع مجالات البروتينات PH (تماثل البليكسترين) يمكنه تجنيد البروتينات التي تمتلك مثل هذه المجالات محليًا. يمكن أن يتفاعل مجال FERM الذي يحتوي على بروتينات ، والتي تربط الأكتين بالغشاء ، مع PIP2 [2]. يمكن أيضًا إثراء فوسفوإينوزيتيد آخر وثيق الصلة ، وهو فوسفاتيديلينوسيتول 3،4،5 ثلاثي الفوسفات (PIP3) في مناطق معينة من غشاء البلازما. لقد ثبت أن إثراء PIP3 يتراكم عند أطراف الخلايا العصبية مما يؤدي إلى استقطاب الخلية وتشكيل محور عصبي [3]. يُشتبه أيضًا في تحفيز إزالة بلمرة الأكتين الموضعية في خلايا ديكتيوستيليوم والتأثير على هجرة الخلايا [4] على الرغم من أن الدراسات الأخرى في العدلات أشارت إلى دورها في بلمرة الأكتين [5].

بالإضافة إلى ذلك ، يمكن لمجالات العصارة الخلوية لبروتينات الغشاء جذب البروتينات الأخرى الموجودة في العصارة الخلوية التي تشارك في شلالات الإشارات. على سبيل المثال ، فسفوريلات مستقبلات Tyrosine Kinases (RTKs) بعض بقايا التيروزين في المجالات العصارية الخلوية لبروتينات الغشاء عند ارتباط الترابط بالنطاقات خارج الخلية. تجذب التيروزينات المفسفرة البروتينات التي تمتلك مجالات SH2 (تماثل src) أو PTB (ربط الفوسفوتيروزين) ، والتي تشتمل على مجمع إشارات.

يمكن أن يؤدي انحناء الأغشية أيضًا إلى إثراء البروتينات ذات الأحجام والخصائص الميكانيكية المسموح بها. على سبيل المثال البروتينات العابرة للغشاء ذات الشكل المخروطي مثل مستقبلات الأسيتيل كولين النيكوتين تفضل المناطق المنحنية في الغشاء لأن هذا يخفف من توتر الغشاء وشكله. تم ملاحظة فرز مكونات الغشاء التي تفضل الانحناء في حواف صهاريج Golgi وبالتالي تقليل الضغط الميكانيكي في المناطق الصهريجية المسطحة [6] [7]. يمكن للبروتينات التي تحتوي على مجال BAR (Bin / Amphiphysin / Rvs) اكتشاف انحناءات الغشاء وتحفيزها ، كما تساعد أيضًا في فرز البروتينات إلى مناطق مختلفة من الغشاء بناءً على الانحناء. يتم إثراء بروتينات مجال BAR بشكل خاص في مناطق الغشاء ذات النشاط الخلوي العالي [8] [9].

التسليم الموجه للمكونات

يمكن أن ينتج توطين البروتين عن التعرف على البروتينات القابلة للذوبان أو المجمعات البروتينية القابلة للذوبان بشكل سلبي ، ومع ذلك ، قد لا يضمن هذا تركيزًا كافيًا للمكونات للحفاظ على عملية معينة. يمكن أن يعيق هذا اكتماله ، خاصة عند تنفيذه في مناطق ذات حجم حشوي محدود ، مثل طرف أرجل خيطية ، أو عندما يتم قلب المكونات بسرعة.

هناك طريقة أكثر فاعلية للحفاظ على تركيز مكونات البروتين عن طريق توصيلها المباشر عبر شبكة الهيكل الخلوي.

يمتد الهيكل الخلوي ، الذي يتكون من خيوط أكتين وأنابيب دقيقة ، على الخلية بأكملها ويربط غشاء البلازما بالنواة والعضيات الأخرى. تؤدي هذه الخيوط أغراضًا عديدة ، من توفير الدعم الهيكلي للخلية ، إلى توليد القوى المطلوبة لانتقال الخلية. قد تكون أيضًا بمثابة & lsquotracks & rsquo حيث يمكن أن تنتقل البروتينات الحركية أثناء نقلها للبضائع من موقع إلى آخر بشكل مشابه لقطار الشحن الذي ينقل البضائع على طول شبكة من خطوط السكك الحديدية.

يتم تسهيل تسليم المكونات بشكل أساسي بواسطة المحركات الجزيئية التي تحركها ATP / GTP مثل myosin V أو myosin X أو Kinesin أو Dynein. لوحظت هذه البروتينات ، أو متماثلاتها ، في العديد من أنواع الخلايا ، بما في ذلك الخميرة ، والخلايا النباتية والحيوانية. يمشي المحركان الجزيئيان dynein و kinesin على الأنابيب الدقيقة بينما يمشي الميوسين على خيوط الأكتين. من المتوقع أن تسير هذه المحركات بطريقة أحادية الاتجاه ، وإن لم تكن بالضرورة في نفس اتجاه بعضها البعض.

تمت دراسة النقل المعتمد على الأنابيب الدقيقة بشكل أساسي في الخلايا العصبية. يمكن أن يكون طول المحاور عدة ميكرونات (أحيانًا يصل طولها إلى متر) ، لذلك هناك حاجة لنقل البروتينات والدهون والحويصلات المشبكية والميتوكوندريا والمكونات الأخرى على طول المحور العصبي. جميع الأنابيب الدقيقة في المحاور أحادية الاتجاه ، مع نهايات & lsquominus & rsquo التي تشير إلى جسم الخلية ونهايات lsquoplus & rsquo التي تشير إلى المشبك. تتحرك محركات Kinesin على طول هذه المسارات لنقل البضائع من جسم الخلية إلى المحور العصبي. يرتبط اضطراب نقل البضائع بوساطة كينيسين بالعديد من الأمراض العصبية العضلية مثل ضمور العضلات الشوكية والضمور العضلي النخاعي والصدلي [10] [11]. من ناحية أخرى ، يلعب دينين دورًا مهمًا في تهريب البضائع في التشعبات [12].

يأتي الكثير من فهمنا للتوصيل المعتمد على الميوسين من الدراسات التي أجريت على الخميرة ، على الرغم من أن الآليات يبدو أنها محفوظة لدى البشر. في خلايا الخميرة ، تُستخدم محركات الميوسين V لتوصيل الحويصلات إلى مواقع التبرعم [13]. وقد تورط مركب الأكتوميوسين أيضًا في توصيل الحويصلات الإفرازية إلى مواقع النمو وإخراج الخلايا وفصل العضيات أثناء انقسام الخلايا [14] [15] [16]. تشمل الميوسينات الأخرى المتورطة في نقل البضائع ، الميوسين السادس ، وهو مهم لتوليد وفرز وتسليم الحويصلات الداخلية [17] ، والميوسين X ، الذي يحمل البروتينات المختلفة إلى أطراف أرجل خيطية عبر مجال FERM الخاص بهم. أحد الأمثلة على البروتين الذي يتم نقله بواسطة Myosin X هو & beta-experin.

على الرغم من التشابه الوظيفي ، توجد اختلافات مهمة بين آليات النقل المعتمدة على الأنابيب الدقيقة والأكتين. بينما يحدث النقل المعتمد على الأنابيب الدقيقة عبر مسافات طويلة ، يحدث التسليم المستند إلى الأكتين على مسافات أقصر بكثير من 1-5 ومايكرو [18] ، تمت مراجعته في [19]. علاوة على ذلك ، تلعب الأنابيب الدقيقة دورًا مهمًا في توصيل البضائع من ER إلى Golgi وإلى غشاء الخلية [20] [21]. من ناحية أخرى ، يرتبط النقل القائم على الأكتين بإيصال البضائع والحويصلات إلى غشاء البلازما ، بهدف بدء نمو النتوءات وسحبها بسرعة. تستشعر هذه النتوءات الخصائص الميكانيكية للبيئة المكروية وتقيسها ، مما يسهل انتقال الخلايا.

