معلومة

بنية تركيبية مع ORFs متعددة لا تعبر

بنية تركيبية مع ORFs متعددة لا تعبر


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد صممت تركيبًا اصطناعيًا على الورق وحصلت عليه من شركة. كان الهدف هو صنع ناقل يمكن استخدامه لدراسة كل من التنظيم النسخي وما بعد النسخ بواسطة عناصر رابطة الدول المستقلة المختلفة (يمكن دراسة 2-3 عناصر مختلفة في نفس الوقت).

البناء مثل هذا:

SmaI-RES1-CMV-RES1'-GFP-MCS1-SV40PA-Linker-RES2-CMV-RES2'-RFP-MCS2-SV40PA-Linker-RES3-CMV-RES3'- YFP-MCS3-SV40PA-ΔLinker-SmaI

أين:

RES1 = KpnI [GGTACC] RES1 '= SalI [GTCGAC] MCS1 = EcoRI + BamHI [GAATTCTGGATCC] RES2 = CLI [ATCGAT] RES2' = NheI [GCTAGC] MCS2 = SpeI + HindIII [ACTAGTAAGCTT] RES3 = Xba = PvuI [CGATCG] MCS3 = نوتي + ساسي [GCGGCCGCGAGCTC] كوزاك إجماع تسلسل = GCCACCATGG رابط (100bp) = AATTCTGGATCCTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCGAATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGC

تعد GFP و RFP و YFP من المتغيرات سريعة الدوران مع تسلسل الآفات MODC. أخذت تسلسلات هذه البروتينات من موقع Evrogen. أخذت تسلسل إشارة polyA Sv40 من أحد نواقلها لتجنب أي حدث من عدم التوافق. تم أخذ تسلسل كوزاك أيضًا من تلك النواقل فقط. الحجم الإجمالي ~ 4.8 كيلو بايت. بالنسبة لمروج CMV ، أخذت التسلسل القياسي المستخدم في معظم النواقل.

باستخدام هذا المتجه ، يمكنني استنساخ أي تسلسل تنظيمي بعد النسخ بين إيقاف كودون و SV40PA ، ويمكنني أيضًا تغيير المروجين.

مع مروج CMV وعدم وجود 3'UTRs ، أرى تعبيرًا خافتًا جدًا عن GFP ، لكن لم أتمكن من رؤية أي تعبير RFP. لقد استخدمت pMaxGFP و dsRed كعنصر تحكم في حساسية المرشح.

لقد قمت بنقل البلازميد في Hela و Neuro2a وبتركيزات مختلفة (1-5 ميكروغرام) باستخدام lipofectamine. تعبر عناصر التحكم بشكل جيد (1 ميكروغرام لكل منهما) ولكني أرى تعبير GFP خافت للغاية ولا أرى أي تعبير RFP.

لقد راجعت تقرير مراقبة الجودة المتسلسل الذي قدمته الشركة ولم يكن هناك indels أو حالات عدم تطابق أخرى. أنا جاهل لماذا فشل البناء في التعبير.

هل الرابط مشكلة؟ هو 100 نقطة أساس ليست كافية؟


أخشى أنه ليس هناك الكثير من الإجابات ولكن العودة إلى مقاعد البدلاء معك! (لهذا يسمى إعادة البحث).

هناك العديد من العوامل التي يمكن أن تلعب دورًا هنا. يمكنك قراءة نصية أو ترجمة. يجب عليك التحقق من تسلسلك والخلايا التي ستنتقل إليها للتأكد من أنك لا تحصل على قمع Amber (UAG).

قبل أن تفعل أي شيء ، يجب أن تتحقق من حمضك النووي لجميع مجموعاتك. قم بتشغيله بدون تقطيع على هلام وتأكد من أن غالبية الحمض النووي عبارة عن ملف فائق. أسهل شيء يجب التحقق منه هو مشاكل الترجمة. احصل على جسم مضاد لـ GFP ، ربما يكون عددًا قليلًا يتعرف على الحلقات المختلفة ، ومعرفة ما إذا كان GFP الخاص بك يخرج بالحجم الصحيح. قد لا تتم معالجتها بشكل صحيح أو طيها بشكل صحيح.

يمكنك مواجهة مشاكل عن طريق تحسين التسلسل. أولاً ، يمكن أن تسبب الطفرات المترادفة متغيرات قابلة للطي (1). ثانيًا ، قد تتسبب في قلم شعر أو بنية ثانوية أو ثالثة ضارة. إذا لم تتمكن من اكتشاف أي مشاكل في منطقتك الغربية ، فقد تفكر في القيام بعمل شمالي لحل مشكلة النسخ.

إذا استبعدت كل شيء آخر ، وكنت تحصل على تعبير ضعيف ، فإن الطريقة الوحيدة التي أعرفها لزيادة تأثير CMV هي استخدام T7. ستكون مشكلة T7 دائمًا هي ما فائدة المصدر. إذا كان بإمكانك استخدام خلايا BSR / T7 ويمكنك وضع يديك عليها ، فإنها تعمل بشكل رائع. وإلا فإنك تنظر إلى بلازميد T7 أو MVA-T7 كمصادر شائعة. لا تؤدي البلازميدات أبدًا إلى قدر كبير من التعبير في يد أي شخص عرفته من قبل. يعمل MVA-T7 ، ولكن القول بأنه يربك الأشياء سيكون البيان السفلي لهذا العام.


بنية تركيبية مع ORFs متعددة لا تعبر - علم الأحياء

تعد مجموعات الجينات الميكروبية المشفرة وغير المعينة من جينات التخليق الحيوي مصادر غير مسبوقة للمنتجات الطبيعية الجديدة.

تلعب أدوات البيولوجيا التركيبية دورًا حيويًا في الاستكشاف والإنتاج الزائد وتنويع هيكل المنتجات الطبيعية.

تعد أنظمة إعادة الدمج وأنظمة CRISPR / Cas9 أداة رائعة للهندسة الوراثية لمسار NP وهندسة المضيف.

هندسة المضيفين مطلوبة للإنتاج الفعال لمحطات الطاقة النووية المستهدفة.


البيانات المرتبطة

خلفية

يمكن لنهج البيولوجيا التركيبية أن تقدم مساهمة كبيرة في تقدم هندسة التمثيل الغذائي عن طريق تقليل وقت تطور الكائنات المؤتلفة. ومع ذلك ، فقد تم تطوير معظم أدوات البيولوجيا التركيبية من أجل الإشريكية القولونية. نحن هنا نقدم منصة للهندسة السريعة لـ C. الجلوتاميك، وهو كائن حي دقيق ذو أهمية صناعية كبيرة. تم تطوير هذه البكتيريا ، التي تُستخدم لعقود من الزمن للإنتاج التخمرى للأحماض الأمينية ، كمضيف لإنتاج العديد من المركبات المهمة اقتصاديًا بما في ذلك المستقلبات والبروتينات المؤتلفة بسبب قدرتها العالية على الإفراز مقارنة بالمضيفات البكتيرية التقليدية مثل بكتريا قولونية. وبالتالي ، قد يساهم تطوير المنصات الجزيئية الحديثة بشكل كبير في التأسيس C. الجلوتاميك كمصنع ميكروبي قوي ومتعدد الاستخدامات.

نتائج

تم إنشاء منصة قائمة على البلازميد تسمى pTGR حيث يتم محاطة جميع المكونات الجينية بمواقع تقييد فريدة لتسهيل تقييم التسلسلات التنظيمية وتجميع التركيبات للتعبير عن جينات متعددة. تم التحقق من صحة هذا النهج باستخدام جينات المراسل لاختبار المروجين ، ومواقع ربط الريبوسوم ، ولتجميع مشغلات الجينات المزدوجة ومجموعات الجينات التي تحتوي على وحدتين نسخ. تجميع اندماجي للمروج (تاك, cspB و الاحمق) و RBS (لاكز, cspB و الاحمق) عناصر ذات نقاط قوة مختلفة تمنح تعبيرًا جينيًا تفاضليًا واضحًا لجينين مراسل ، eGFP و mCherry ، مما يسمح بالنسخ & # x0201cfine-tuning & # x0201d من جينات متعددة. بالإضافة إلى ذلك ، سمحت المنصة بالتجميع السريع للأوبرونات ومجموعات الجينات للتعبير المشترك عن الجينات غير المتجانسة ، وهي ميزة قد تساعد في هندسة المسارات الأيضية.

الاستنتاجات

نتوقع أن تساهم منصة pTGR في استكشاف إمكانات الأجزاء الجديدة لتنظيم التعبير الجيني ، وتسهيل تجميع الدوائر الجينية للهندسة الأيضية لـ جيم الجلوتاميك. قد يوفر التوحيد القياسي الذي يوفره هذا النهج وسيلة لتحسين إنتاجية مسارات التخليق الحيوي في المصانع الميكروبية لإنتاج مركبات جديدة.


نتائج

الهرولة الدائرة

تخليط الدارة هو أسلوب لتشفير طوبولوجيا الدائرة الجينية ، إما في المختبر أو في الجسم الحي (أي داخل خلية هندسية) ، والتي من شأنها أن توفر الحماية عند تخزين الدائرة أو نقلها بين الأطراف. يمكن تحقيق التدافع في الدائرة من خلال استخدام إعادة التركيب أحادي الاتجاه الخاصة بالموقع ، مثل إعادة التركيب السيرين الكبيرة ، التي تتعرف على تسلسل الحمض النووي المعين المعروف باسم أتب و AttP المواقع 5. إذا تم وضع مواقع التعرف على إعادة التركيب (RRS) على نفس قطعة الحمض النووي ، فإن إعادة التركيب المشابه سوف يتسبب في حدث إعادة التركيب لمرة واحدة بين RRS ، مما يؤدي إلى انعكاس أو استئصال الحمض النووي بين RRS ، اعتمادًا على اتجاهها النسبي 6،7. يمكن بعد ذلك استخدام أحداث إعادة التركيب هذه لخلط طوبولوجيا الدائرة عندما لا تكون قيد الاستخدام ، وهو أمر مفيد لأن سلوك الدائرة الجينية يتحدد إلى حد كبير من خلال طوبولوجياها والخصائص الكيميائية الحيوية للمكونات.

لإثبات تشويش الدائرة باستخدام إعادة التركيب ، نستخدم دوائر النسخ كمثال. هنا ، يتم تحديد طوبولوجيا دوائر النسخ من خلال أزواج محددة من الجينات المروج ، حيث يعبر المروجون عن جينات ترميز عوامل النسخ ، ويمكن تنظيم كل مروج بواسطة واحد أو أكثر من عوامل النسخ. إن العملية التي يمكن أن "تدافع" و "تفكيك" هذه الأزواج بشكل حاسم تسمح بتشفير وفك تشفير طوبولوجيا الدائرة ، مما ينتج عنه دوائر غير وظيفية أو وظيفية ، على التوالي.

توفر إعادة التركيب أحادي الاتجاه وسيلة للتخليط الحتمي وطوبولوجيا الدائرة عن طريق إعادة هيكلة الحمض النووي فيزيائيًا. يوضح الشكل 1 إثباتًا لمفهوم عملية التشفير لبوابة AND وراثية. تتكون البوابة AND من ثلاثة جينات ، منظمة خطيًا على امتداد DNA (الشكل 1 أ). يتم خلط البوابة باستخدام عملية تكرارية من خطوتين: (1) يتم اختيار قسم من الحمض النووي بحيث يكون طرف واحد على الأقل بين المروج وجينه ويكون هذا القسم مقلوبًا ، و (2) RRS الذي يحيط بالمنطقة المقلوبة قدم في التسلسل. يمكن إدخال مجموعات متعددة من RRS بهذه الطريقة لتخليط الدائرة (الشكل 1 ب). يمكن بعد ذلك تصنيع الدائرة المشوشة أو تجميعها في المختبر. يتطلب فك الترميز (الشكل 2 أ) تطبيق نفس مجموعة إعادة التركيب التي تم استخدامها لعملية التخليط في مجموعة محدودة من الطلبات (تمت مناقشة تحليل هذا للبوابة AND لاحقًا). من خلال تداخل أزواج من مواقع إعادة التركيب المتوافقة مع إعادة التركيب المختلفة ، يتم إدخال تبعية النظام في عملية فك الترميز. تم استخدام التطبيق المعتمد على الترتيب لإعادة التركيب أحادي الاتجاه سابقًا في بناء دوائر المنطق الجيني 1،8 ، بينما تم استخدام إعادة التركيب ثنائية الاتجاه "لفك ضغط" بنية دائرة وراثية واحدة إلى توازن أكثر من بنية واحدة 9.