مسارات الاتصال

مع تنفيذ عمليات مختلفة في حجرات خلوية منفصلة ، منظمة عبر مناطق مختلفة من الخلية ، يعتبر التواصل داخل الخلايا أمرًا بالغ الأهمية. مثل هذا الاتصال ، الموصوف بمزيد من التفصيل تحت إشارات & lsquocell & rsquo ، يسمح للخلايا بالحفاظ على تركيز بروتينات معينة وداخل المناطق الصحيحة ، اعتمادًا على متطلبات عملية معينة أو حالة خلية. يضمن هذا في النهاية عمل المقصورات الفردية بكفاءة ، ويمكّن عملية خلوية واحدة من قيادة أخرى. يسمح هذا في النهاية للخلية بتسهيل وظائفها الأساسية بطريقة فعالة ومتماسكة.

قد تحمل مسارات الإشارات إشارة تنشأ من خارج الخلية أو من داخل مقصورات مختلفة وعادة ما تتضمن نقل الأيونات والمذابات والبروتينات والرسائل الثانوية.

تحتوي جميع الخلايا على مستقبلات سطحية وبروتينات أخرى لتسهيل استشعار الإشارات من البيئة خارج الخلية. يمكن أن تكون هذه الإشارات في شكل أيونات ، وجزيئات صغيرة ، وببتيدات ، وإجهاد القص ، وقوى ميكانيكية ، وحرارة ، وما إلى ذلك بمجرد استشعار الإشارة بواسطة مستقبل السطح ، يتم نقلها إلى السيتوبلازم عادةً عن طريق التغيير التوافقي في المستقبل أو تغيير في حالة الفسفرة على الجانب العصاري. يؤدي هذا بدوره إلى إطلاق سلسلة إشارات في اتجاه مجرى النهر ، والتي غالبًا ما تبلغ ذروتها في النواة. عادة ما ينتج عن الإشارة تغيير في ملف تعريف التعبير الجيني للخلايا ، مما يساعدها على الاستجابة للمنبهات.

قد تمتلك المقصورات دون الخلوية أيضًا آليات تسمح لها بتنظيم وظائف بعضها البعض & rsquos. على سبيل المثال ، يتم تعديل تخليق البروتين والنشاط الإفرازي لـ ER و Golgi عن طريق فسفرة البروتينات أو الدهون على أغشيتها بواسطة إنزيمات العصارة الخلوية مثل عائلة البروتين A والبروتين كيناز D. تعتبر أيونات الكالسيوم (Ca2 +) وسيلة شائعة لمثل هذه الإشارة التوضيح. عادة ما يكون تركيز هذه الأيونات في العصارة الخلوية منخفضًا جدًا (

0.1 وميكرو إم) ، ولكن يمكن زيادتها إلى 1 وميكرو إم عند الاستقراء بواسطة إشارة. ER هو مخزن أيونات Ca2 + وعندما يتم إطلاقها في العصارة الخلوية فإنها ترتبط بالعديد من البروتينات ، مما يعدل نشاطها. على سبيل المثال ، أحد أهداف Ca2 + هو CaM kinase ، والذي يؤثر بشكل مباشر على حركة الخلية والهجرة من خلال التحكم في نشاط سلسلة كيناز الميوسين الخفيفة.


نقاش

في محاولة لتوصيف مكونات مسار الاتجار Stx ، تم إجراء الفحص الجيني للجزيئات المشاركة في تهريب السموم داخل الخلايا. تم نقل الخلايا بمكتبة Vero cell cDNA ثم تم اختيارها لمقاومة Stx. تم استرداد DNA البلازميد الذي كان يُفترض أنه يشفر عاملًا يسمح بمقاومة السموم من الخلايا المقاومة. تم استعادة نسخة واحدة بعد ثلاث جولات من تعداء الجسم والتخصيب ووجد أنها تحتوي على cDNA يشفر أول 124 من الأحماض الأمينية لبروتين غير موصوف سابقًا. كشف المزيد من التوصيف والاستنساخ لـ (كدنا) كامل الطول أن هذا الجين يشفر كوصي جديد Hsp40. أظهر التوصيف الأولي أن هذا الجزيء مترجم إلى ER ، حيث يكون قادرًا على التفاعل مع BiP والمرافقين اللامعين الآخرين (36). تم تعيين متماثلات الكلاب والبشر لهذا الجزيء Erdj3 ، وقد ثبت أنها تتفاعل أيضًا مع BiP وبروتينات الركيزة غير المطوية (1 ، 28). بالتشابه مع مرافقات Hsp40 المرتبطة بخميرة ER ، من المحتمل أن يعمل HEDJ في التعرف على البروتينات على أنها خاطئة وتجنيد الجزيئات المطوية بشكل شاذ إلى Sec61 من أجل الانتقال العكسي.

لا يحتوي توكسين الشيغا ، مثل مادة الريسين وتوكسين الكوليرا ، على نشاط جوهري في تكوين المسام ، ومع ذلك يجب أن تصل جميع هذه السموم إلى العصارة الخلوية (22 ، 24). تتطلب هذه السموم الاتجار في مسار دائري إلى ER ، على عكس السموم التي تدخل العصارة الخلوية مباشرة من غشاء البلازما أو من الحيز الداخلي. نظرًا لعدم القدرة على عبور الأغشية ، فإن ذيفان الشيغا والسموم ذات الصلة تستخدم على ما يبدو الآلات المضيفة الحالية لدخول العصارة الخلوية. تم اقتراح مؤخرًا أن هذه السموم قادرة على محاكاة بنية البروتين غير المطوي وبالتالي استخدام آلية انتقال المضيف للنقل من ER إلى العصارة الخلوية (4 ، 21).

تمت دراسة عملية إعادة نقل البروتين عبر غشاء ER على نطاق واسع في الخميرة. كشفت المسوخات الحساسة لدرجات الحرارة عن أدوار مركزية للغشاء المتكامل ، Sec61 ، بالإضافة إلى Hsp70 المعروف باسم BiP (أو Kar2) ، في نقل البروتين من ER إلى العصارة الخلوية. بالإضافة إلى ذلك ، تم إثبات أن Jem1p و Scj1p ، وهما من أفراد عائلة Hsp40 ، مطلوبان لإعادة نقل البروتينات غير المطوية (16). يشير تحديد HEDJ في تحليل فحص لمقاومة السموم وإثبات أن السم يتفاعل مع هذا الموصي داخل ER إلى أن HEDJ يلعب دورًا مشابهًا في إزاحة البروتينات الخاطئة ، وكذلك Stx ، من الثدييات ER.

تشارك مرافق Hsp40 في جميع جوانب تخليق البروتين وإفرازه تقريبًا. باستخدام طريقة الفحص الجيني الموصوفة هنا ، قمنا بعزل أول Hsp40 cochaperone المترجمة إلى تجويف ER للخلايا البشرية. لم يتم فحص متطلبات توفير مرافقين محليين في ER في النقل الرجعي للسموم البكتيرية ، باستثناء الاكتشاف الأخير أن نقل ذيفان الكوليرا يتطلب كشفه بواسطة مرافق يعرف باسم إيزوميراز ثنائي كبريتيد البروتين (33). ليس معروفًا ما إذا كان توكسين الشيغا والريسين يتفاعلان مع PDI. علاوة على ذلك ، فإن الآلية التي يتم من خلالها استهداف هذه السموم الثلاثة على ما يبدو لمسام Sec61 لا تزال غير معروفة. من المفترض أن الأحداث الأولية تتضمن التفاعل مع مرافقي ER المترجمة الذين يتعرفون على هذه السموم كبروتينات مضيفة خاطئة وتستهدفهم لإعادة النقل. في الآونة الأخيرة ، تراكمت الأدلة على أن كلاً من مادة الريسين وتوكسين الكوليرا يستخدمان مسام Sec61 للوصول إلى السيتوبلازم من ER (16 ، 27 ، 29 ، 33). استنادًا إلى تهريبه المماثل داخل الخلايا وعدم قدرته على عبور أغشية المضيف ، من المحتمل أيضًا أن يستخدم توكسين الشيغا Sec61 translocon. تشير بياناتنا إلى أنه قد يتم تجنيد Stx لجهاز Sec61 بواسطة HEDJ ومرافقي ER اللامعين الآخرين.