تشفير البوابة الجينية AND باستخدام الخلط الدائرى. أ بوابة AND الوراثية. A ، B ، C ORFs ترميز لاسي, araC، و gfp، على التوالى. pA و pB و pC هي المروجين proD و pLtetO-1 و pLac / ara-1 على التوالي. يثبط المحرض 1 (IPTG) قمع النسخ بواسطة LacI ، وينشط المحرض 2 (أرابينوز) النسخ بواسطة AraC. تم اختبار هذه الدائرة في الخلايا التي لا تعبر عن مثبط TetR بحيث يكون pLtetO-1 نشطًا بشكل أساسي. ب تشفير البوابة AND. في كل خطوة ، تتم إضافة مجموعة جديدة من مواقع إعادة التركيب (شرك أم لا) أو أزواج جينات المروج الشرك. المروج pD و ORF D هما pLtetO-1 و رباعي، على التوالى. يتم التعرف على مواقع إعادة التركيب التي يُشار إليها بالمثلثات والأقواس والأقواس المربعة وأنصاف الدوائر بواسطة recombinases TP01 و BxbI و Int3 و PhiC31 ، على التوالي

فك تشفير البوابة الجينية AND. أ فك تشفير البوابة AND المشوشة من الشكل 1. يظهر سلوك التركيبات من كل مرحلة من مراحل فك الشفرات. ن = 3 ، أشرطة الخطأ تمثل الانحراف المعياري. يوضح البناء النهائي غير المرتب (الخطوة 4) سلوك البوابة AND ، بينما تُظهر الخطوات الوسيطة سلوك البوابة غير AND. ب مثال على فك تشفير غير صحيح. تم استخدام تسلسلات RiboJ 34 مباشرة في اتجاه المنبع من RBS لكل جين لمنع أي تداخل من الحجم المتزايد لـ 5UTRs (RiboJ54 و RiboJ51 و RiboJ53 و RiboJ ، من أجل araC, لاسي, رباعي، و gfp على التوالى). NoInd = لا محفز ، عربي = أرابينوز

يمكن تقوية التدافع بشكل كبير باستخدام الشراك الخداعية. الأفخاخ هي عناصر وراثية موجودة داخل البناء المخلوط ، ويمكن تصور أن تكون جزءًا من دائرة وظيفية ، ولكنها ليست مطلوبة في الواقع لوظيفة الدائرة. تقدم الأفخاخ شكًا إضافيًا فيما يتعلق بالطوبولوجيا الفعلية للدائرة الوظيفية ، مما يجعل كسر الدائرة المشوشة أكثر صعوبة. تتيح إمكانية جينات الطعم إمكانية دمج أحداث الختان في عملية فك الترميز ، وبالتالي منع الختان من أن يكون مؤشرًا على فك التشفير غير الصحيح. يوضح مثال تخليط البوابة AND استخدام زوج الجينات المروجة للطعم و RRS الشرك (الشكل 1 ب). يتوافق زوج الجين المروج الطعم pD و ORF D مع pLtet0-1 و رباعي، والتي يمكن أن تكون عناصر معقولة للدائرة الوظيفية. إن شرك RRS هي تلك التي تم التعرف عليها بواسطة recombinase PhiC31. في هذا المثال ، لا يلزم إعادة التركيب مع PhiC31 من أجل فك الترميز الصحيح ، وإذا تم استخدامه سيؤدي إلى حذف غالبية مكونات الدائرة ، مع ترك ORFs فقط رباعي و gfp متبقي. لن تؤدي الدائرة الناتجة وظيفة البوابة AND الصحيحة.

طبقنا تجريبياً مثالاً على التدافع والتفكيك في الدارات في التين. 1 ، 2 في المختبر. يجب أن يكون من الممكن أيضًا تنفيذ هذه العملية على الدوائر المشفرة داخل الخلايا 1،10،11. بدءًا من البلازميد الذي يحتوي على التركيبة المخفوقة ، قمنا بتفكيك الهيكل من خلال جولات متتالية من العلاج في المختبر مع إعادة التركيب المنقى المختلفة. في كل جولة ، تم تحويل البلازميدات إلى بكتريا قولونية وتم اختيار التركيبات المعاد تجميعها. في العمل المستقبلي ، يمكن تحسين هذا البروتوكول بحيث لا تكون أحداث إعادة التركيب والتحويل والاختيار المتتالية ضرورية.

يمكن تحقيق التكسير بالقوة الغاشمة للتركيبات المخلوطة بإعادة التركيب إما عن طريق (1) بناء جميع الدوائر الممكنة بناءً على المروجين والجينات الموجودة ، أو (2) تجربة كل الأوامر الممكنة وهويات إعادة التركيب. في كلتا الحالتين ، لا يزال يتعين تحديد هوية الدائرة الحقيقية من المجموعة الناتجة من الهياكل المحتملة. . بالإضافة إلى ذلك ، تعني الأفخاخ أنه يجب على الطرف الثالث تقدير العناصر التي هي مكونات دارة فعلية لتجنب الدائرة النهائية ذات المكونات غير الصحيحة.

تتمثل الطريقة الأكثر منهجية لتكسير الدائرة المشوشة في تعداد جميع حالات الحمض النووي الممكنة التي يمكن الحصول عليها من الترتيبات المختلفة لإعادة التركيب ، ثم تقييم الحالات لمعرفة مدى احتمالية أن تكون الدائرة الحقيقية. عددنا جميع أوامر فك تشفير إعادة التركيب الممكنة ( ( mathop < sum> nolimits_^ فارك <> << يسار ( حق)! >> = 64 )) 12 أين ن هو العدد الإجمالي لإعادة التركيب و ك هو عدد إعادة التركيب المستخدمة في فك تشفير محتمل للبوابة AND المشفرة (الشكل التكميلي 1). لقد ثبت رسميًا في مكان آخر أنه عند استخدام زوج RRS واحد لكل recombinase ، ن يمكن أن تنتج recombinases 2 على الأكثر ن حالات DNA الفريدة 11 (بما في ذلك الحالة التي لا يتم فيها استخدام إعادة التركيب). علاوة على ذلك ، يمكن أن تؤدي الترتيبات المختلفة لنفس مجموعة إعادة التركيب إلى نفس حالة الحمض النووي 11. من الناحية العملية ، ليست كل طلبات إعادة التركيب منتجة لأن حدث الختان قد يزيل مواقع إعادة التركيب الأخرى ، والتي لا يمكن استخدامها بعد ذلك في الخطوات اللاحقة. ومع ذلك ، نظرًا لأن أي طلب لنفس مجموعة إعادة التركيب يؤدي إلى نفس حالة الحمض النووي ، يجب أن تكون جميع الطلبات غير متاحة حتى لا يمكن الوصول إلى الحالة. بالنسبة لبوابة AND ، ن = 4 و 2 ن = 16 ، وعلى الرغم من أن أحداث الختان تسمح فقط لـ 35 من أوامر إعادة التركيب الـ64 المحتملة أن يكون لها تأثير إنتاجي (واحد حيث يكون لكل recombinase في المجموعة تأثير على حالة الحمض النووي) على حالة الحمض النووي عند إجرائها (الشكل التكميلي 1) ، نحن تجد أن جميع الولايات الـ 16 يمكن الوصول إليها. اثنتان من هذه الحالات متطابقة ، بسبب أحداث الختان المتداخلة. نظرًا لحدوث هذا النوع من التكرار ، في حين أن عدد حالات الحمض النووي الفريدة التي يمكن الوصول إليها قد يكون عادةً أقل من 2 ن ، قد لا يكون أقل بشكل جوهري.

وبالتالي ، سيتم تقديم المهاجم بقائمة من المرشحين المحتملين للدوائر الفريدة ، والتي حتى لو كان الترقيم بالمئات المنخفضة فقط (على سبيل المثال ، 2 8 = 256) قد يتضمن العديد من المرشحين المقبولين. في حالة البوابة AND ، على الرغم من صغر حجمها ، فإن العديد من حالات الحمض النووي الـ 15 (بما في ذلك الحالة المشفرة) هي تكوينات معقولة لأقتران ودوائر المروج ORF (الشكل التكميلي 1). يقترح مزيد من الفحص لهذه التكوينات طرقًا لزيادة التنوع وعدد التوصيلات في هذه الدوائر غير الصحيحة ، مما يجعلها تبدو أكثر منطقية. على سبيل المثال ، فإن استخدام متغيرات مختلفة من pLtetO-1 لـ pB و pD من شأنه أن يفرق بين بعض التكوينات ، إضافة مروج بشكل دائم (على سبيل المثال ، مع عدم وجود مواقع إعادة الارتباط بين المروج و ORF بحيث لا يتم قطع هذه العلاقة أبدًا) رباعي سوف يعرض التعبير رباعي روابط في العديد من التكوينات ، وإما جعل pC ثنائي الاتجاه أو ببساطة إضافة في مروج معارض سيعبر في كثير من الحالات لاسي وتقديم حلقة التغذية الراجعة. لن تؤثر أي من هذه الإضافات على طوبولوجيا البوابة AND المفككة الصحيحة ، على الرغم من أنه قد يكون هناك تأثير كمي لجعل pC ثنائي الاتجاه. أخيرًا ، في هذا المثال ، تكون دائرة البوابة AND الصحيحة أبسط بكثير (على سبيل المثال ، لا تحتوي على محفزات غير مستخدمة أو ORFs ، ولها مروج واحد لكل جين ، مع جميع أزواج الجينات المروج في نفس الاتجاه) من العديد من الحالات المرشحة الأخرى . في الممارسة العملية ، يجب تصميم الدائرة الصحيحة لتبدو غير منظمة مثل المرشحين الآخرين بحيث لا تبرز.

يقتصر التنفيذ العملي لهذا النهج على العدد والتعامد والكفاءات المتاحة لإعادة التركيب. على سبيل المثال ، تم إثبات أن 11 إعادة تركيب متعامدة إلى حد كبير مع بعضها البعض 13 ، ويمكن اكتشاف المزيد من خلال المزيد من التعدين. تعرض ثلاثة من مجموعات إعادة التركيب مستويات منخفضة من الحديث المتبادل مع موقع تمييز واحد آخر بالإضافة إلى مواقعهم الخاصة. لذلك فإن تعامد مجموعة إعادة التركيب المستخدمة مهم لأن الحديث المتبادل قد يؤدي إلى أحداث إعادة تركيب غير صحيحة. إذا لزم الأمر ، من المحتمل أن يتم تقليل الحديث المتبادل عن طريق الهندسة والتطور الموجه. يمكن أن تؤثر كفاءات إعادة التركيب على الوقت المطلوب لفك التشفير بنجاح ، وكذلك على كفاءة فك التشفير الإجمالية. على سبيل المثال ، ثبت أن Bxb1 يعيد تجميع 90٪ من المواقع في ساعتين في المختبر 14. بافتراض أن هذا المعدل ينطبق على إعادة التركيب الأخرى ، فمن المتوقع أن يكون لفك التشفير باستخدام خمسة إعادة التركيب كفاءة مجتمعة 0.9 5

60٪. إن السماح لتفاعلات إعادة التركيب بالعمل لفترة أطول أو إجراء تطور على إعادة التركيب لتحسين نشاطها يمكن أن يساعد في التخفيف من هذه المشاكل.

تفاعلات إعادة التركيب الموصوفة هنا هي أحادية الاتجاه ولا تسمح بالعكس ما لم يتم استخدامها مع عوامل اتجاه إعادة التركيب 15. هذا مقبول للتطبيقات الحالية ، حيث أن الخلايا المهندسة غالبًا ما تستخدم مرة واحدة ونادرًا ما يتم استردادها واستخدامها مرة أخرى. قد يتغير هذا في التطبيقات المستقبلية ، وبالتالي قد يكون إعادة التدافع مفيدًا. قد يكون أحد الأمثلة تطبيقًا ميدانيًا خارج مختبر أبحاث ، حيث لا يمكن الاحتفاظ بمخزون من المخزونات المجمدة لفترات طويلة من الزمن. سيكون من المفيد بعد ذلك الحفاظ على بنك واحد من الخلايا لفترة طويلة من الزمن ، وفك ترتيب الدائرة عند الحاجة إلى استخدام الخلايا ، ثم إعادة خلط الدائرة بعد ذلك. بالإضافة إلى ذلك ، فإن إعادة التدافع هي أيضًا مثيرة للاهتمام لأنها تطرح تحديات تقنية ومفاهيمية. بعد ذلك ، نقدم طريقة للتعتيم على الدوائر يمكن عكسها.

تمويه الدائرة

على عكس التدافع الدائري ، يحافظ تمويه الدائرة على طوبولوجيا الدائرة الحقيقية ، ولكنه يجعل تحديد هذه الهيكلية أمرًا صعبًا. يتم تحقيق ذلك من خلال تضمين الدائرة الوظيفية داخل دائرة "تمويه" أكبر (الشكل 3) ، وهي شكل من أشكال إخفاء المعلومات. يتم استخدام إستراتيجية مماثلة في تصميم الدوائر المتكاملة (IC) 16 ، 17 ، 18 ، حيث تتم إضافة جهات اتصال وهمية إضافية بين الطبقات الموصلة بحيث يتم من الرؤية العلوية (المنظر الذي يمكن من خلاله استخدام الفحص المجهري للكشف عن تصميم الدائرة) التصميم من الدائرة لا يمكن التعرف عليها بسهولة. في نهجنا ، يستخدم إلغاء التمويه "مفتاح" جزيئي لطرح تأثيرات جينات التمويه من الدائرة الوظيفية بحيث يمكن أن تعمل بشكل صحيح. في التنفيذ الذي تمت مناقشته هنا ، يتم تحقيق ذلك عن طريق قمع التعبير عن جينات التمويه. نظرًا لأن معظم آليات القمع قابلة للعكس ، يمكن أن يكون إلغاء التمويه عابرًا ويمكن إعادة تمويه الدائرة عن طريق إزالة الأساليب القمعية.