لم يتم تحديد السمات الهيكلية للسموم التي تسمح بالانتقال ، ولم يتم تحديد دور المرافقين المحليين في ER في هذه العملية. تم اقتراح المجالات المكشوفة للماء لتكون إشارة مهمة لتفاعل Hsp70 مع البروتينات غير المطوية. مع وضع هذا في الاعتبار ، تم اقتراح أن المجال الكارثي للماء الموجود بالقرب من نهاية الكربوكسيل لـ StxA ، ذيفان الكوليرا ، والريسين يتعرض عند تفكك الوحدات الفرعية B ويكون مسؤولاً عن التعرف على السم من قبل مرافق المضيف. دعماً لدور هذه المنطقة في انتقال السموم ، فقد ثبت أن الطفرات في المجال الكاره للماء لـ StxA تؤدي إلى تقليل السمية الخلوية (31). لم يتم اختبار ما إذا كانت هذه المنطقة حاسمة في النقل الرجعي لأي مادة سامة عبر غشاء ER لم يتم اختبارها بعد. يجب أن تسمح الطفرات المستهدفة للسموم و HEDJ بالتشريح الجزيئي للمخلفات المتضمنة في تفاعلها ويجب تسهيلها عن طريق فحوصات الربط والنقل في المختبر الموصوفة هنا. في النهاية ، قد تسمح هذه المعلومات بالتصميم العقلاني للعوامل الدوائية التي تمنع ارتباط السموم بـ HEDJ ونقلها إلى سيتوبلازم الخلية المضيفة.


أساليب

الخلايا والأجسام المضادة

تم استخدام خطوط الخلايا RKO (CRL-2577) و HeLa (CCL-2) والخلايا الليفية الأولية للرئة MRC-5 (CCL-171) ، التي تم الحصول عليها من ATCC ، في هذه الدراسة. تم الاحتفاظ بخلايا RKO و HeLa في وسائط DMEM المكملة بـ 10 ٪ FCS (Sigma-Aldrich ، St. الصناعات ، بيت هعيمق ، إسرائيل). تم الاحتفاظ بالخلايا الليفية MRC-5 في وسائط EMEM بنفس المكملات وتم استخدامها أسفل المقطع 20. نمت الخلايا المنقولة بواسطة shRNA في وسط اختيار يحتوي على 5 ميكروغرام / مل من بوروميسين (Merck Millipore ، Billerica ، MA). نمت الخلايا المنقولة بواسطة EYFP في وسط اختيار يحتوي على 2 مجم / مل من G418 (Sigma-Aldrich). تم عزل الخلايا القاتلة الطبيعية من الخلايا الليمفاوية في الدم المحيطي باستخدام مجموعة تخصيب الخلايا القاتلة الطبيعية البشرية EasySep (StemCells Technologies ، فانكوفر ، كندا). تمت زراعة الخلايا القاتلة الطبيعية بشكل مشترك مع خلايا مغذية خيفية مشععة ، وتم تنشيطها باستخدام 500 وحدة / مل من rhIL-2 (PeproTech ، Rehovot ، إسرائيل) و 20 ميكروغرام / مل من PHA (روش ، بازل ، سويسرا). تم قياس نقاء NK & gt95 ٪ عن طريق تلطيخ التدفق الخلوي لـ CD56 + CD3 - جزء. تم الحصول على جميع الخلايا الأولية وفقًا للإرشادات المؤسسية والأذونات لاستخدام الأنسجة البشرية.

مكافحة MICA (استنساخ 159227 ، أنظمة R & ampD ، Minneapolis ، MN) ، مكافحة MICB (استنساخ 236511 ، أنظمة R & ampD) ، مكافحة ULBP1 (استنساخ 170818 ، أنظمة R & ampD) ، مكافحة ULBP2/5/6 (استنساخ 165903 ، R & ampD تم استخدام الأجسام المضادة لـ ULBP3 (استنساخ 166514 ، أنظمة R & ampD) ، والأجسام المضادة الأولية المضادة لـ MHC من الفئة الأولى (الورم الهجين W6 / 32) لقياس التدفق الخلوي. تم استخدام الأجسام المضادة الأولية المضادة لـ PDI (الأرانب polyclonal ، Abcam ، Cambridge ، MA) ، المضادة لـ MICA (استنساخ 159227 ، أنظمة R & ampD) ، والعلامة المضادة له (استنساخ AD1.1.10 ، أنظمة R & ampD) للتألق المناعي.

تم استخدام الأجسام المضادة الثانوية التالية لقياس التدفق الخلوي والتألق المناعي: مضاد الفأر AlexaFluor 647 ومضاد الأرانب Cy3 ، وجميعها تم شراؤها من Jackson Laboratories (Bar Harbour ، ME).

تم استخدام الأجسام المضادة الأولية التالية للتخثر المناعي: anti-his tag (clone AD1.1.10، R & ampD systems) ، anti-MICA (استنساخ EPR6568 ، Abcam) ، anti-SEL1L (أرنب polyclonal to N-terminus ، Sigma-Aldrich) ، EYFP مضاد لـ GFP متفاعل (أرنب polyclonal ، ab290 ، Abcam) ، مضاد لـ HRD1 (أرنب polyclonal ، NB100-2526 ، Novus Biologicals ، Centennial ، CO) ، مضاد لليوبيكويتين (استنساخ FK2 ، Merck Millipore) ، مضاد لـ GAPDH (استنساخ) 6C5 ، سانتا كروز ، دالاس ، تكساس) ، ومضادات الفينكولين (استنساخ EPR8185 ، Abcam).

تم استخدام الأجسام المضادة الثانوية التالية للتخثر المناعي: مضادات الفأر HRP و HRP المضادة للأرانب ، وسلسلة خفيفة وثقيلة محددة ، أو خاصة بالسلسلة الخفيفة ، وكلها تم شراؤها من مختبرات جاكسون.

طفرات تفاعل البوليميراز المتسلسل ، تعداء البلازميد ، وانتقال الفيروسة البطيئة

تم وصف تركيبات US8-HIS و US9-HIS سابقًا 28 ، واستخدمت كقوالب لطفرات تفاعل البوليميراز المتسلسل. يتم تضمين جدول يوضح بالتفصيل الاشعال والقوالب المستخدمة لكل تفاعل في ملف المعلومات التكميلية. بالنسبة لتركيبات EYFP ، تم تضخيم شظايا PCR واستنساخها في pIRES-neo FLAG / HA EYFP (هدية Addgene # 10825 من دكتور K. Le-Trilling ، مستشفى جامعة إيسن ، ألمانيا) باستخدام مواقع تقييد EcoRV و NotI. تم بعد ذلك نقل البلازميدات مباشرة إلى الخلايا باستخدام كاشف ترنسفكأيشن Transit-LT1 (Mirus). تم استنساخ جميع التركيبات الأخرى في ناقل pHAGE-DsRED (-) - eGFP (+) lentiviral باستخدام مواقع تقييد NotI و BamHI. تم التحقق من صحة جميع التركيبات عن طريق تسلسل الحمض النووي. تم إنشاء فيروسات Lentivirus في خلايا 293T باستخدام بروتوكول ترنسفكأيشن ثلاثي البلازميد العابر 81: تم نقل البلازميدات التي تحتوي على الملحق ، و Gag-pol ، و PDMG وتم حصاد المواد الطافية التي تحتوي على ذرية الفيروسة البطيئة بعد 48 ساعة ، وطردها للتخلص من حطام الخلية وتخزينها في -80 درجة مئوية. تم إجراء التنبيغ في وجود البوليبرين (6 ميكروغرام / مل). تم تقييم كفاءة التنبيغ من خلال مستويات التألق ، وتم استخدام مجموعات الخلايا بكفاءة & gt90 ٪ فقط للتجارب. تم إجراء التحويل المتكرر إذا لزم الأمر للحصول على الكفاءة المطلوبة.