تمويه الدائرة. تشير العقد الحمراء إلى جينات الدائرة الصحيحة بينما العقد الزرقاء هي جينات دائرة التمويه. تؤدي إضافة "مفتاح جزيئي" إلى كبت أو إزالة تأثيرات جينات دائرة التمويه التي تحدث على الدائرة الصحيحة ، تاركًا الدائرة الصحيحة لتعمل. تم فقط إزالة العقد التي تم كبتها بواسطة المفتاح الجزيئي والتي تقع فقط على الدائرة الصحيحة في الدائرة غير المموهة. تم الاحتفاظ بالعقد المستهدفة بواسطة المفتاح ولكنها لا تزال تحتوي على عقدة عرضية من الدائرة الصحيحة ، حيث ستعمل هذه العقد كمغسلة للبروتينات من الدائرة الصحيحة

يوضح الشكل 4 تنفيذًا لإثبات المفهوم في الجسم الحي لتمويه الدائرة على دائرة تبديل ثنائية الاستقرار 19. يوضح الشكل 4 أ طوبولوجيا التبديل ثنائية الاستقرار التي تعتمد على القمع المتقاطع بواسطة رباعي و لاسي، وثنائي الاستقرار من حيث ناتج GFP. لتمويه الدائرة ، أضفنا جينين إضافيين إلى الدائرة ، araC و λCI (الشكل 4 ب). عن طريق تعديل قيادة المروج رباعي لتضمين موقع ملزم لـ λCI, λCI يمكن أن ترتبط بمروجي التبديل ثنائي الاستقرار ، وبالتنسيق مع تنشيط λCI التعبير بواسطة AraC ، تشوش وظيفتها عن طريق تدمير سلوك مفتاح التبديل. لإلغاء التمويه على الدائرة ، قمنا بتحويل في بلازميد يحتوي على dCas9 المعبر عنه بشكل أساسي ، جنبًا إلى جنب مع اثنين من الحمض النووي الريبي المعبر عنه بشكل أساسي يستهدفان ORFs لـ araC و λCI، والتي تشكل معًا "مفتاح كريسبر". تم كبت التعبير CRISPR عن araC و λCI من خلال تداخل CRISPR ، مما يترك المفتاح ثنائي الاستقرار غير مموه ويعمل (الشكل 4 ب). احتوى البلازميد على الأصل الحساس لدرجة الحرارة repA101 ts من pDK46 ، وهو مستقر عند 30 درجة مئوية ولكنه غير مستقر عند 42 درجة مئوية ، وعلامة مقاومة الأمبيسلين. من خلال تنمية الخلايا على وسائط صلبة عند 42 درجة مئوية طوال الليل دون اختيار ، تمت إزالة البلازميد ، وبالتالي إعادة تمويه الدائرة بجعلها تفقد وظائفها بسبب تأثيرات جينات التمويه.

التمويه وعدم التمويه لمفتاح ثنائي الاستقرار باستخدام تمويه الدائرة. أ يتم تشكيل المفتاح ثنائي الاستقرار من رباعي و لاسي في قمع بعضهم البعض. يعمل GFP كمراسل. ب الجينات الإضافية araC و λCI قم بالتواصل مع الدائرة وتمويهها عن طريق تغيير الهيكل والتدخل في وظيفتها. تؤدي إضافة مفتاح كريسبر إلى قمع التعبير عن araC و λCI، عدم التمويه على المفتاح. يمكن مقارنة ديناميكيات المفتاح غير المموه بالدائرة بدون إضافة جينات التمويه. تؤدي إزالة مفتاح كريسبر إلى إعادة تمويه المفتاح. توضح بيانات قياس التدفق الخلوي إخراج GFP للمفتاح. يتم تمثيل الخلايا المستحثة بـ + aTc على شكل مدرج تكراري أحمر ، ويتم تمثيل الخلايا المستحثة بـ + IPTG على شكل مخططات بيانية زرقاء. تم إجراء كل مرحلة في ثلاث نسخ - يمثل كل مدرج تكراري تكرارًا بيولوجيًا واحدًا. الرسوم البيانية الإضافية في مرحلة عدم التمويه هي عناصر تحكم سلبية (انظر الطرق للحصول على التفاصيل)

يتطلب تكسير التمويه بالقوة الغاشمة إيجاد جميع الدوائر الفرعية الممكنة للدائرة المموهة وتحديد الدائرة الصحيحة. باستخدام مفتاح جزيئي يمكنه استهداف جينات معينة ، يكون عدد الدوائر الفرعية الممكنة 2 ن أين ن هو العدد الإجمالي للجينات داخل الدائرة المموهة. هذا مخطط قابل للمقارنة عدديًا بعدد مسارات فك الترميز لتخليط الدارة. ومع ذلك ، تحديد أي من هذه 2 ن الدوائر هي على الأرجح أن الدائرة الحقيقية أكثر صعوبة من تخليط الدائرة. هذا لأن المروجين و ORFs يقترنان دائمًا في تمويه الدائرة ، مقارنةً بالتخليط الدائرى حيث يجب إقران كل من مجموعة المروج-ORF التي تعبر عن عامل النسخ والمروج- ORF الذي ينظمه عامل النسخ حتى يكون الارتباط معقولًا . هذا يعني أن الكون من الدوائر المرشحة المعقولة من تمويه الدائرة سيكون أكبر وأكثر ارتباطًا في المتوسط ​​من التدافع الدائري. إذا كان من الممكن استهداف روابط محددة بدلاً من جينات محددة فقط ، فيمكن تقوية التمويه ، حيث توجد عادةً روابط تنظيمية أكثر من الجينات. لا توجد آلية بسيطة معروفة يمكنها التمييز بين الروابط التنظيمية من نفس الجينات ، ولكن قد يكون الحظر التفاضلي لوصول عامل النسخ إلى المروجين المختلفين استراتيجية واحدة. على سبيل المثال ، قد يسمح استهداف موقع فريد يتداخل مع موقع ربط المنشط بحظر ارتباط المنشط بمروج واحد يحتوي على موقع فريد ولكن ليس موقعًا آخر لا يحتوي على الموقع الفريد. يمكن أن يعمل نفس النهج مع مثبطات حقيقية النواة التي تربط المنبع من المروج الأساسي.

للحصول على مخطط تمويه مثالي ، يجب ألا تعرض الدائرة السلوك النوعي والكمي الصحيح عند استخدام مفتاح غير صحيح. قمنا بفحص سلوك دائرتنا تحت مفاتيح غير صحيحة لفهم الفئات المختلفة للسلوكيات التي قد تؤدي إلى حالة عامة. في الشكل 5 ، عدد أهداف gRNA المحتملة (في أي مكان يوجد NGG لـ S. المقيحة dCas9) أسفل كل مروج و ORF. أرقام المروجين دقيقة ، بينما بالنسبة لـ ORFs ، يقدر طولها بـ ORF في bp مقسومًا على 16 (الاحتمال العشوائي للحصول على NGG في ثلاثة توائم (CCN ، الذي يتوافق مع NGG في الشريط السفلي ، لم يؤخذ في الاعتبار العدد الإجمالي هو 235 ، مما يعطي العدد الإجمالي لمجموعات الجرنا 2 ^ 235

10 70. في حين أن كل مجموعة من المجموعات الـ 10 70 يمكن أن تكون مفتاحًا محتملاً ، بالنسبة لقابلية التتبع ، فقد اعتبرنا جرنا واحدًا فقط لكل ORF كعضو رئيسي محتمل. بالنسبة للمروجين ، أخذنا في الاعتبار فقط gRNAs التي تتداخل مع منطقة المروج الأساسية ، واخترناها جميعًا لتتداخل مع منطقة -10. يعطي هذا مجموعة من 7 جرنا قد تشكل جزءًا من المفتاح الصحيح ، المسمى a-g في الشكل 3 ، ليصبح المجموع 2 ^ 7 = 128 مجموعة ، أو 127 إذا تم استبعاد تركيبة no-gRNA. لمزيد من التبسيط ، قمنا فقط بفحص مجموعات من 3 جرنا على الأكثر ، وتحديدًا مجموعة فرعية منها توضح النتائج المحتملة لاستخدام مفتاح غير صحيح (الشكل 5). كانت هناك مجموعة من التأثيرات النوعية والكمية لاستخدام مفتاح غير صحيح ، عند مقارنتها بسلوك التبديل الصحيح (الشكل 4 ب ، اللوحة 2): أعطت التوليفات a + b و a + b + g و e + b النواتج التي كانت مختلفة نوعيًا عن سلوك التبديل. أدت التوليفات c و c + d إلى تبديل مختلف كميًا أو سلوكًا يشبه التبديل. أسفر الجمع بين b + f عن سلوك تبديل مشابه. أدى الجمع بين e + f إلى سلوك تبديل مشابه ولكن بشكل غير موثوق به (لم يتم تنفيذ جميع التكرارات بنفس الطريقة ، كما لوحظ أيضًا بالنسبة لـ a + b). هذه السلوكيات الأربعة: (1) لا يوجد فرق عملي عن الدائرة المشفرة (b + f) ، (2) تختلف كميًا عن الدائرة التي تم فك تشفيرها بشكل صحيح (c و c + d) ، (3) تختلف نوعياً عن الدائرة المشفرة بشكل صحيح (أ + b و a + f + g و e + b) و (4) مكافئ كميًا للدائرة التي تم فك تشفيرها بشكل صحيح ولكن غير متناسقة (e + f) تغطي السيناريوهات المحتملة التي يمكن رؤيتها في الحالة العامة.

نزع التمويه باستخدام مفاتيح غير صحيحة. يتم إعادة رسم الدائرة المموهة. يتم عرض مواضع استهداف جرنا كشريط أحمر. تشكل gRNAs e + g المفتاح الصحيح ، المستخدم في الشكل 2. تشير الأرقام الموجودة بجانب المروجين و ORFs إلى عدد مواقع ربط gRNA المحتملة (أي التسلسلات المجاورة لـ NGG PAM). تُظهر الرسوم البيانية إخراج GFP من مفاتيح غير صحيحة. يتم تمثيل الخلية المستحثة بـ + aTc على شكل رسوم بيانية حمراء ، والخلايا المستحثة بـ + IPTG يتم تمثيلها كمدرج تكراري أزرق. تم إجراء كل تجربة في ثلاث نسخ - يمثل كل مدرج تكراري تكرارًا بيولوجيًا واحدًا

على الرغم من أن معظم الدوائر التي تم وصفها في الأدبيات هي أنظمة إثبات المفهوم ، فإن استخدامها النهائي سيكون في التحكم الدقيق بالخلايا والكائنات الحية المهندسة ، حيث تكون العلاقة الكمية بين المدخلات والمخرجات حيوية. تشمل الأمثلة مصنّفات الخلايا للسرطان 20 حيث يتم تحديد المعدلات السلبية والإيجابية الزائفة من خلال سلوك الدائرة الكمية ، والبروبيوتيك المهندسة التي تستشعر مستويات العلامات الحيوية وتعاير تعبير المركبات العلاجية على جرعات محددة. لذلك ، قد يكون إخفاء السلوك الكمي للدائرة لا يقل أهمية عن إخفاء السلوك النوعي.

بينما يتم تدمير طوبولوجيا الدائرة الصحيحة في التدافع الدائري ، يمكن أن تظل الطوبولوجيا سليمة مع تمويه الدائرة. وبالتالي فإن نسبة جينات التمويه إلى جينات الدائرة الحقيقية مهمة - فكلما انخفضت هذه النسبة ، زاد احتمال أن يمنحك الاختيار العشوائي لدائرة فرعية متصلة جزءًا من الدائرة الحقيقية. كما هو الحال مع التدافع الدائري ، لا يوفر تمويه الدائرة الحماية عندما تكون الدائرة غير مموهة وتكون قيد الاستخدام ، على الرغم من اختلاف نقطة الضعف. بالنسبة للتخليط الدائرى ، تتمثل الثغرة فى القدرة على تسلسل التركيب غير المرتب ، بينما مع تمويه الدائرة ، فإن الضعف هو القدرة على الحصول على المفتاح الجزيئى عندما يكون فى الخلية. قد يؤدي استخدام أنواع أخرى من المفاتيح الجزيئية التي تكون إما عابرة بشكل طبيعي أو يصعب اكتشافها مقابل الخلفية الخلوية إلى تقليل هذا الضعف. تتضمن الأمثلة توصيل RNAs صغيرًا يتم إزالته عادةً بسرعة بواسطة الخلية ، أو مجموعة من المركبات التي يتم استقلابها بسرعة. في كل حالة ، بدون الإمداد المتكرر بالمفتاح ، ستُعاد تمويه الدائرة بسرعة.

تقليديا ، استخدمت الهندسة الأيضية التعديل الجيني الدائم لتحسين إنتاج المركبات المستهدفة ، مثل الطفرات في تسلسلات تنظيمية محددة أو الجينات لتغيير وظائفها. تم استخدام تقنية CRISPRi مؤخرًا في هندسة عملية التمثيل الغذائي للمهمات الصناعية الوتدية الجلوتاميسيوم بقمع الجينات بدلاً من حذفها 21. قد يسمح هذا النهج بضبط أكثر دقة لعملية التمثيل الغذائي للمضيف ، مما يسمح بتحقيق تكوينات الشبكة الأيضية التي يصعب تحقيقها مع الطفرات أو الضربات القاضية. يمكن تطبيق نهجنا في استخدام مفتاح فك تشفير عابر على هندسة التمثيل الغذائي. بالنسبة لأي مسار معين ، يوجد توزيع تدفق أمثل يزيد من إنتاج مركب مستهدف معين. عن طريق إضافة مفتاح بلازميد dCas9-gRNA وإزالته بشكل عابر لتعديل التعبير عن مكونات المسار المختلفة ، يمكن تصميم السلالة بشكل عابر لتحقيق هذا الأمثل. هذا هو الوضع المثالي حيث يكون للسلالة قيمة تجارية فقط عندما يتم إزالة التمويه وتعمل ، في حين أن السلالة الأساسية المخزنة غير المهندسة من المحتمل أن يكون لها قيمة تجارية أقل بكثير.


محتويات

كانت أول دائرة جينية طبيعية تمت دراستها بالتفصيل هي أوبرون لاك. في دراسات النمو diauxic من بكتريا قولونية اكتشف جاك مونود وفرانسوا جاكوب ذلك على وسائل الإعلام ثنائية السكر بكتريا قولونية يستهلك بشكل تفضيلي الجلوكوز الذي تتم معالجته بسهولة أكبر قبل التحول إلى استقلاب اللاكتوز. اكتشفوا أن الآلية التي تتحكم في وظيفة "التبديل" الأيضية كانت آلية تحكم من جزأين في أوبرون lac. عندما يكون اللاكتوز موجودًا في الخلية ، يتم إنتاج إنزيم β-galactosidase لتحويل اللاكتوز إلى جلوكوز أو جالاكتوز. عندما يغيب اللاكتوز في الخلية ، يمنع مثبط اللاكتوز إنتاج إنزيم β-galactosidase لمنع أي عمليات غير فعالة داخل الخلية.

يستخدم lac operon في صناعة التكنولوجيا الحيوية لإنتاج البروتينات المؤتلفة للاستخدام العلاجي. يتم وضع الجين أو الجينات لإنتاج بروتين خارجي على بلازميد تحت سيطرة محفز لاك. في البداية تنمو الخلايا في وسط لا يحتوي على اللاكتوز أو السكريات الأخرى ، لذلك لا يتم التعبير عن الجينات الجديدة. بمجرد أن تصل الخلايا إلى نقطة معينة في نموها ، تتم إضافة Isopropyl β-D-1-thiogalactopyranoside (IPTG). IPTG ، جزيء مشابه للاكتوز ، ولكن برابطة كبريتية غير قابلة للتحلل بالماء بحيث لا تهضمه E. Coli ، يُستخدم لتنشيط أو "تحفيز" إنتاج البروتين الجديد. بمجرد تحفيز الخلايا ، يصعب إزالة IPTG من الخلايا وبالتالي يصعب إيقاف التعبير.

نُشر مثالان مبكران للدوائر البيولوجية الاصطناعية في مجلة Nature في عام 2000. أحدهما ، بقلم تيم غاردنر ، وتشارلز كانتور ، وجيم كولينز العامل في جامعة بوسطن ، أظهر تبديلًا "ثنائي الاستقرار" في بكتريا قولونية. يتم تشغيل المفتاح عن طريق تسخين مزرعة البكتيريا ويتم إيقاف تشغيله عن طريق إضافة IPTG. استخدموا GFP كمراسل لنظامهم. [3] والثاني ، من تأليف مايكل إلويتز وستانيسلاس ليبلر ، أظهر أن ثلاثة جينات مثبطة يمكن ربطها لتشكيل حلقة تغذية مرتدة سلبية تسمى المكبِّد (Repressilator) الذي ينتج تذبذبات مستدامة ذاتيًا لمستويات البروتين في بكتريا قولونية. [4]

تعد الدوائر الاصطناعية حاليًا مجالًا مزدهرًا للبحث في بيولوجيا الأنظمة مع نشر المزيد من المنشورات التي تفصل الدوائر البيولوجية الاصطناعية كل عام. [5] كان هناك اهتمام كبير بتشجيع التعليم والتواصل أيضًا: مسابقة الآلات المهندسة وراثيًا الدولية [6] تدير إنشاء وتوحيد أجزاء BioBrick كوسيلة للسماح لطلاب المرحلة الجامعية والثانوية بتصميم الدوائر البيولوجية الاصطناعية الخاصة بهم .

توجد تطبيقات فورية وطويلة المدى لاستخدام الدوائر البيولوجية التركيبية ، بما في ذلك التطبيقات المختلفة للهندسة الأيضية والبيولوجيا التركيبية. وتشمل تلك التي تم إثباتها بنجاح إنتاج المستحضرات الصيدلانية ، [7] وإنتاج الوقود. [8] ومع ذلك ، فإن الطرق التي تتضمن الإدخال الجيني المباشر ليست فعالة بطبيعتها دون التذرع بالمبادئ الأساسية للدوائر الخلوية الاصطناعية. على سبيل المثال ، يستخدم كل من هذه الأنظمة الناجحة طريقة لتقديم الاستقراء أو التعبير الكل أو لا شيء. هذه دائرة بيولوجية حيث يتم إدخال مثبط أو مروج بسيط لتسهيل إنشاء المنتج ، أو تثبيط مسار منافس. ومع ذلك ، مع الفهم المحدود للشبكات الخلوية والدوائر الطبيعية ، يتم إعاقة تنفيذ مخططات أكثر قوة مع تحكم أكثر دقة وردود الفعل. وهنا يكمن الاهتمام المباشر بالدوائر الخلوية التركيبية.

يمكن أن يؤدي التطور في فهم الدوائر الخلوية إلى تعديلات جديدة ومثيرة ، مثل الخلايا التي يمكن أن تستجيب للمنبهات البيئية. على سبيل المثال ، يمكن تطوير الخلايا التي تشير إلى البيئة السامة وتتفاعل عن طريق تنشيط المسارات المستخدمة لتحطيم السم المدرك. [9] لتطوير مثل هذه الخلية ، من الضروري إنشاء دائرة خلوية تركيبية معقدة يمكنها الاستجابة بشكل مناسب لمحفز معين.

بالنظر إلى أن الدوائر الخلوية التركيبية تمثل شكلاً من أشكال التحكم في الأنشطة الخلوية ، يمكن تفسير أنه من خلال الفهم الكامل للممرات الخلوية ، يمكن هندسة "التوصيل والتشغيل" [1] للخلايا ذات الدوائر الجينية المحددة جيدًا. من المعتقد على نطاق واسع أنه في حالة إنشاء صندوق أدوات مناسب من الأجزاء ، [10] يمكن تطوير الخلايا الاصطناعية باستخدام المسارات اللازمة فقط لتكاثر بقاء الخلية. من هذه الخلية ، التي يمكن اعتبارها كخلية جينوم صغيرة ، يمكن للمرء إضافة قطع من صندوق الأدوات لإنشاء مسار محدد جيدًا مع دوائر تركيبية مناسبة لنظام تغذية راجعة فعال. نظرًا لطريقة البناء الأساسية ، وقاعدة البيانات المقترحة لقطع الدوائر المعينة ، يمكن استخدام التقنيات التي تعكس تلك المستخدمة لنمذجة الكمبيوتر أو الدوائر الإلكترونية لإعادة تصميم الخلايا ونماذج الخلايا لسهولة استكشاف الأخطاء وإصلاحها والسلوك التنبئي والعوائد.

المذبذبات تحرير

Elowitz et al. وفونج وآخرون. دوائر تذبذبية تستخدم آليات متعددة ذاتية التنظيم لإنشاء تذبذب يعتمد على الوقت في التعبير الجيني للمنتج. [11] [12]

مفاتيح ثنائية التحرير

جاردنر وآخرون. استخدم القمع المتبادل بين وحدتي تحكم لإنشاء تنفيذ مفتاح تبديل قادر على التحكم في الخلايا بطريقة ثنائية الثبات: منبهات عابرة تؤدي إلى استجابات مستمرة. [3]

العوامل المنطقية تحرير

تحرير الموالفات التناظرية

باستخدام ردود الفعل السلبية والمروجين المتطابقين ، يمكن لدارات الجينات الخطية أن تفرض تعبيرًا جينيًا موحدًا يعتمد خطيًا على تركيز المحفز الكيميائي خارج الخلية. [15]

ضوابط عدم تجانس التعبير الجيني تحرير

يمكن لدوائر الجينات الاصطناعية التحكم في عدم تجانس التعبير الجيني ويمكن التحكم فيه بشكل مستقل عن متوسط ​​التعبير الجيني. [16]

تعديل الأنظمة الهندسية الأخرى

الأنظمة المهندسة هي نتيجة تنفيذ مجموعات من آليات التحكم المختلفة. تم تنفيذ آلية تعداد محدودة بواسطة سلسلة جينية يتم التحكم فيها بالنبض [17] وتطبيق العناصر المنطقية يتيح "البرمجة" الجينية للخلايا كما هو الحال في بحث Tabor et al. ، والذي قام بتجميع برنامج الكشف عن الحواف البكتيرية الحساسة للضوء. [18]

أدت التطورات الأخيرة في تخليق الجينات الاصطناعية والزيادة المقابلة في المنافسة داخل الصناعة إلى انخفاض كبير في الأسعار ووقت انتظار تخليق الجينات وساعدت في تحسين الأساليب المستخدمة في تصميم الدوائر. [19] في الوقت الحالي ، يتحسن تصميم الدوائر بوتيرة بطيئة بسبب التنظيم غير الكافي للتفاعلات الجينية المتعددة والنماذج الرياضية المعروفة. تتم معالجة هذه المشكلة من خلال تطبيق برامج التصميم بمساعدة الكمبيوتر (CAD) لتوفير تمثيلات الوسائط المتعددة للدوائر من خلال الصور والنصوص ولغة البرمجة المطبقة على الدوائر البيولوجية. [20] تتضمن بعض برامج CAD الأكثر شهرة GenoCAD و Clotho framework و j5. [21] [22] [23] يستخدم GenoCAD القواعد النحوية ، والتي هي إما "قواعد" مفتوحة المصدر أو "قواعد" أنشأها المستخدم والتي تشمل الجينات المتاحة والتفاعلات الجينية المعروفة لاستنساخ الكائنات الحية. يستخدم إطار كلوثو قواعد Biobrick القياسية. [20]


المواد والأساليب

مجموعات البيانات المستخدمة في التحليل

لقد أنشأنا نسختين بيولوجيتين من Ribo-Seq المكورات العنقودية الذهبية نيومان وتحميلها الإشريكية القولونية MG1655 (Ribo-Seq و GSM3455899 و TIS-Ribo-Seq المعالج بالريتابامولين و GSM3455900 (19)) و العصوية الرقيقة البيانات (Ribo-Seq و GSM872395 و GSM872397، (40)) من مستودع Gene Expression Omnibus (GEO). بيانات Ribo-Seq لـ بكتريا المكورة العنقودية البرتقالية تم تحميل Newman في GEO تحت رقم الانضمام GSE150601. بيانات قياس الطيف الكتلي لـ بكتريا المكورة العنقودية البرتقالية هم من (41) و بكتريا قولونية من (42).

Ribo-Seq من بكتريا المكورة العنقودية البرتقالية

خلايا نمت في وسط TSB (هضم بنكرياسي للكازين 17 جم / لتر ، هضم إنزيمي لفول الصويا 3 جم / لتر ، كلوريد الصوديوم 5 جم / لتر ، ك2HPO4 2.5 جم / لتر ، جلوكوز 2.5 جم / لتر ، درجة الحموضة 7.3) إلى OD550 = 1 تم حصادها عن طريق الطرد المركزي السريع ، وتعليقها في الجليد البارد 20 ملي مولار Tris lysis buffer pH 8.0 ، يحتوي على 10 ملي مولار MgCl2· 6 ح2O ، 100 ملي NH4Cl ، 0.4٪ Triton-X-100 ، 4 U DNase ، 0.4 ميكرولتر Superase-In (Ambion) ، 1 ملي كلورامفينيكول وتعطل بالتجانس (FastPrep-24 ™ ، MP Biomedicals) مع حبات زجاجية 0.5 مل (قطر 0.1 مم). 100 أ260 تعرضت وحدات جزء mRNA المرتبط بالريبوسوم لعملية الهضم التحلل النووي مع 10 وحدات / ميكرولتر من نوكلياز المكورات الدقيقة (Thermofisher) في المخزن المؤقت مع الرقم الهيدروجيني 9.2 (10 مللي مولار من درجة الحموضة 11 تحتوي على 50 ملي مولار NH4Cl ، 10 ملي MgCl2، 0.2٪ تريتون X-100 ، 100 ميكروغرام / مل كلورامفينيكول و 20 ملي كلوريد الكالسيوم2). تم استنفاد شظايا الرنا الريباسي باستخدام بكتريا المكورة العنقودية البرتقالية تم إجراء مجموعة riboPOOL rRNA oligo (siTOOLs ، ألمانيا) وإعداد المكتبة كما هو موضح سابقًا (43).

معالجة البيانات ورسم الخرائط

تم قطع قراءات التسلسل الخام باستخدام FASTX Toolkit (عتبة الجودة: 20) وتم قطع المحولات باستخدام cutadapt (الحد الأدنى من التداخل من 1 nt). تم استخدام إصدارات الجينوم التالية لرسم الخرائط: بكتريا قولونية U00096.3 ، بكتريا المكورة العنقودية البرتقالية NC_009641.1 و B. الرقيقة NC_000964.3. تم تنزيل الجينوم والشروح من NCBI (يناير 2020). في الخطوة الأولى من رسم الخرائط ، تم تجاهل القراءات التي تم تعيينها إلى الرنا الريباسي. بعد ذلك ، تم تعيين القراءات بشكل فريد للجينومات المرجعية باستخدام Bowtie (44) ، وإعدادات المعلمات: -l 16 -n 1 -e 50 -m 1-strata -best. تم تجاهل القراءات غير المعينة بشكل فريد. تم تلخيص العدد الإجمالي للقراءات المعينة في الجدول التكميلي S1.