التنميط الجيني MICA

تم استخراج الحمض النووي الجينومي من الخلايا الليفية MRC-5 باستخدام مجموعة استخراج الحمض النووي الجينومي AccuPrep (Bioneer ، Daejeon ، كوريا الجنوبية) وفقًا لتعليمات الشركة المصنعة. تم تضخيم MICA Exons 2-5 باستخدام الاشعال الموصوفة سابقًا (FW: CGTTCTTGTCCCTTTGCCCGTGTGC و REV: GATGCTGCCCCATTCCCTTCCCAA) ، ثم تم ربط منتجات PCR الناتجة في pGEM T-easy plasmids (Promega ، Madison ، WI). تمت مقارنة التسلسلات بجميع أليلات MICA المعروفة في قاعدة بيانات IMGT / HLA (http://www.ebi.ac.uk/ipd/imgt/hla/) وتم التحقق منها عن طريق التعليق على exons يدويًا ومواءمتها مع الأليلات المرشحة باستخدام التسلسل العالمي المحاذاة (emboss.bioinformatics.nl/). تم إجراء أربعة تسلسلات منفصلة على الأقل قبل اعتبار خط الخلية متماثل اللواقح.

عدوى HCMV

تم إنشاء متحولة الحذف US9 (ΔUS9) مسبقًا باستخدام BAC-cloned AD169فارL الجينوم pAD16928. نمت مخزونات الفيروس على الخلايا الليفية للقلفة البشرية ، وتمت معايرتها باستخدام فحص البلاك ، وتخزينها عند درجة حرارة -80 درجة مئوية. تم إجراء العدوى في عدوى متعددة (MOI) 2.5 ، في الخلايا الليفية المتكدسة MRC-5. تم تعزيز عدوى HCMV بالطرد المركزي عند 800 × ز لمدة 30 دقيقة. تمت معالجة الخلايا الليفية المصابة بالعدوى الوهمية باستخدام متوسط ​​فقط ، وتم طلاءها بكثافة أقل بحيث تكون شبه متكدسة في الوقت الذي تم فيه حصاد الخلايا المصابة. تم التحقق من العدوى عن طريق تلطيخ قياس التدفق الخلوي بجسم مضاد لـ CMV (استنساخ 8B1.2 ، Merck Millipore) بمعدل 24 نقطة في البوصة ، وأصيب 85٪ على الأقل من الخلايا.

ضربة قاضية SEL1L و HRD1

تم شراء خمسة مستنسخات من SEL1L MISSION shRNA من Sigma-Aldrich لكل جين مستهدف ، معبرًا عنها باستخدام نقل الفيروسة البطيئة كما هو موصوف أعلاه ، وتم فحصها بواسطة طقطقة مناعية لكفاءة الضربة القاضية في خلايا RKO MICA * 008-HA. تم اختيار اثنين من SEL1L shRNAs ، المعينين كـ # 1 (TRCN0000161385) و # 2 (TRCN0000165954) ، واثنين من HRD1 shRNAs ، تم تحديدهما على أنهما # 3 (TRCN0000364475) و # 4 (TRCN0000364477) ، للتجارب اللاحقة.

تألق مناعي

نمت الخلايا على شرائح زجاجية وثبتت ونفذت في ميثانول بارد (-20 درجة مئوية). تم حظر الخلايا طوال الليل في كتلة CAS (Life Technologies ، Carlsbad ، CA) ، ثم حضنت طوال الليل بأجسام مضادة أولية مخففة بنسبة 1: 200 في كتلة CAS ، ثم غسلها واحتضانها طوال الليل في أجسام مضادة ثانوية مخففة 1: 500 في 5٪ BSA PBS. تم بعد ذلك غسل الخلايا ومعالجتها لمدة 5 دقائق باستخدام DAPI وتغطيتها بغطاء. تم استخدام مجهر مسح ليزر متحد البؤر (Zeiss Axiovert 200M Carl Zeiss MicroImaging ، Thornwood ، نيويورك) للحصول على الصور. تم الحصول على الصور ومعالجتها باستخدام برنامج Olympus FluoView FV1000.

التدفق الخلوي

بالنسبة لقياس التدفق الخلوي ، تم طلاء الخلايا بكثافات متساوية واحتضانها طوال الليل. تم تحضين الخلايا المعلقة على الجليد لمدة ساعة واحدة مع الجسم المضاد الأولي بتركيز 0.2 ميكروغرام لكل بئر. ثم تم تحضين الخلايا لمدة 30 دقيقة على الجليد باستخدام الجسم المضاد الثانوي المناسب بتركيز 0.75 ميكروغرام لكل بئر. في جميع التجارب التي تستخدم الخلايا المنقولة بفيروس بطيء معبر عن GFP أو منقولة باستخدام EYFP ، يتم تثبيت الرسوم البيانية على السكان GFP / EYFP + الحي. استراتيجية البوابات موصوفة في الشكل S2f. تم الحصول على 10000 خلية حية من كل عينة. تم إجراء تلوين الخلفية مع جسم مضاد ثانوي بمفرده أو مع عنصر تحكم مطابق للنمط المتماثل في الخلايا المصابة بفيروس HCMV لجميع أنواع الخلايا في التجربة. يتم عرض تلطيخ تحكم تمثيلي واحد (تم تحديده في أساطير الشكل) لكل تجربة ، وكانت جميع ألوان الخلفية مشابهة لتلك الموضحة. تم تحليل بيانات قياس التدفق الخلوي باستخدام FCS Express الإصدار 6 (De Novo Software ، Pasadena ، CA).

مقايسة CD107a- إزالة الحبيبات

تم وصف تحليل CD107a على سطح خلية NK مسبقًا 51. باختصار ، تم تحضين خلايا NK الأولية السائبة المنشطة من IL-2 مع الخلايا المستهدفة بنسبة 1: 1 عند 37 درجة مئوية لمدة ساعتين ، في وجود جسم مضاد CD107a مترافق مع APC و CD56 مترافق مع PE. جسم مضاد (Biotest). ثم تم تحديد مستويات CD107a على الخلايا القاتلة الطبيعية عن طريق قياس التدفق الخلوي. تم استخدام ثلاثة متبرعين منفصلين NK للتجارب. تم تعيين إزالة التحبيب في وجود أهداف EV بنسبة 100 ٪ ، وتم حساب الانخفاض الطبيعي في التحلل مقارنةً بالتحكم في EV لكل متحولة.

لطخة مناعية

تم طلاء الخلايا بكثافة متساوية ، وحضنت طوال الليل ، وتم تفريغها في مخزن مؤقت يحتوي على 0.6 ٪ SDS و 10 ملي مولار تريس (الرقم الهيدروجيني 7.4) مكمل بـ 1 ملي مولار PMSF ، 1: 100 أبروتينين (سيغما ألدريتش). في بعض الحالات ، تم هضم المحللات باستخدام endoH أو PNGaseF (New England Biolabs ، Ipswich ، MA) ، وفقًا لتعليمات الشركة المصنعة. تم إجراء التحليل الكهربائي للهلام دوديسيل كبريتات الصوديوم - بولي أكريلاميد باستخدام 10 أو 12.5 أو 15٪ من المواد الهلامية. ثم تم مسح البروتينات على أغشية النيتروسليلوز. تم حظر الأغشية لمدة ساعة واحدة عند درجة حرارة الغرفة (PBS ، 5٪ حليب خالي الدسم ، 0.4٪ توين) وتم صبغها باستخدام الأجسام المضادة الأولية والثانوية الموصوفة أعلاه. تم تطوير الأغشية باستخدام مجموعة EZ-ECL (الصناعات البيولوجية). تم الحصول على الصور وتحديد كميتها باستخدام برنامج Image Lab (Bio-Rad ، Hercules ، CA) ، وتم تعديل تباين اللطخة والسطوع حسب الاقتضاء لتحسين التصور. يتم تضمين اللقطات الكاملة غير المعدلة كملف منفصل.

NP40 تجزئة

تم طلاء الخلايا بكثافة متساوية ، وحضنت طوال الليل ، وتم تحللها في محلول تحلل NP40 بنسبة 1 ٪ (150 ملي كلوريد الصوديوم ، 50 ملي مولار تريس ، درجة الحموضة 7.4 ، 1 مم PMSF ، 1: 100 أبروتينين). تم الطرد المركزي للمحللين عند 12000 × ز لمدة 10 دقائق وتم جمع المواد الطافية كجزء قابل للذوبان في المنظفات. تم غسل الكريات ثلاث مرات في برنامج تلفزيوني ثم تعليقها في محلول عينة البروتين ، وغليها لمدة 10 دقائق عند 99 درجة مئوية ، وتم جمعها كجزء غير قابل للذوبان في المنظف.