تحديد الببتيد ل بكتريا قولونية تم إجراؤه باستخدام مجموعة البيانات PXD000498 (mascot_daemon_merge.mgf) (42) المتوفرة في PRIDE (45). لتحديد MASCOT (الإصدار 2.6) (46) بحثًا ضد مرشحي smORF (أخذ أطول smORF فقط للمرشحين الذين يتشاركون نفس كود الإيقاف) وجميع جينات تشفير البروتين (4243 تسلسلًا) وتم تنفيذ قاعدة بيانات شرك ذات الصلة باستخدام معلمات البحث مثل نشرت سابقا (42).

سير عمل smORFer

يتم تلخيص سير عمل smORFer ، الذي يتم تنفيذه بطريقة معيارية ، في الشكل 1. يتم تنفيذ عدة خطوات بسيطة للعد والتصفية باستخدام BEDTools (47) ، على سبيل المثال ORFs في المناطق غير المشروحة حيث تم إجراء التصفية حسب intersectBed وقراءة العد باستخدام coverBed. الجزء الأول من الوحدة أ مطلوب لتعريف حدود جميع ORFs المفترضة. يتم تنقيح الاختيار بشكل أكبر من خلال الخصائص الهيكلية المتأصلة في تسلسل تشفير البروتين. تضيف الوحدتان B و C مزيدًا من الثقة إلى مرشحات smORF المكتشفة ويمكن تنفيذها إما بشكل مستقل أو معًا ، حيث تزيد الأخيرة من اكتشاف smORFs الجديدة الإيجابية الحقيقية.

مخطط عام لخوارزمية smORFer بوحداتها الثلاث التي تقيم المعلومات الجينومية (الوحدة A ، الخضراء) والترجمة ودورية 3-nt في RPFs من بيانات Ribo-Seq (الوحدة B ، الأزرق) ، و TIS من TIS-Ribo-Seq ( الوحدة C ، البرتقالي).

مخطط عام لخوارزمية smORFer بوحداتها الثلاث التي تقيم المعلومات الجينومية (الوحدة A ، الخضراء) والترجمة ودورية 3-nt في RPFs من بيانات Ribo-Seq (الوحدة B ، الأزرق) ، و TIS من TIS-Ribo-Seq ( الوحدة C ، البرتقالي).

كشف ORF القائم على الجينوم (الوحدة أ)

تم إنشاء قائمة ORFs المفترضة باستخدام برنامج Perl النصي المعدل (48) ، حيث تقوم بإنشاء ORFs مفترضة مع بدء وإيقاف كودون في الإطار. استخدمنا أربعة أكواد بداية ، ATG ، GTG ، TTG ، CTG ، وهي الأكثر شيوعًا في بدائيات النوى (49) ، وكودونات التوقف الثلاثة الموحدة ، TGA ، TAG ، TAA. smORFer منفصلة smORFs بناءً على موقعهم ، على سبيل المثال في المناطق غير المشروحة والمزودة بتعليقات توضيحية ، وتحتوي أيضًا على مرشح خاص بحبلا لاختيار المنطقة.

لاكتشاف ما إذا كان SMORF المفترض يشفر الببتيدات أو البروتينات ، أي يعرض 3-nt دورية التسلسل من CDS ، وبالتالي ، من المحتمل أن تتم ترجمتها ، استخدمنا تحويل فورييه (تم تنفيذ FT كوظيفة أساسية لـ R) لمحتوى GC لكل جين واحد ، أي لكل ORF فردي ، هذا متجه من 0 و 1. يتم ضبط الإشارة أولاً على طول ORF حيث تعتمد شدة الإشارة على طول ORF. في هذا النمط الدوري 3-nt ، تكون الفترة 1.5-nt موجودة دائمًا مع الفترة 3-nt بغض النظر عن طول ORF المفترض. بعد ذلك ، نبني جزء الإشارة المقيسة في فترة 3 nt ونقسمه على المتوسط ​​الحسابي للإشارة بين الفترتين 3 nt و 1.5 nt.

الكشف عن ORFs المترجمة من بيانات Ribo-Seq بما في ذلك معالجة القراءة (الوحدة ب)

يتم أولاً تعيين بيانات Ribo-Seq ويتم تحديد smORFs بحد أدنى من خمسة RPFs وتعيينها كـ "مترجم. تغطية تعدادات 5 RPF أعلى في المتوسط ​​من خطأ العد لـ ORFs القصيرة في مجموعات بيانات Ribo-Seq (23 ، 50) ونقترح استخدامها كقطع تعسفي عندما لا تكون التكرارات البيولوجية متاحة. بخلاف ذلك ، يجب تحديد الحد الأدنى الموثوق به لعدد القراءة لكل جين بشكل فردي لكل Ribo-Seq باستخدام تحليل التباين لإحصاءات العد لنسختين بيولوجيتين مستقلتين تقوم أيضًا بتقييم تأثير احتساب الضوضاء (23 ، 43).

يخصص إجراء المعايرة لكل RPF الكودون في موقع الريبوسوم A أو P ، مما يسمح بتتبع الوتيرة الدورية للريبوسومات حسب الكودون على طول ORFs. لوضع قراءة في موقع ribosomal A أو P ، يتم وضع القراءات أولاً حسب الطول ويتم تحديد الإزاحة لكل صندوق طول للقراءة على حدة كما هو موضح ((51) تتوفر جميع البرامج النصية هنا: https://github.com/ AlexanderBartholomaeus / MiMB_ribosome_profiling). بالنسبة لمجموعات بيانات Ribo-Seq بدائية النواة ، يوصى بإجراء معايرة باستخدام 3 نهايات ، أي إلى أكواد الإنهاء ، نظرًا لأن نوكليازات المستخدمة لتوليد RPFs في البكتيريا تنشق بطريقة انتقائية متسلسلة مع اختلافات أقل إلى حد ما في الأطراف 3 (52) . تختلف توزيعات طول القراءة بين مجموعات البيانات على الأرجح بسبب البروتوكولات التجريبية المختلفة (53) ويجب مراعاة ما لا يقل عن أربعة إلى خمسة صناديق طول للقراءة. هنا ، نظرنا ل بكتريا قولونية و B. الرقيقة قراءة صناديق الطول 27-30 nt ول بكتريا المكورة العنقودية البرتقالية صناديق 24-28 nt مع إزاحة للموقع A 11 nt لـ 24-28 nt و 12 nt لـ 29-30 nt. بدلاً من ذلك ، يمكن استخدام خوارزميات أخرى تستخرج موقع A أو P من قراءات RPF. على غرار نهجنا ، يحسب Plastid (54) و RiboProfling (55) موقع P عن طريق تقسيم القراءات في صناديق وفقًا لطولها ومعالجة كل صندوق بشكل مستقل ينتج عنه إزاحات متغيرة عبر الصناديق. riboWaltz (56) ، خوارزمية R من خطوتين ، تحسب موقع P بدقة عالية باستخدام إزاحة مفردة متماسكة.

تتطلب المعايرة تغطية قراءة جيدة ، وبالتالي تعرضت smORFs ذات التغطية 100 RPFs لكل كيلو قاعدة من طول ORF (RPK) لتحليل FT لتحديد دورية 3-nt أو الكودون لملف تعريف RPF المعاير. عادةً ما ينتج عن تغطية 100 RPK (أي قراءة واحدة لكل 10 nt) تحليل FT جيد. يتم تصنيف smORFs ذات التواتر 3-nt في تغطية RPF على أنها "3-نت مترجم '. بعد ذلك ، يخضع تواتر 3-nt أو الكودون لملف تعريف RPF المُعاير لـ FT ويتم استخراج درجة من متوسط ​​الإشارة بين الفترتين 3 nt و 1.5 nt. يتم تحديد العتبة (FT & gt 2) من التوزيعات التراكمية لقيم FT لـ 2315 ORFs المشفرة بالبروتين مع ≥100 RPK. يتم تصنيف smORFs بقيمة FT أعلى من 2 ثم على أنها "3nt مترجم. smORFs مع تغطية RPF منخفضة ، والتي لا يمكن تحديد إشارة دورية 3-nt في ملفات تعريف RPF ، يتم فرزها على أنها "مترجم". لاحظ أن "مترجم" يجب أيضًا الاحتفاظ بـ smORFs لأنها يمكن أن تكون نجاحًا حقيقيًا ، لكن مستويات الترجمة المنخفضة نسبيًا ، مع عدد قليل فقط من RPFs ، تمنع المعايرة وتحليل FT.

الكشف عن TIS (الوحدة C)

يتم تنفيذ Ribo-Seq في وجود مثبط بدء الترجمة هنا ، لـ بكتريا قولونية تم استخدام الريتابامولين (19). تمت معالجة TIS-Ribo-Seq بنفس طريقة معالجة Ribo-Seq. يتم استخراج النيوكليوتيدات الوسطى لكل RPF واستخدامها في مزيد من التحليل في حالة حتى طول القراءة ، يتم أخذ 3 نيوكليوتيد من النصف الأول من RPF (51). وتجدر الإشارة إلى أن القراءات من TIS-Ribo-Seq لا يمكن معايرتها ، نظرًا للتغطية المنحرفة عند البدء ونقص التغطية عند الإنهاء ، فإن هذا الأخير يمنع المعايرة في كل من كودونات البدء والإيقاف (51). علاوة على ذلك ، فإن التخصيص اليدوي للإزاحة غير ممكن ، لأن retapamulin يرتبط بمركز peptidyl-transferase في كل من وجود وغياب البادئ fMet-tRNA (19 ، 57 ، 58) ، وبالتالي طمس تخصيص موقع P على مدى اثنين على الأقل مواقف الكودون. لكل SMORF ، يتم حساب TIS للنيوكليوتيدات المتوسطة على النيوكليوتيدات الثلاثة لكودون البدء ويتم تلخيص كودون واحد في المنبع والمصب من البداية ويتم تصنيف ORFs التي تحتوي على أكثر من 5 RPFs على أنها تحتوي على TIS حقيقي.

نظام التشغيل وإصدارات R والنصوص والأمثلة

استخدمنا Ubuntu 18.04 LTS كنظام تشغيل. لتحليل البيانات والتصور ، استخدمنا R (3.5.0) بما في ذلك حزم seqinr (3.6-1) و Biostrings (2.50.2) المتوفرة في جميع أنظمة التشغيل. البرامج النصية والمكالمات والملفات النموذجية (باستثناء ملفات BAM بسبب حجمها الكبير) لاستخدام smORFer بكتريا قولونية تتوفر مجموعات البيانات على https://github.com/AlexanderBartholomaeus/smORFer.


النتائج

تعتمد طرق التجميع الموجه بالتداخل على 20-50 نقطة أساس من التسلسل المشترك بين أجزاء الحمض النووي التي تلتصق ، اعتمادًا على الطريقة الدقيقة المستخدمة (9). اقترح البحث أن الحد الأدنى من 40 نقطة أساس مطلوب للتجميع الفعال عن طريق إعادة التركيب المتماثل للخميرة ، وأن طولًا مماثلًا من الحمض النووي هو الأمثل لطريقة تجميع جيبسون (26 ، 43 ، 44). لتمكين معيار MODAL الخاص بنا من التوافق مع Gibson و CPEC وتجميع الخميرة ، اخترنا 45 نقطة أساس لتكون طول مناطق التداخل لدينا ، والتي نسميها الروابط وتعمل بمثابة "نهايات إرشادية" في تفاعلات التجميع. لتكون قادرًا على ربط هذه الأجزاء بسهولة بأي جزء من الحمض النووي باستخدام بروتوكول قياسي ، يجب أن تمر الأجزاء بعملية توحيد لمرة واحدة. يتكون هذا من PCR حيث يتم تضخيم جزء الحمض النووي من أي مصدر (أي DNA البلازميد أو الجينوم) باستخدام الاشعال الخاص بالجزء الذي يحتوي على متواليات "محول" 15-bp (الشكل 1A). هذان التسلسلان (محول البادئة ومحول اللاحقة) عالميان ويحيطان بأجزاء الحمض النووي بعد التضخيم. لاحظ أنه يمكن استبدال هذه الخطوة بتوليف الحمض النووي المباشر. يمكن بعد ذلك ربط الوصلات الطرفية التوجيهية بأي جزء من الحمض النووي باستخدام PCR موحد: يستخدم هذا مواد أولية من مجموعة من البادئات العامة القابلة لإعادة الاستخدام (مجموعة الروابط) ، والتي تصلب إلى تسلسلات المحول وتشفر روابط النهاية التوجيهية (الشكل 1 أ) . يتم تحديد موضع أجزاء الحمض النووي في التركيبات النهائية بواسطة الوصلات ، لأنها توجه تفاعل التجميع: على سبيل المثال ، إذا كان التجميع المطلوب هو الجزء A متبوعًا بالجزء B ، فسيتم تضخيم A باستخدام التمهيدي العكسي الذي هو عكس تكملة لتسلسل الرابط بالإضافة إلى تسلسل محول اللاحقة ، ويتم تضخيم B باستخدام التمهيدي الأمامي ، أي تسلسل الرابط بالإضافة إلى تسلسل محول البادئة. ومع ذلك ، إذا تم عكس الترتيب المطلوب (أي الجزء B متبوعًا بالجزء A) ، يتم تبديل الاشعال المستخدمة لتضخيم الأجزاء حولها ، بحيث يتم تضخيم B باستخدام التمهيدي العكسي المذكور أعلاه ويتم تضخيم A باستخدام التمهيدي الأمامي.

يمكن أن يؤدي التجميع الموجه للتداخل لأجزاء الحمض النووي عن طريق إضافة تسلسلات رابط معيارية إلى تمكين التجميع القياسي للجينات في أوامر وتوجهات مختلفة بدون تأثيرات السياق. (أ) رسم تخطيطي لاستراتيجية مودال. باستخدام PCR الأولي ، يتم تضخيم أجزاء الحمض النووي المحددة من مصدرها لتكون محاطة بتسلسلات محول 15-bp محددة (P = محول البادئة ، S = محول اللاحقة) ، والتي يمكن بعد ذلك استنساخها وتخزينها والتحقق من تسلسلها في ناقل pJET. يتم بعد ذلك إضافة متواليات الوصلة (المرقمة من 1 إلى 4) 5 و 3 من المحولات بواسطة PCR وتوجيه تجميع التداخل بوساطة التماثل إلى بلازميدات أو تركيبات أخرى. يُظهر التشعب في الرسم التخطيطي مثالاً على كيفية تغيير الروابط التي تمت إضافتها إلى الجزء أ والجزء ب يغير ترتيبها في البناء النهائي. (ب) استخدام مجموعة واحدة من أربعة وصلات عشوائية 45 نقطة أساس وأربعة موحد بكتريا قولونية أجزاء (تعبير GFP التأسيسي ، تعبير RFP التأسيسي ، مقاومة كاناميسين وأصل pUC للنسخ المتماثل) ، تم استخدام تجميع Gibson لبناء البلازميدات بأجزاء في مجموعة متنوعة من الأوامر. لم يُظهر تعبير GFP و RFP لكل خلية كما تم قياسه بواسطة قياس التدفق الخلوي تباينًا كبيرًا عندما تم خلط الأجزاء إلى مواضع مختلفة في البلازميد واحتوت على تسلسلات رابط مختلفة في المنبع والمصب للجينات. تم حساب متوسط ​​التألق لكل خلية من متوسط ​​FL1 (GFP) وقياسات FL5 (RFP) (ن = 5). تشير أشرطة الخطأ إلى الخطأ المعياري.

يمكن أن يؤدي التجميع الموجه للتداخل لأجزاء الحمض النووي عن طريق إضافة تسلسلات رابط معيارية إلى تمكين التجميع القياسي للجينات في أوامر وتوجهات مختلفة بدون تأثيرات السياق. (أ) رسم تخطيطي لاستراتيجية مودال. باستخدام PCR الأولي ، يتم تضخيم أجزاء الحمض النووي المحددة من مصدرها لتكون محاطة بتسلسلات محول 15-bp محددة (P = محول البادئة ، S = محول اللاحقة) ، والتي يمكن بعد ذلك استنساخها وتخزينها والتحقق من تسلسلها في ناقل pJET. يتم بعد ذلك إضافة متواليات الوصلة (المرقمة من 1 إلى 4) 5 و 3 من المحولات بواسطة PCR وتوجيه تجميع التداخل بوساطة التماثل إلى بلازميدات أو تركيبات أخرى. يُظهر التشعب في الرسم التخطيطي مثالاً على كيفية تغيير الروابط التي تمت إضافتها إلى الجزء أ والجزء ب يغير ترتيبها في البناء النهائي. (ب) استخدام مجموعة واحدة من أربعة وصلات عشوائية 45 نقطة أساس وأربعة موحد بكتريا قولونية أجزاء (تعبير GFP التأسيسي ، تعبير RFP التأسيسي ، مقاومة كاناميسين وأصل pUC للنسخ المتماثل) ، تم استخدام تجميع Gibson لبناء البلازميدات بأجزاء في مجموعة متنوعة من الأوامر. لم يُظهر تعبير GFP و RFP لكل خلية كما تم قياسه بواسطة قياس التدفق الخلوي تباينًا كبيرًا عندما تم خلط الأجزاء إلى مواضع مختلفة في البلازميد واحتوت على تسلسلات رابط مختلفة في المنبع والمصب للجينات. تم حساب متوسط ​​التألق لكل خلية من متوسط ​​FL1 (GFP) وقياسات FL5 (RFP) (ن = 5). تشير أشرطة الخطأ إلى الخطأ المعياري.

للتخفيف من الأخطاء التي تحملها PCR ، اتخذنا ثلاث خطوات: (1) تم إجراء جميع PCRs باستخدام بوليميريز DNA عالي الدقة ، (2) تم استنساخ الأجزاء المعيارية التي تم إنشاؤها في PCR الخطوة 1 في ناقل pJET والتحقق من التسلسل قبل المزيد من الاستخدام ، و (3) لم يتجاوز عدد الدورات في الخطوة 2 PCR 25 دورة.

تتيح تسلسلات التداخل المعيارية إمكانية التجميع في وعاء واحد للبنى متعددة الجينات ذات السياقات المتغيرة

للتحقق من صحة نهجنا ، أخذنا مجموعة من أربعة أجزاء من الحمض النووي على مستوى الجينات وأنشأنا مكتبة أولية صغيرة من بادئات MODAL لتجميعها. تتطلب أربعة أجزاء تجميع أربعة روابط ، لذلك قمنا بإنشاء ثمانية بادئات 60 مير: يتكون كل جهاز تمهيدي أمامي من تسلسل رابط نهاية توجيهي مكون من 45 قاعدة متبوعًا بتسلسل محول بادئة مكون من 15 قاعدة ، ويتكون كل أساس عكسي من تكملة عكسية من تسلسل الرابط متبوعًا بمحول اللاحقة ذو 15 قاعدة. تم إنشاء تسلسلات الرابط بشكل عشوائي بحيث تحتوي على 50٪ من محتوى GC فوق منطقة التداخل 45-bp. باستخدام استراتيجية MODAL (الشكل 1 أ) مع طريقة تجميع جيبسون ذات وعاء واحد ، أنشأنا بكتريا قولونية ترميز البلازميدات التأسيسية GFP و RFP ، وتكرار الحمض النووي ومقاومة الكاناميسين. سمحت طريقتنا لنفس المواد الأولية بدمج الأجزاء الأربعة على مستوى الجينات في بلازميدات وظيفية لها جيناتها في مجموعة متنوعة من الأوامر والتوجهات المختلفة. لتحديد ما إذا كانت تسلسلات الروابط الاصطناعية الخاصة بنا تنقل أي تأثيرات خاصة بالسياق (أي تعديل التعبير الجيني المحلي) ، حددنا أيضًا إخراج GFP و RFP من البلازميدات التي تم إنشاؤها من أجزاء في أوامر مختلفة. كشف التحديد الكمي لـ GFP و RFP عن تعبير جيني موثوق به بشكل ملحوظ بغض النظر عن السياق المحلي ووجود مناطق الرابط (الشكل 1 ب). وبالتالي ، فإن استراتيجية MODAL لا تتيح فقط إعادة ترتيب وتوجيه الجينات داخل البنى بسرعة ، ولكن التسلسلات التركيبية التي تشفر المحولات والروابط كانت جيدة التحمل بين أجزاء الحمض النووي على مستوى الجينات (أي عندما تكون متداخلة بين الجينات).

مع محول البادئة ومحول اللاحقة ووصلات 45-bp ، يترك نهجنا المعياري 75 نقطة أساس من الحمض النووي الاصطناعي بين الأجزاء. في حين أن هذا قد يكون مقبولًا على المستوى الجيني لتجميع الحمض النووي ، فمن غير المرجح أن تكون مثل هذه التسلسلات الطويلة محايدة تمامًا عند وضعها بين أجزاء مستوى الجين الفرعي التي تشكل وحدات التعبير الجيني ، مثل المحفزات ، والمناطق غير المترجمة 5 والقراءة المفتوحة الإطارات (ORFs). لقد أكدنا ذلك من خلال إنشاء سلسلة من أشرطة التعبير ثنائية الاتجاه التي تتكون من مروج و GFP و RFP وتقييم مستويات التعبير GFP و RFP النسبية عند استخدام روابط مختلفة. ليس من المستغرب أن يختلف التعبير الجيني بشكل كبير اعتمادًا على الروابط المختارة وترتيب المكبس (الشكل التكميلي S2). من المحتمل أن يكون هذا الاعتماد على السياق بسبب الاختلافات في طي الحمض النووي الريبي المحلي داخل النصوص ، وتعديل كفاءات عناصر مثل تسلسل موقع ربط الريبوسوم (RBS) (45) وضبط استقرار الرنا المرسال.

مصمم R2oDNA: برنامج عبر الإنترنت لتصميم تسلسل رابط متعامد لتجميع الحمض النووي الموجه بالتداخل

أظهرت هذه التجارب الأولية إمكانية توحيد تجميع الحمض النووي الموجه بالتداخل. ومع ذلك ، عند تجميع البلازميدات في الشكل 1 ب ، ما يقرب من نصف المستعمرات إما لم تعبر عن أي GFP أو RFP ، أو عبرت فقط عن مراسل فلورسنت واحد. يعكس هذا خبرتنا الأوسع في تجميع جيبسون على مستوى البلازميد ، حيث نرى اختلافات كبيرة في الكفاءة اعتمادًا على الأجزاء التي يتم تجميعها. لذلك اخترنا تطوير أداة برمجية ، R2oDNA Designer ، كوسيلة لاختبار القيود المطلوبة للتجميع الفعال للحمض النووي ولتسهيل توليد تسلسلات DNA المتعامدة المناسبة للتداخل. عند القيام بذلك ، أدركنا أن أي DNA يمكن أن يحتوي على متواليات تجعلها غير فعالة لطرق تجميع الحمض النووي المتداخلة (مثل تشغيل polyA أو التسلسلات التي تشكل دبابيس شعر قوية عندما تقطعت بهم السبل) ، أو يمكن أن تحتوي على تسلسلات إنزيم التقييد التي تعيق المعالجة النهائية المخطط لها. بالإضافة إلى ذلك ، يمكن أن تكون بعض تسلسلات الحمض النووي ضارة بالوظيفة البيولوجية للنظام (مثل مواقع ربط عامل النسخ) أو للمضيف عبر إعادة التركيب المتماثل غير المتوقع مع الجينوم.

لمعالجة هذه المشكلات ، تم تصميم R2oDNA Designer لإنشاء تسلسلات DNA اصطناعية بطول محدد وتكوين مناسب لتجميع التداخل ويمكن أن يستبعد التسلسلات المحظورة المحددة مسبقًا. يستخدم البرنامج MCSA لأخذ عينات عشوائية من مساحة تسلسل الحمض النووي وتسجيل التسلسلات التي تم إنشاؤها ، متقاربة على مجموعة تفي بالمعايير المحددة للطول المحدد مسبقًا ومحتوى GC أو درجة حرارة الانصهار (الشكل 2A). تتم مقارنة هذه التسلسلات مع تسلسل الجينوم لقائمة الكائنات الحية المقدمة (استخدمنا هنا بكتريا قولونية, S. cerevisiae و بacillus subtilis) باستخدام خوارزمية بلاست (41) ، للتخلص من أي مادة يمكن أن تتداخل مع متواليات الكروموسومات. أخيرًا ، تتم بعد ذلك مقارنة جميع التسلسلات المتبقية مع بعضها البعض باستخدام خوارزمية استبعاد الشبكة لإزالة أي منها قد يؤدي إلى التصلب المتقاطع وبالتالي لن يكون متعامدًا ومناسبًا للتجميع أحادي الوعاء المحدد.

R2oDNA Designer هي أداة برمجية عبر الإنترنت لتصميم تسلسلات الوصلات الاصطناعية لاستراتيجية MODAL. (أ) نظرة عامة إلى العملية. يتم إنشاء مجموعة أولية من التسلسلات العشوائية التي تتوافق مع متطلبات المستخدم الأساسية (قيود النوكليوتيدات الخاصة بالطول والموضع). ثم يتم تحسينها باستخدام MCSA باستخدام وظيفة التسجيل التي تعاقب (1) الهياكل الثانوية للحمض النووي أحادية السلسلة ، (2) الأشكال المتسلسلة المحظورة بما في ذلك مواقع إنزيمات التقييد ، (3) الزخارف الوظيفية مثل تسلسلات ربط الريبوسوم و (4) تسلسل عنصر الإدراج ، (5) التلدين الذاتي غير المرغوب فيه و (6) محتوى GC أو T.م. يتم تحسين جميع التسلسلات التي تحتوي على أشكال ممنوعة أو هياكل ثانوية متوسطة إلى قوية أو ذاتية التلدين. يتم التخلص من أي تسلسلات ذات ضربات كبيرة في الجينوم المحدد. أخيرًا ، تتم إزالة أي تسلسلات متبقية تتداخل مع بعضها البعض باستخدام خوارزمية إزالة الشبكة. (ب) تظهر واجهة مستخدم R2oDNA Designer. يمكن للمستخدمين إدخال طول الرابط ومتطلبات التسلسل والتفضيلات لمحتوى GC أو درجة حرارة الانصهار في النافذة الأولى. يمكن تعديل قائمة التسلسلات والجينومات المحظورة للمقارنة معها في نافذة الإعدادات المتقدمة.