مطاردة سيكلوهيكسيميد

لمطاردة سيكلوهكسيميد ، تم تحضين الخلايا لمدة 4-5 ساعات في وجود سيكلوهيكسيميد (50 ميكروغرام / مل ، سيغما-الدريش) بالاشتراك مع إيبوكسوميسين (ميرك ميليبور) أو مع العلاج الوهمي DMSO. تم تحضير Lysates للتخثر المناعي كما هو موضح أعلاه عند 0 ساعة وفي نقاط زمنية لاحقة أثناء المطاردة.

علاج كيفونينسين

تم طلاء الخلايا في صفيحة من 6 آبار بكثافة 400000 خلية لكل بئر. The following day, cells were treated with kifunensine (Cayman Chemical, Ann Arbor, MI) at a concentration of 200 μM or with equivalent concentrations of mock treatment (ultra-pure water). Cells were incubated for 24 h and then harvested for immunoblot analysis as described above.

الترسيب المناعي

RKO MICA*008-HA cells expressing US9, ΔIg, ΔSer, or ΔN-Ser were plated at equal densities to reach 90% confluence the following day. Cells were then incubated at 37 °C overnight with 50 nM epoxomicin (Merck Millipore). Cells were washed twice in ice-cold PBS and lysed for 30 min on ice in 1% NP40 lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.4) supplemented with mammalian protease inhibitor cocktail (1:100, Sigma-Aldrich). Following lysis, nuclei and debris were cleared by centrifugation (10,000 × ز, 4 °C, 20 min). Supernatants were pre-cleared for 30 min at 4 °C using an isotype-matched control (mouse IgG1, Biolegend, San Diego, CA) and protein G-plus beads (Santa-Cruz). Beads were then removed by centrifugation (1000 × ز, 4 °C, 5 min). The pre-cleared supernatants were then mixed with an anti-His tag antibody (AD1.1.10, R&D Systems), and incubated for 1 h at 4 °C on a rotating platform. After 1 h, protein G-plus beads were added for an overnight incubation at 4 °C on a rotating platform. The following day, four washes were performed in ice-cold high-salt 0.2% NP40 wash buffer (500 mM NaCl, 50 mM Tris, pH 7.4) followed by two washes in ice-cold PBS and eluted by boiling for 3 min in twofold concentrated protein sample buffer. The eluates were run in gel electrophoresis on 15% gels which were then stained with Imperial protein stain (Thermo Fisher Scientific, Waltham, MA). Immunoprecipitated bands were excised based on size. For US9, the two isoforms were excised separately. Excised bands were shipped to the Smoler Proteomics Center, Department of Biology, Technion Institute of Technology, analyzed by LC-MS/MS on Q-Exactive (Thermo Fisher Scientific) and identified by Discoverer software against the US9 sequence. All the identified peptides were filtered with high confidence, top rank, mass accuracy, and minimum of two peptides. High confidence peptides have passed the 1% FDR threshold. Semi quantitation was done by calculating the peak area of each peptide. The area of the protein is the average of the three most intense peptides from each protein.

HA-tag immunoprecipitation was performed using anti-HA tag (clone 12B16, Abcam) and protein G-plus beads. RKO MICA*008-HA-US9 cells expressing either shScrambled control or shHRD1#4 were plated overnight as described above and incubated for 5 h with 4 µM of the proteasomal inhibitor EPX. Washing, lysis, preclearance, high-salt washing, and elution were performed as described above.

Co-immunoprecipitation

Cells were plated at equal densities to reach 90% confluence the following day. Cells were then incubated for 4 h at 37 °C with 2 µM epoxomicin, washed twice in ice-cold PBS, and lysed for 30 min on ice in 1% digitonin lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.4) supplemented with mammalian protease inhibitor cocktail (1:100, Sigma-Aldrich). Following lysis, nuclei and debris were cleared by centrifugation (10,000 × ز, 4 °C, 20 min). Input controls were taken from the supernatants after this stage.

For anti-His tag co-immunoprecipitation, supernatants were pre-cleared for 30 min at 4 °C using an isotype-matched control (mouse IgG1, Biolegend) and protein G-plus beads (Santa-Cruz). Beads were then removed by centrifugation (1000 × ز, 4 °C, 5 min). The pre-cleared supernatants were then mixed with an anti-His tag antibody (AD1.1.10, R&D Systems), and incubated for 1 h at 4 °C on a rotating platform. After 1 h, protein G-plus beads were added for an overnight incubation at 4 °C on a rotating platform. The following day, four washes were performed in ice-cold 0.2% digitonin wash buffer (150 mM NaCl, 50 mM Tris, pH 7.4) followed by two washes in ice-cold PBS. For immunoblotting, beads were eluted by boiling in twofold concentrated protein sample buffer for 3 min.

For proteomics, the same anti-His immunoprecipitation protocol was used, except that two controls were used: empty-vector-transduced cells immunoprecipitated with an anti-His antibody, and US9-HIS-transduced cells immunoprecipitated with an isotype control. Uneluted beads were stored at −80 °C and shipped to the Smoler Proteomics Center, Department of Biology, Technion Institute of Technology, where LC-MS/MS was performed on Orbitrap XL (Thermo Fisher Scientific), and results were analyzed by the MaxQuant software. All the identified peptides were filtered with 1% FDR threshold and minimum of two peptides. Known contaminants were also excluded.

For anti-HA tag co-immunoprecipitation, covalently attached anti-HA agarose beads (clone HA-7, Sigma-Aldrich) were used according to the manufacturer’s instructions. Elution was performed by boiling in twofold concentrated protein sample buffer for 3 min.

Metabolic labeling

Cells grown in 6-well plates were washed with PBS and metabolically labeled (Easytag Express [35S]-Met/Cys protein labeling, Perkin Elmer, Waltham, MA) with 100 Ci/ml for 20 min. Cells were lysed in digitonin lysis buffer (140 mM NaCl, 20 mM Tris [pH 7.6], 5 mM MgCl2, and 1% digitonin (Merck Millipore)) and cleared from membrane debris at 13,000 rpm for 30 min at 4 °C. Lysates were incubated with anti-His tag antibody for 2 h at 4 °C in an overhead tumbler before immune complexes were retrieved by protein G-sepharose (GE Healthcare, Chicago, IL). Sepharose pellets were washed four times with increasing NaCl concentrations (0.15–0.5 M in lysis buffer containing 0.2% detergent). EndoH (New England Biolabs) treatment was performed as recommended by the manufacturer. Prior to loading onto a SDS-PAGE immune complexes were dissociated at 95 °C for 5 min in a DTT (40 mM) containing sample buffer. Fixed and dried gels were exposed overnight to a phosphor screen, scanned by Typhoon FLA 7000 (GE Healthcare). For better visualization of the results, contrast and brightness were adjusted. A long exposure to X-ray film was used for autoradiography. Images were quantified using the ImageJ software 83 .

أساليب إحصائية

A one-way ANOVA was used to compare the effect of the various US9 mutants and chimeras on MICA surface expression (measured as normalized median fluorescent intensity). All mutants sharing the same control groups (e.g., all single US9 mutants, all double US9 mutants, all EYFP chimeras, etc.) were grouped into the same analysis to correct for the relevant multiple comparisons. EV controls were not included in the analyses. Where the ANOVA was statistically significant, a post hoc Dunnett’s test was conducted to determine which mutants differed significantly from the control group. A two-way ANOVA was used to compare the effects of SEL1L knockdown and the various US9 constructs, including EV controls, on MICA surface expression, and where the ANOVA was statistically significant, a post hoc Tukey test was conducted to determine which mutants differed significantly from each other. ANOVAs and post hoc tests were considered statistically significant when ص & لتر 0.05. Full statistical details including ص values, F values, degrees of freedom, and effect sizes (Cohen’s د) are presented in the relevant figure legends and/or in the Source data file.