R2oDNA Designer هي أداة برمجية عبر الإنترنت لتصميم تسلسلات الوصلات الاصطناعية لاستراتيجية MODAL. (أ) نظرة عامة إلى العملية. يتم إنشاء مجموعة أولية من التسلسلات العشوائية التي تتوافق مع متطلبات المستخدم الأساسية (قيود النوكليوتيدات الخاصة بالطول والموضع). ثم يتم تحسينها باستخدام MCSA باستخدام وظيفة التسجيل التي تعاقب (1) الهياكل الثانوية للحمض النووي أحادية السلسلة ، (2) الأشكال المتسلسلة المحظورة بما في ذلك مواقع إنزيمات التقييد ، (3) الزخارف الوظيفية مثل تسلسلات ربط الريبوسوم و (4) تسلسل عنصر الإدراج ، (5) التلدين الذاتي غير المرغوب فيه و (6) محتوى GC أو T.م. يتم تحسين جميع التسلسلات التي تحتوي على أشكال ممنوعة أو هياكل ثانوية متوسطة إلى قوية أو ذاتية التلدين. يتم التخلص من أي تسلسلات ذات ضربات كبيرة في الجينوم المحدد. أخيرًا ، تتم إزالة أي تسلسلات متبقية تتداخل مع بعضها البعض باستخدام خوارزمية إزالة الشبكة. (ب) تظهر واجهة مستخدم R2oDNA Designer. يمكن للمستخدمين إدخال طول الرابط ومتطلبات التسلسل والتفضيلات لمحتوى GC أو درجة حرارة الانصهار في النافذة الأولى. يمكن تعديل قائمة التسلسلات والجينومات المحظورة للمقارنة معها في نافذة الإعدادات المتقدمة.

يسمح برنامج R2oDNA Designer ، المتاح مجانًا عبر الإنترنت على الموقع http://www.r2odna.com ، للمستخدم بالاختيار من مجموعة من التسلسلات المحظورة الافتراضية (الجدول التكميلي S3) أو تحميله (الشكل 2 ب). وبالمثل ، يمكن تخصيص قائمة تسلسلات الجينوم التي تتم مقارنة التسلسلات التركيبية بها. ميزة أخرى للبرنامج هي القدرة على تسجيل التسلسلات الحالية من أجل "قبولها" لاستخدامها كرابط تداخل. يتم توفير مزيد من التفاصيل حول البرنامج وميزاته في المواد التكميلية.

تتيح تسلسلات التداخل المصممة تجميع DNA معياري فعال بوعاء واحد من خلال مجموعة متنوعة من التقنيات

لتوضيح كيف يمكن لتسلسلات الرابط التي تم إنشاؤها بواسطة R2oDNA Designer تحسين كفاءة الاستنساخ للبلازميدات المعيارية لمجموعة متنوعة من طرق تجميع الحمض النووي ذات وعاء واحد ، قمنا باختبار كفاءة تجميع الحمض النووي لاثنين من البلازميدات المكونة من 4 أجزاء: بكتريا قولونية البلازميد بشكل أساسي معربا عن GFP و RFP و S. cerevisiae 2-μ بلازميد أيضًا يعبر بشكل أساسي عن متغيرات GFP و RFP (yEGFP و mCherry ، على التوالي ، انظر الشكل 1B والشكل التكميلي S1). تجميع الحمض النووي لـ بكتريا قولونية تم اختبار البلازميد باستخدام طرق تجميع جيبسون وطرق CPEC ، وتحويل منتجات التجميع إلى DH10B بكتريا قولونية وقياس كفاءة التجميع كنسبة مئوية من المستعمرات التي كانت حمراء وخضراء عند مسحها ضوئيًا من أجل التألق (الشكل 3 أ). تم اختبار تجميع الحمض النووي لبلازميد الخميرة باستخدام التجميع المباشر في الخميرة (في الجسم الحي إعادة التركيب) ، وتحويل الأجزاء المعيارية إلى YPH500 S. cerevisiae وقياس كفاءة التجميع كنسبة مئوية من المستعمرات التي كانت حمراء وخضراء عند مسحها ضوئيًا بحثًا عن التألق.

تقييم الوصلات المصممة المستخدمة في استراتيجية MODAL مع Gibson و CPEC و S. cerevisiae طرق تجميع الحمض النووي إعادة التركيب. (أ) لتقييم تسلسل رابط معياري ، تم تجميع أربعة أجزاء بواسطة تجميع Gibson في تعبير GFP و RFP ترميز بلازميد ، باتباع المخطط الموضح في الشكل 1 أ. درهم 10 ب بكتريا قولونية تم تحويلها مع تفاعلات التجميع ونمت على لوحات أجار LB + كاناميسين بين عشية وضحاها ثم تم مسحها ضوئيًا بحثًا عن التألق الأخضر والأحمر في اليوم التالي. تكرر هذا ثلاث مرات في أيام منفصلة ، ويتم عرض مجموعة واحدة هنا. تم إجراء التجميع باستخدام ست مجموعات روابط مختلفة: عشوائية ، مصممة بمحتوى 40٪ GC ، مصممة بمحتوى 50٪ GC ، مصممة بمحتوى 40٪ GC ، وظيفية وبدون آثار. يعطي التجميع الصحيح المستعمرات تظهر باللون الأصفر بسبب التألق الأخضر والأحمر المتزامن. (ب) تم حساب العدد الإجمالي للمستعمرات والنسبة المئوية لتلك التي تحتوي على بلازميدات مجمعة بشكل صحيح ("الدقة") من تحليل الصور لكل لوحة لتجمعات الحمض النووي باستخدام تسلسلات رابط مختلفة وباستخدام جيبسون ، و CPEC و S. cerevisiae طرق تجميع الحمض النووي إعادة التركيب. مقابل بكتريا قولونية تم استخدام الأجزاء والخلايا المختصة لـ Gibson و CPEC (ن = 3) ولكن من أجل S. cerevisiae التجميع ، تم استخدام خلايا YPH500 وأجزاء الحمض النووي المشفرة yEGFP التأسيسية و mCherry RFP ، واختيار uracil وأصل 2-plasmid (ن = 2). تشير أشرطة الخطأ إلى الخطأ المعياري. (ج) رسم تخطيطي يوضح الفرق بين عملية التجميع والمناطق الجينية المتكونة من إستراتيجية MODAL والتجميع بدون ترك آثار.

تقييم الوصلات المصممة المستخدمة في استراتيجية MODAL مع Gibson و CPEC و S. cerevisiae طرق تجميع الحمض النووي إعادة التركيب. (أ) لتقييم تسلسل رابط معياري ، تم تجميع أربعة أجزاء بواسطة تجميع Gibson في تعبير GFP التأسيسي و RFP ترميز البلازميد ، باتباع المخطط الموضح في الشكل 1 أ. درهم 10 ب بكتريا قولونية تم تحويلها مع تفاعلات التجميع ونمت على لوحات أجار LB + كاناميسين بين عشية وضحاها ثم تم مسحها ضوئيًا بحثًا عن التألق الأخضر والأحمر في اليوم التالي. تكرر هذا ثلاث مرات في أيام منفصلة ، ويتم عرض مجموعة واحدة هنا. تم إجراء التجميع باستخدام ست مجموعات روابط مختلفة: عشوائية ، مصممة بمحتوى 40٪ GC ، مصممة بمحتوى 50٪ GC ، مصممة بمحتوى 40٪ GC ، وظيفية وبدون آثار. يعطي التجميع الصحيح المستعمرات تظهر باللون الأصفر بسبب التألق الأخضر والأحمر المتزامن. (ب) تم حساب العدد الإجمالي للمستعمرات والنسبة المئوية لتلك التي تحتوي على بلازميدات مجمعة بشكل صحيح ("الدقة") من تحليل الصور لكل لوحة لتجمعات الحمض النووي باستخدام تسلسلات رابط مختلفة وباستخدام جيبسون ، و CPEC و S. cerevisiae طرق تجميع الحمض النووي إعادة التركيب. مقابل بكتريا قولونية تم استخدام الأجزاء والخلايا المختصة لـ Gibson و CPEC (ن = 3) ولكن من أجل S. cerevisiae التجميع ، تم استخدام خلايا YPH500 وأجزاء الحمض النووي المشفرة yEGFP التأسيسية و mCherry RFP ، واختيار uracil وأصل 2-plasmid (ن = 2). تشير أشرطة الخطأ إلى الخطأ المعياري. (ج) رسم تخطيطي يوضح الفرق بين عملية التجميع والمناطق الجينية المتكونة من إستراتيجية MODAL والتجميع بدون ترك آثار.

تم تقييم أربع مجموعات مختلفة من الروابط التي تم إنشاؤها بواسطة مصمم R2oDNA لتجميع Gibson لـ بكتريا قولونية بلازميد ، بمقارنتها بتجميع جيبسون القياسي المفصل الذي ينتج منتجًا سلسًا ("سكارلس") والروابط التي يتم إنشاؤها عشوائيًا ، كما هو مستخدم في الشكل 1 ("عشوائي"). تم أيضًا تقييم مجموعتين من الروابط الأربعة من أجل CPEC والتجميع المباشر في الخميرة. تتألف المجموعات الأربع من ثلاث مجموعات مصممة بواسطة عمليات تشغيل نموذجية لمصمم R2oDNA ، مع 40 و 50 و 60 ٪ من محتوى GC المحدد أثناء عملية التصميم (انظر الجدول التكميلي S3 لمعلمات التصميم). تم تصميم المجموعة الرابعة ، "الوظيفية" ، لتوضح مشاكل النهج المقترح سابقًا حيث يتم ترميز الأجزاء الوظيفية القصيرة ضمن تسلسل مناطق التداخل (26). تم اختيار هذه المجموعة المكونة من أربعة متواليات رابط ، وهي ترميز مروج ، وفاصل ، وتسلسل علامة ببتيد وموقع RNAse III ، باستخدام قدرة R2oDNA Designer على تسجيل التسلسلات الموجودة لملاءمتها لاستخدامها كروابط ، والتي تم وصفها بمزيد من التفصيل في المواد التكميلية. لجميع تفاعلات التجميع ، تم تصميم منطقة التداخل لتكون 45 نقطة أساس.

جميع ردود فعل تجميع جيبسون للأجزاء الأربعة بكتريا قولونية أعطى البلازميد عددًا كبيرًا من المستعمرات لكل تحويل باستثناء اثنين: عندما تم استخدام الروابط المصممة مع 60 ٪ من محتوى GC ومع الروابط الوظيفية (الشكل 3 ب). نظرًا لضعف الملاءمة للتجميع المتداخل للروابط الوظيفية (كما تم تقييمها بواسطة برنامجنا) ، فليس من المستغرب أنها كانت غير فعالة ، ومع ذلك ، فقد فوجئنا أن 60٪ من الروابط المصممة من GC كان أداءها سيئًا أيضًا. إن تكرار تجميع الحمض النووي هذا ولكن باستخدام مجموعة أخرى من أربعة متواليات رابط أخرى مصممة بحيث تحتوي على 60٪ من محتوى GC لم يغير عدد المستعمرات لكل تحويل ، مما يدل على أن الكفاءة المنخفضة لم تكن سمة محددة لواحد أو أكثر من التسلسلات المستخدمة كحلقة وصل.

شوهدت أعلى دقة لتجميع Gibson ، مع أكبر نسبة من النسخ الصحيحة ، مع إستراتيجية MODAL مع وصلات GC بنسبة 40٪. ولَّد التجمع عديم الندبات العديد من المستعمرات ، لكن نسبة كبيرة منها أظهرت بروتينًا فلوريًا واحدًا فقط. من المحتمل أن يكون هذا بسبب التجميع غير الصحيح الموجه عن طريق التماثل الجزئي بين متواليات المروج والمنهي لأجزاء ترميز GFP و RFP (الشكل 3C).

بعد أن قررنا أن 40٪ من روابط GC المصممة بواسطة R2oDNA Designer أعطت أعلى دقة لتجميع Gibson وأن 60٪ من وصلات GC كانت مشكلة ، قمنا بعد ذلك بفحص ما إذا كانت هذه الملاحظات موجودة أيضًا لطريقتين أخريين تستخدمان بشكل متداخل للتجميع الموجه ، وهما CPEC والتجميع المباشر في الخميرة. بالنسبة إلى CPEC ، أعطت كل من وصلات GC بنسبة 40 و 60٪ نسبة عالية (85٪) من المستعمرات الصحيحة ولكن أعدادًا أقل بكثير من المحولات مقارنة بتجميع جيبسون. في هذه الحالة ، تم الحصول على مستعمرات أكثر بشكل ملحوظ باستخدام وصلات GC 60٪ مقارنة مع 40٪ روابط GC (الشكل 3 ب). بالنسبة للتجميع المباشر في الخميرة ، أعطت كل من وصلات GC بنسبة 40 و 60٪ دقة بنسبة 100٪ ، مما يعني أن كل مستعمرة كانت مرئية كتجميع صحيح في كل مرة تتكرر فيها التجربة. على عكس CPEC ، ولكن كما هو الحال مع Gibson ، كانت وصلات GC بنسبة 40 ٪ مفضلة على روابط GC بنسبة 60 ٪ ، مما أدى إلى إنتاج مستعمرات أكثر بشكل كبير (الشكل 3 ب). من المثير للاهتمام ملاحظة أن وصلات GC بنسبة 60٪ مفضلة من خلال طريقة التجميع التي تحدث بالدوران في درجات حرارة عالية (60 درجة مئوية) (CPEC) ، بينما تُفضل وصلات GC بنسبة 40٪ عندما يكون تفاعل التجميع متساوي الحرارة ويتم إجراؤه عند درجات حرارة منخفضة.