For specific comparison of the effect of US9 on MICA surface and total protein levels in shSCR, shSEL1L, or shHRD1 KD cells, a two-tailed Student’s ر-test for unequal variance samples was used, with Sidak’s correction for multiple comparisons. The t-test was considered significant when (p ,<, [1 - (1 - 0.05)^>]) , where م equals the number of null hypotheses tested. Results from the two shRNA constructs targeting the same gene (SEL1L or HRD1) were pooled together in this analysis.

Where multiple comparisons were not needed, a two-tailed Student’s ر-test for unequal variance samples was used without corrections and was considered statistically significant when ص & لتر 0.05.

The number of independent experiments analyzed (biological replicates) is indicated in the relevant figure legends. Biological replicates were performed with fresh cells from at least two separate transfections/transductions. The data analysis for this paper was generated using the Real Statistics Resource Pack software (Release 5.4). Copyright (2013–2018) Charles Zaiontz. www.real-statistics.com, and GraphPad Prism version 8 for Windows, GraphPad Software, La Jolla, California, USA, www.graphpad.com.

ملخص التقارير

يتوفر مزيد من المعلومات حول تصميم البحث في Nature Research Reporting Summary المرتبط بهذه المقالة.


النتائج

Optimized biochemical conditions are not sufficient for the efficient cell-free expression of many ORFs

It was previously reported that the efficiency of cell-free protein synthesis is improved remarkably when the reaction mixture is supplied with sufficient amounts of energy and substrates ( 9). For example, in reactions utilizing creatine phosphate for the continuous regeneration of ATP, the use of an excess amount of creatine phosphate enabled prolonged protein synthesis provided that the reaction mixture was supplied periodically with fresh magnesium ions to compensate for their loss through the formation of insoluble magnesium phosphates. Using this approach, as much as 1.2 mg/ml of chloramphenicol acetyltransferase (CAT) could be produced from a single batch reaction of cell-free protein synthesis. An increase in the productivity of many other proteins was also shown after improving the supply of ATP and amino acids ( 9).

However, the provision of optimal biochemical conditions does not always enhance the productivity of cell-free protein synthesis. For example, the expression level of hEPO was not affected significantly in the presence of the elevated levels of ATP and amino acids, and remained at <100 μg/ml. Since all of our ORFs were routinely cloned in the same expression vectors (pK7 and pIVEX2.3d) ( 9, 18), such a discrepancy would be due to the nature of the nucleotide sequences of the structural genes.

Signal peptide sequences-mediated stimulation of protein expression

With respect to the effect of the sequence elements on the efficiency of gene expression, many recent reports strongly suggest that the translational efficiency of a gene is determined primarily by the nature of the initial nucleotide sequences. For example, Stenström and Isaksson recently demonstrated that the translational efficiency of the لاكز reporter gene was critically affected by the identity of the first +2 to +5 codons ( 13). In particular, the expression level was dramatically changed according to which codon was placed at the +2 position. While the expression level of the reporter gene was strongly stimulated when the AAA codon was located at +2 position ( 11), the placement of the NGG codons (CGG, AGG, GGG and UGG) at the same position was associated with remarkably lower expression efficiency ( 12, 20).

Based on their results, it was assumed that the yields of otherwise poorly expressed genes might be stimulated by placing the optimal nucleotide sequences beforehand. It was also expected that such a stimulatory sequence could be used as a universal translation enhancer to increase the productivity of recombinant proteins. In search of the nucleotide sequences that possibly enhance the expression of their fusion partners, the python script was used to analyze the codon usage in the entire بكتريا قولونية الجينوم. Interestingly, it was found that the nucleotide sequences of many signal peptides had strong bias for AAA as the second codon. Approximately 40% of signal peptides had the AAA triplet as the second codon ( Table 2).

Codon biases of the nucleotide sequence of the بكتريا قولونية signal peptides

Sequence data . Frequency of AAA codon at position +2 .
جميع بكتريا قولونية K12 genome 440/4241 (10.3%)
Unverified بكتريا قولونية signal sequences 22/45 (48.9%)
تم التحقق بكتريا قولونية signal sequences 16/54 (29.6%)
Sequence data . Frequency of AAA codon at position +2 .
جميع بكتريا قولونية K12 genome 440/4241 (10.3%)
Unverified بكتريا قولونية signal sequences 22/45 (48.9%)
تم التحقق بكتريا قولونية signal sequences 16/54 (29.6%)

بكتريا قولونية signal sequence data set were obtained from a signal peptide database (http://proline.bic.nus.edu.sg/spdb/). This database currently contains 99 entries of بكتريا قولونية signal sequences: 54 of the entries are experimentally verified signal sequences (the N-terminal amino acid residues were sequenced), and 45 are computationally predicted sequences ( 17).

Codon biases of the nucleotide sequence of the بكتريا قولونية signal peptides

Sequence data . Frequency of AAA codon at position +2 .
جميع بكتريا قولونية K12 genome 440/4241 (10.3%)
Unverified بكتريا قولونية signal sequences 22/45 (48.9%)
تم التحقق بكتريا قولونية signal sequences 16/54 (29.6%)
Sequence data . Frequency of AAA codon at position +2 .
جميع بكتريا قولونية K12 genome 440/4241 (10.3%)
Unverified بكتريا قولونية signal sequences 22/45 (48.9%)
تم التحقق بكتريا قولونية signal sequences 16/54 (29.6%)

بكتريا قولونية signal sequence data set were obtained from a signal peptide database (http://proline.bic.nus.edu.sg/spdb/). This database currently contains 99 entries of بكتريا قولونية signal sequences: 54 of the entries are experimentally verified signal sequences (the N-terminal amino acid residues were sequenced), and 45 are computationally predicted sequences ( 17).

According to the analysis reported by Sato وآخرون. ( 21), >10% of the بكتريا قولونية genes use AAA as their second codon whereas the frequency of AAA triplet in the entire بكتريا قولونية genome is 3.3%. It was also suggested that the higher frequency of the AAA triplet at the +2 position is related to the translation efficiency of a gene. Therefore, from the exceptionally high frequency of the AAA triplet as the second codon, it was assumed that the signal sequences might work as a translation-enhancing element.

Therefore, the genes of hEPO with different signal sequences were fused and experiments were carried out to determine if their presence affects the efficiency of protein synthesis in our cell-free synthesis system. The nucleotide sequences of the seven different signal peptides (pelBss, ompAss, phoAss, malEss, ompCss, ompTss, heposs) were fused to the upstream of hEPO sequence in the plasmid pK7hEPO, and the resulting constructs were expressed in the reaction mixture for cell-free protein synthesis. As summarized in Table 3, the five signal sequences except for ompTss and heposs dramatically enhanced the expression level, yielding 9–10 times higher amounts of the target proteins ( Figure 2). For example, the expression level of hEPO was increased from 55 to 588 μg/ml through its fusion with the ompA sequence.

SDS–PAGE analysis of the cell-free synthesized hEPOs fused with different signal peptides. The reaction mixture was incubated at 37°C for 2 h. The reaction mixture (2 μl) was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue.

SDS–PAGE analysis of the cell-free synthesized hEPOs fused with different signal peptides. The reaction mixture was incubated at 37°C for 2 h. The reaction mixture (2 μl) was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue.

Expression level of the signal peptide-EPO fusion constructs

بلازميد. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8
بلازميد. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8

a Data from three independent experiments.

b Expression level as compared with the expression of the wild-type EPO (EPO expression level = 1 EPO expression level = 55 μg/ml)

Expression level of the signal peptide-EPO fusion constructs

بلازميد. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8
بلازميد. Signal peptide . Second codon . Expression level a (μg/ml) . Relative level of expression b .
pK7pelBss-EPO pelB AAA 569 ± 34 10.3
pK7ompAss-EPO ompA AAA 588 ± 28 10.7
pK7phoAss-EPO phoA AAA 515 ± 31 9.4
pK7malEss-EPO malE AAA 524 ± 13 9.5
pK7ompCss-EPO ompC AAA 522 ± 24 9.5
pK7ompTss-EPO ompT CGG 107 ± 17 1.9
pK7heposs-EPO heposs GGG 101 ± 13 1.8

a Data from three independent experiments.

b Expression level as compared with the expression of the wild-type EPO (EPO expression level = 1 EPO expression level = 55 μg/ml)

Effect of the identity of the second codon on the translation efficiency

However, not all the signal sequences were effective in enhancing the expression of the downstream ORF. For example, the nucleotide sequence of the OmpT signal sequence (ompTss) failed to stimulate the synthesis of hEPO with the amount of the accumulated protein being similar to the wild-type sequence. Similarly, the addition of the natural signal sequence of hEPO (heposs) did not affect the expression level of hEPO.

Interestingly, when the second codons of ompTss and heposs were switched to AAA (from CGG and GGG, respectively), there was an ∼4-fold increase in protein synthesis ( Figure 3A). In contrast, switching the second codons of ompAss and ompCss from AAA to NGG (AGG, TGG, GGG and CGG) almost completely abolished its stimulatory effect ( Figure 3B). This suggests that the identity of the second codon critically affects the stimulatory effect of the signal sequences.

Effect of the expression level of the fused proteins according to the identity of the second codon. The efficiency of cell-free protein synthesis was enhanced by switching the second codon of ompTss and heposs into AAA (أ). In contrast, protein synthesis was repressed when the second codons (AAA) of ompAss and ompCss were mutated into NGG codons (AGG, TGG, GGG and CGG) (ب). After 2 h incubation, 15 μl of the reaction samples were withdrawn from the reaction mixture, and the [ 14 C]leucine-labeled radioactivity was measured as described in Materials and Methods.

Effect of the expression level of the fused proteins according to the identity of the second codon. The efficiency of cell-free protein synthesis was enhanced by switching the second codon of ompTss and heposs into AAA (أ). In contrast, protein synthesis was repressed when the second codons (AAA) of ompAss and ompCss were mutated into NGG codons (AGG, TGG, GGG and CGG) (ب). After 2 h incubation, 15 μl of the reaction samples were withdrawn from the reaction mixture, and the [ 14 C]leucine-labeled radioactivity was measured as described in Materials and Methods.

PCR-based addition of the stimulatory signal sequence and the direct expression of the amplified DNAs

Encouraged by the dramatic increase in hEPO expression in the presence of the signal sequences, this study examined whether or not the signal sequence-assisted stimulation of protein synthesis is generally applicable to the expression of other proteins. Sixteen different ORFs that normally show a very low expression level in our cell-free protein synthesis system were selected. Instead of cloning each of the fusion constructs in the expression vector, the PCR-amplified DNA with or without the ompAss were used directly as the templates for cell-free protein synthesis, thereby eliminating the time- and labor-intensive cloning steps ( Figure 4). As summarized in Table 4, the presence of ompAss remarkably enhanced the expression of the target proteins in all the cases examined, which suggests that the proposed strategy can be employed as a general method for boosting the expression of the recombinant proteins in a cell-free protein synthesis system. However, the extent of stimulation showed significant variations among different proteins implying that the expression of protein can also be substantially affected by the nucleotide sequences of the target ORFs.

Construction and expression of the linear expression templates by PCR. (أ) Schematic diagram of the PCR-based generation of the ompA fusion constructs. Three primary PCR products with defined overlapping ends were synthesized by the first PCR. These three fragments were joined in the second PCR, overlap extension PCR, which also simultaneously introduced the regulatory elements and the OmpA signal peptide sequence to the target genes. The red bar indicates the overlapping region. The blue and black bar indicate UTR and ORF, respectively. (ب) Agarose gel electrophoresis of the PCR products. Second PCR products have an additional 600 bp as a result of the fusion with 5′-UTR and 3′-UTR. (ج) Cell-free expression of ompA-fused PCR products. The reaction mixture for cell-free protein synthesis was prepared as described in Materials and Methods. After 2 h of incubation, 2 μl of the reaction mixture was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue. Cell-free expressed proteins are indicated by arrows.

Construction and expression of the linear expression templates by PCR. (أ) Schematic diagram of the PCR-based generation of the ompA fusion constructs. Three primary PCR products with defined overlapping ends were synthesized by the first PCR. These three fragments were joined in the second PCR, overlap extension PCR, which also simultaneously introduced the regulatory elements and the OmpA signal peptide sequence to the target genes. The red bar indicates the overlapping region. The blue and black bar indicate UTR and ORF, respectively. (ب) Agarose gel electrophoresis of the PCR products. Second PCR products have an additional 600 bp as a result of the fusion with 5′-UTR and 3′-UTR. (ج) Cell-free expression of ompA-fused PCR products. The reaction mixture for cell-free protein synthesis was prepared as described in Materials and Methods. After 2 h of incubation, 2 μl of the reaction mixture was loaded on a 13% Tricine-SDS–PAGE gel and stained with Coomassie Brilliant Blue. Cell-free expressed proteins are indicated by arrows.

Cell-free expression of the ompAss fused genes

Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 الانسان العاقل
TNF-a 226 513 2.3 X01394 17.5 الانسان العاقل
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 الانسان العاقل
المملكة المتحدة 83 387 4.7 NM_008873 30.5 موس العضلات
VEGF اختصار الثاني. 489 X62568 22.3 الانسان العاقل
IFN-γ 45 460 10.2 K00083 16.0 موس العضلات
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter الهلال
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 أغروباكتريوم توميفاسيانز
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR اختصار الثاني. 702 AAF72551 26.8 Streptomyces fradiae
Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 الانسان العاقل
TNF-a 226 513 2.3 X01394 17.5 الانسان العاقل
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 الانسان العاقل
المملكة المتحدة 83 387 4.7 NM_008873 30.5 موس العضلات
VEGF اختصار الثاني. 489 X62568 22.3 الانسان العاقل
IFN-γ 45 460 10.2 K00083 16.0 موس العضلات
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter الهلال
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 أغروباكتريوم توميفاسيانز
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR اختصار الثاني. 702 AAF72551 26.8 Streptomyces fradiae

a The relative expression level was determined by dividing the amount of the ompA fused protein by the expressed wild-type protein.

b Plasmid pDsRed2 is obtained from Clontech.

Cell-free expression of the ompAss fused genes

Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 الانسان العاقل
TNF-a 226 513 2.3 X01394 17.5 الانسان العاقل
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 الانسان العاقل
المملكة المتحدة 83 387 4.7 NM_008873 30.5 موس العضلات
VEGF اختصار الثاني. 489 X62568 22.3 الانسان العاقل
IFN-γ 45 460 10.2 K00083 16.0 موس العضلات
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter الهلال
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 أغروباكتريوم توميفاسيانز
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR اختصار الثاني. 702 AAF72551 26.8 Streptomyces fradiae
Protein . Wild-type (μg/ml) . ompA fusion (μg/ml) . Relative level of expression a . GenBank ID/references . Molecular weight of protein (kDa) . Origin .
IL-2 91 545 6.0 S77834 15.5 الانسان العاقل
TNF-a 226 513 2.3 X01394 17.5 الانسان العاقل
DsRed2 b 98 665 6.8 25.9 Synthetic gene
BMP2 128 431 3.4 M22489 13.0 الانسان العاقل
المملكة المتحدة 83 387 4.7 NM_008873 30.5 موس العضلات
VEGF اختصار الثاني. 489 X62568 22.3 الانسان العاقل
IFN-γ 45 460 10.2 K00083 16.0 موس العضلات
ϖ-TACc 125 487 3.9 AAK25105 47.8 Caulobacter الهلال
ϖ-TAMl 206 537 2.6 BAB48961 48.2 Mesorhozobium loti
ϖ-TATr 173 436 2.5 AAL44116 49.0 أغروباكتريوم توميفاسيانز
ϖ-TAVf 237 539 2.3 ( 32) 50.3 Vibrio fluvialis
ϖ-TAXc 198 529 2.7 AAM41635 48.4 Xanthomonas axonopodis
smTG 11 358 32.5 AAS68222 45.7 Streptomyces mobaraensis
oleV 35 645 18.4 AAD55451 53.1 Streptomyces antibioticus
oleW 26 689 26.5 AAD55450 35.8 Streptomyces antibioticus
urdR اختصار الثاني. 702 AAF72551 26.8 Streptomyces fradiae

a The relative expression level was determined by dividing the amount of the ompA fused protein by the expressed wild-type protein.

b Plasmid pDsRed2 is obtained from Clontech.

فى الموقع cleavage of signal peptide in an بكتريا قولونية cell-free protein synthesis system

Although it was shown that the presence of ompAss dramatically enhances the expression of the recombinant proteins, it also adds 21 non-native amino acid residues to the target proteins that might interfere with the biological functions and proper folding of the expressed proteins. Therefore, it would be desirable if the signal peptides are removed during protein synthesis so that the resulting polypeptide of the target protein follows its natural folding pathway. Since the reactions of cell-free protein synthesis are carried out in a crude lysate of بكتريا قولونية (S30 extract), it was presumed that most of the soluble بكتريا قولونية proteins are present in the reaction mixture. In addition, the signal peptidase of بكتريا قولونية retains its activity even when it is detached from the cellular membrane ( 22, 23). Therefore, the added signal peptide should be removed فى الموقع by the endogenous signal peptidase activity. As shown in Figure 5A, SDS–PAGE and western blot analyses confirmed that a significant proportion of the cell-free expressed protein had the native size without the signal peptide. This indicates that the S30 extract retains the signal peptidase activity under the reaction conditions for cell-free protein synthesis.

فى الموقع cleavage of the signal peptides during cell-free protein synthesis. (أ) The indicated concentration of Triton X-100 was added to the reaction mixture from the start of the synthesis reaction, and examined to determine it could increase the level of signal peptide cleavage. After incubation, the reaction mixture was centrifuged at 10 000 ز for 10 min, and the soluble and pellet fractions were analyzed by 13% Tricine-SDS–PAGE stained with Coomassie Brilliant Blue (upper panel) and western blot using the anti-EPO antibody (lower panel). P and S represent the insoluble and soluble fractions of the cell-free synthesized EPO, respectively. (ب) [ 14 C]leucine-labeled radioactivity of the expressed protein was measured as described under Materials and Methods.

فى الموقع cleavage of the signal peptides during cell-free protein synthesis. (أ) The indicated concentration of Triton X-100 was added to the reaction mixture from the start of the synthesis reaction, and examined to determine it could increase the level of signal peptide cleavage. After incubation, the reaction mixture was centrifuged at 10 000 ز for 10 min, and the soluble and pellet fractions were analyzed by 13% Tricine-SDS–PAGE stained with Coomassie Brilliant Blue (upper panel) and western blot using the anti-EPO antibody (lower panel). P and S represent the insoluble and soluble fractions of the cell-free synthesized EPO, respectively. (ب) [ 14 C]leucine-labeled radioactivity of the expressed protein was measured as described under Materials and Methods.

Tschantz وآخرون. reported that the catalytic activity of truncated بكتريا قولونية signal peptidase, which lacks the membrane-anchoring domain, was stimulated in the presence of the detergent Triton X-100 ( 22, 24). By taking advantage of the ‘open’ nature of cell-free protein synthesis, an attempt was made to express the ompAss-hEPO construct in the presence of Triton X-100 with the anticipation that the enhanced signal peptidase activity would increase the fraction of the correctly sized product. Indeed, the efficiency of the cleavage of signal peptide was improved remarkably upon the addition of Triton X-100, and virtually all the products were found at the correct molecular weight ( Figure 5A). When tested at different concentrations, the presence of Triton X-100 >0.1% (w/v) effectively facilitated the removal of the OmpA sequence, and virtually all of the cell-free expressed products were found at the native size of EPO. At least up to the concentration of 0.5% (w/v), the presence of Triton X-100 did not affect the efficiency of protein synthesis ( Figure 5B). Therefore, enhanced efficiency of the cleavage of the signal sequence was not due to a reduced yield of protein synthesis. In addition, solubility of the cell-free expressed products was substantially enhanced in the presence of Triton X-100. While the EPO molecules (regardless of the presence of signal sequences) were almost completely insoluble in the reaction mixture without any detergents, ∼70% of the expressed protein was found in the soluble fraction.


The function of SRP was discovered by the study of processed and unprocessed secretory proteins, particularly immunoglobulin light chains [2] and bovine preprolactin. Newly synthesized proteins in eukaryotes carry N-terminal hydrophobic signal sequences, which are bound by SRP when they emerge from the ribosome. [3] [4]

In eukaryotes, SRP binds to the signal sequence of a newly synthesized peptide as it emerges from the ribosome. [1] This binding leads to the slowing of protein synthesis known as "elongation arrest", a conserved function of SRP that facilitates the coupling of the protein translation and the protein translocation processes. [5] SRP then targets this entire complex (the ribosome-nascent chain complex) to the protein-conducting channel, also known as the translocon, in the endoplasmic reticulum (ER) membrane. This occurs via the interaction and docking of SRP with its cognate SRP receptor [6] that is located in close proximity to the translocon.

In eukaryotes there are three domains between SRP and its receptor that function in guanosine triphosphate (GTP) binding and hydrolysis. These are located in two related subunits in the SRP receptor (SRα and SRβ) [7] and the SRP protein SRP54 (known as Ffh in bacteria). [8] The coordinated binding of GTP by SRP and the SRP receptor has been shown to be a prerequisite for the successful targeting of SRP to the SRP receptor. [9] [10]

Upon docking, the nascent peptide chain is inserted into the translocon channel where it enters into the ER. Protein synthesis resumes as SRP is released from the ribosome. [11] [12] The SRP-SRP receptor complex dissociates via GTP hydrolysis and the cycle of SRP-mediated protein translocation continues. [13]

Once inside the ER, the signal sequence is cleaved from the core protein by signal peptidase. Signal sequences are therefore not a part of mature proteins.

Despite SRP function being analogous in all organisms, its composition varies greatly. The SRP54-SRP RNA core with GTPase activity is shared in all cellular life, but some subunit polypeptides are specific to eukaryotes.


الاستنتاجات ووجهات النظر

The proprotein convertase furin has become an attractive target for the treatment of various infectious and noninfectious diseases as it regulates the activity of numerous mammalian, bacterial and viral proteins. In recent years, several peptidic and nonpeptidic inhibitors have been developed that block the activation of bacterial toxins, prevent the maturation of viral proteins and suppress tumor growth في المختبر. Although some of them also yielded promising results in mouse models, there have been only a limited number of clinical trials in humans.

One major challenge is the redundancy of furin with related proprotein convertases that also recognise polybasic cleavage sites. On the one hand, selective inhibition of furin may be beneficial as it limits unwanted side effects due to inhibition of other PCSKs. On the other hand, treatment of some diseases may require the simultaneous inhibition of several PCSKs to efficiently block pathological substrate conversion. To advance current approaches, a better understanding of the relative contribution of individual PCSKs to (nonphysiological) proteolytic protein processing is urgently needed. Therapeutic intervention needs to specifically target the convertase(s) that drive disease progression. Currently, the most promising approaches for selective inhibition are shRNA-mediated silencing and nanobodies as they show no or only little off-target effects.

Even if selective inhibition of individual PCSKs can be achieved, systemic long-term inhibition will most likely have detrimental effects, as PCSKs are required for the activation of hundreds of cellular substrates. Thus, local applications such as targeted treatment of tumors or topical treatment of bacterial and viral infections may be more feasible than systemic therapy. Finally, the ability of tumor cells or pathogens to evolve resistance or evasion mutations remains poorly investigated. For example, several substrates such as dengue virus prM harbour suboptimal furin target sequences and may optimise their cleavage sites upon therapy to enable sufficient cleavage in the presence of inhibitors.

Although the therapeutic application of furin inhibitors may be full of pitfalls, it is certainly a promising approach that should be further pursued. Future studies will elucidate the role of individual PCSKs and their substrates in disease progression and a better understanding of cellular pathways regulating furin activity may uncover additional targets for therapeutic intervention.