يسمح PCR المطفّر داخل MODAL بالبناء السريع للمكتبات مع تنوع يستهدف أجزاء معينة

تسمح إستراتيجية MODAL الخاصة باستخدام PCR لتوصيل الأجزاء المعيارية بمجموعات الوصلات المصممة تقريبًا باستخدام أي تسلسل قابل للتضخيم ضمن نهج التجميع الخاص بنا ، والذي يتناقض مع العديد من التقنيات المعتمدة على إنزيم التقييد [مثل GoldenBraid (46) و BioBricks (17) ] ، التي تحدد أن بعض التسلسلات يجب أن تكون غائبة عن الأجزاء. بينما نحافظ عادةً على PCR لعدد قليل من الدورات ونستخدم بوليميراز عالي الدقة لتجنب حدوث أخطاء في الأجزاء ، فمن السهل أيضًا في هذه المرحلة استبدال PCR عالي الدقة بـ PCR لواحد أو أكثر من الأجزاء المحددة من a بناء لتكون متنوعة (35 ، 47). مع تعديل طفيف فقط ، يصبح نهجنا طريقة سريعة لإنشاء مكتبات بناء ضمن عملية تجميع الحمض النووي.

لإثبات هذا الاختلاف في إستراتيجيتنا MODAL ، قمنا بتعديل تصميم بلازميد تعبير GFP و RFP المكون من أربعة أجزاء ، بحيث تم تقسيم المروج التأسيسي لـ GFP (مروج ADH1) ومنطقة GFP المنسوخة ومعالجتها على أنها جزأين معياريين منفصلين ، مما يعني أن تصميمنا كان الآن عبارة عن مجموعة بلازميد مكونة من خمسة أجزاء باستخدام خمسة سلاسل وصلات GC بنسبة 40٪. تم إجراء تجميع الحمض النووي مباشرة في الخميرة كما كان من قبل ، ولكن أثناء عملية تفاعل البوليميراز المتسلسل (PCR) لإضافة مناطق الوصلة إلى الأجزاء ، قمنا بتضخيم جزء محفز ADH1 في تفاعلين مختلفين بالتوازي مع تفاعل قياسي باستخدام بوليميراز عالي الدقة ، وتفاعل مطفر ، محسن إلى دمج ∼ 10 طفرات لكل 100 نقطة أساس (الشكل 4 أ). لفحص كفاءة هذا النهج في إنشاء مكتبات بسرعة ، اخترنا أربع مستعمرات من التجمع غير المتحور و 52 مستعمرة من التجمع المتحور. نمت هذه المستعمرات بين عشية وضحاها في وسائط سائلة ثم تميزت بتعبير GFP و RFP باستخدام قياس التدفق الخلوي ثنائي اللون. شوهد تعبير GFP لكل بلازميد يختلف اختلافًا كبيرًا بين المستعمرات المختارة من تجميع PCR المطفر ، لكنه ظل ثابتًا بين المستعمرات من التجميع القياسي (الشكل 4B ، أقحم). من التجميع المسبب للطفرات ، اخترنا مكتبة تضم 20 من محفزات ADH1 المتحولة التي أعطت مجموعة متنوعة من مخرجات GFP المختلفة. كررنا توصيفهم في ثلاث نسخ وحددنا متواليات النيوكليوتيدات الخاصة بهم (الشكل 4 ب والجدول التكميلي S4). وهكذا ، ضمن الخطوات البسيطة لاستراتيجيتنا MODAL ، تمكنا من توجيه الطفرات إلى جزء محدد في البناء النهائي وإنشاء مكتبة مروج الخميرة التأسيسية المفيدة لمشاريع البيولوجيا التركيبية والهندسة الأيضية (47 ، 48).

يتيح دمج الطفرة في عملية استراتيجية MODAL الإنشاء السريع لمكتبات الإنشاء. (أ) بالإضافة إلى إجراء التجميع القياسي ، يمكن أيضًا تغيير الأجزاء المحددة بسهولة كجزء من سير عمل التجميع عن طريق إضافة نظائر النيوكليوتيدات في تضخيم PCR الذي يضيف مناطق الرابط ، كما في المخطط المعروض. يستخدم تفاعل البوليميراز المتسلسل المطوّر (35) dPTP و 8-oxo-dGTP لإساءة دمج نسبة عالية من أخطاء التسلسل في تفاعل البوليميراز المتسلسل. (ب) ينتج عن التجميع المباشر لبلازميد معياري مكون من خمسة أجزاء في الخميرة مع حدوث طفرة مطبقة على جزء محفز ADH1 مئات من مستعمرات الخميرة التي تعرض مستويات مختلفة من التعبير GFP. يسمح الفحص الأولي لـ 52 مستعمرة عن طريق قياس التدفق الخلوي (داخلي) بمكتبة متدرجة من 20 مروج ADH1 متحولة (A1 – A20) ليتم اختيارها تغطي 3 أوامر من نطاق التعبير عن الحجم ، أعلى وأسفل المخرجات التي يوفرها مروج ADH1 غير المعتم ( ADH). تشير أشرطة الخطأ إلى الخطأ المعياري (ن = 3).

يتيح دمج الطفرة في عملية استراتيجية MODAL الإنشاء السريع لمكتبات الإنشاء. (أ) بالإضافة إلى إجراء التجميع القياسي ، يمكن أيضًا تغيير الأجزاء المحددة بسهولة كجزء من سير عمل التجميع عن طريق إضافة نظائر النيوكليوتيدات في تضخيم PCR الذي يضيف مناطق الرابط ، كما في المخطط المعروض. يستخدم تفاعل البوليميراز المتسلسل المطوّر (35) dPTP و 8-oxo-dGTP لإساءة دمج نسبة عالية من أخطاء التسلسل في تفاعل البوليميراز المتسلسل. (ب) ينتج عن التجميع المباشر لبلازميد معياري مكون من خمسة أجزاء في الخميرة مع حدوث طفرة مطبقة على جزء محفز ADH1 مئات مستعمرات الخميرة التي تعرض مستويات مختلفة من التعبير GFP. يسمح الفحص الأولي لـ 52 مستعمرة عن طريق قياس التدفق الخلوي (داخلي) بمكتبة متدرجة من 20 مروج ADH1 متحولة (A1 – A20) ليتم اختيارها تغطي 3 أوامر من نطاق التعبير عن الحجم ، أعلى وأسفل المخرجات التي يوفرها مروج ADH1 غير المعتم ( ADH). تشير أشرطة الخطأ إلى الخطأ المعياري (ن = 3).


توقعات - وجهات نظر

كما يتضح من الدراسات الملخصة هنا ، فإن كثافة المعلومات المشفرة في الجينومات حقيقية النواة والبكتيرية أكبر بكثير مما تم تقديره سابقًا ، مع العديد من أحداث الترجمة أكثر مما كان متوقعًا. يمكن أن تؤدي الترجمة دورًا تنظيميًا أو تؤدي إلى بروتين وظيفي ، أو ربما كليهما. تشير اللوائح الصارمة التي تمت ملاحظتها إلى أن ترجمة هذه المناطق التي تم تجاهلها سابقًا مهمة للخلية ، وهي نقطة تم التأكيد عليها من خلال ارتباط تعبير بديل ORF غير الطبيعي بالمرض. تفتح هذه الدراسات العديد من مجالات البحث الجديدة والمثيرة التي سبق ذكرها وتثير أسئلة إضافية تستحق الدراسة.

معيار الإثبات

من غير المحتمل أن يؤدي كل ORF مترجم محتمل إلى ظهور بروتين وظيفي ، وسيستغرق التحليل الوظيفي لكل ترجمة بديلة متوقعة لـ ORF وقتًا. يؤدي هذا إلى السؤال عن موعد وضع تعليق توضيحي على ORF المفترض. ما هو مستوى الأدلة الضروري؟ هل الدليل على الترجمة عن طريق التنميط الريبوسوم أو المطابقات بواسطة مطياف الكتلة كافٍ؟ لا يشير وجود كثافة الريبوسوم بالضرورة إلى ترجمة منتج بروتيني. وبالمثل ، فإن التطابق الطيفي الفردي بواسطة مطياف الكتلة لا يقدم دليلاً ملموسًا على التوليف. علاوة على ذلك ، يمكن أن تكون ترجمة ORF عبارة عن ضوضاء انتقالية ليس لها وظيفة تنظيمية ولا تنتج بروتينًا مستقرًا. نقترح أنه يجب أن تكون الأسطر المتعددة موجودة قبل شرح ORF المفترض.

تعقيد الوظيفة المزدوجة

بالنسبة لـ alt-ORFs المتداخلة مثل ملف gndA-GndP الزوج ، هناك أسئلة حول كيفية تأثير التعبير عن الوظيفتين المشفرة بواسطة مناطق متداخلة على بعضها البعض. فيما يتعلق بهذا ، هناك عدد متزايد من الأمثلة حيث تظهر النصوص التي تعمل بمثابة RNA تنظيمي أيضًا تشفير البروتينات الصغيرة ، وبالتالي تخدم "وظيفة مزدوجة" (150). يمكن أن يعمل الحمض النووي الريبي التنظيمي والبروتين الصغير في نفس المسار أو أن يكون لهما عواقب مختلفة تمامًا. النبات ميديكاغو truncatula تقوم miRNA miR171b التنظيمية بترميز البروتين الصغير miPEP171 ، والذي ثبت أنه يزيد من تراكم miR171b لتعزيز تكوين الجذر الجانبي (151). في البكتيريا بكتريا قولونية SgrS التنظيمي sRNA أيضًا يشفر بروتين SgrT ، وينظم كل من SgrS و SgrT نفس الهدف ، وهو ناقل الجلوكوز EIICB (152). ال المكورات العنقودية الذهبية يشفر RNAIII sRNA ، الذي يتزاوج مع العديد من الرنا المرسال لتنظيم الفوعة ، بروتين بيتا هيمولايسين. بينما δ-hemolysin مهم في بكتريا المكورة العنقودية البرتقالية الفوعة ، في هذه الحالة لا يؤثر الحمض النووي الريبي التنظيمي والبروتين الذي ينتجه على نفس الهدف [تمت مراجعته في (153 ، 154)].لا يُعرف سوى القليل جدًا عن متى وكيف تعمل هذه الرناوات ثنائية الوظيفة مثل mRNAs مقابل RNAs التنظيمية أو ما إذا كان النشاطان يتداخلان مع بعضهما البعض.

تطور

يؤدي أيضًا النظر في كيفية تطور بديل ORF بشكل عام والوظائف المتداخلة بشكل خاص إلى أسئلة مثيرة للاهتمام. على سبيل المثال ، في حالة الحمض النووي الريبي مزدوج الوظيفة ، ما النشاط الذي تطور أولاً؟ بالنسبة لبروتينات الغشاء الصغيرة الكارهة للماء ، هل تطورت من تكرار مجال الغشاء؟ الفرضية الجذابة هي أن بديل ORFs ، والتي هي أقل حفظًا من ORFs الرئيسية (بما يتوافق مع دورها التنظيمي في التعبير الجيني) ، قد تطورت مؤخرًا. على عكس main-ORFs التي تستخدم بشكل أساسي أكواد AUG الأساسية ، غالبًا ما تستخدم alt-ORFs قريبًا من أكواد البدء المتشابهة (ثلاثة توائم مثل AUG) للبدء. وتجادل هذه الميزة كذلك في أن ترجمة بديل ORFs أقل كفاءة بكثير عند مقارنتها بـ ORF الرئيسي. تم عرضه مؤخرًا في ملف D. melanogaster السكان ، فإن نسبة كبيرة من بديل ORFs مفيدة وثابتة بسرعة في ظل الاختيار الإيجابي (68). بالإضافة إلى الطفرات ، يمكن أن يؤدي إدخال العناصر القابلة للنقل إلى توليد بديل ORFs جديد. والجدير بالذكر أن ما يقدر بنحو 10 ٪ من بديل ORFs البشري مشتق من عناصر قابلة للنقل (155). لا يزال يتعين استكشاف القوى التطورية التي تحكم توليد بديل ORF في جميع الكائنات الحية.

إمكانية الاستغلال

نظرًا لأدوارها الواسعة ، فمن المستحسن هندسة بديل ORFs للتحكم الدقيق في ترجمة البروتين (156-158). في الواقع ، أتاح تحرير الجينوم لـ uORFs الذاتية في النباتات تعديلًا انتقاليًا لبروتينات ترميز ORFs الرئيسية المشاركة في التطوير أو التخليق الحيوي لمضادات الأكسدة (156). بالإضافة إلى ذلك ، فإن إدخال uORFs المستجيبة للأمراض في الجينات المحورة التي ترميز منظمات المناعة الرئيسية يسمح للنباتات باكتساب مقاومة واسعة النطاق للأمراض دون المساس بملاءمة النبات (158). في الآونة الأخيرة ، بذلت جهود لتحديد مركبات الجزيئات الصغيرة التي تستهدف ترجمة uORF (159). نظرًا لأن غالبية uORFs تعتمد على أكواد بدء قريبة ، فإن استهداف الترجمة غير التابعة لـ AUG قد يكون استراتيجية علاجية.

على نفس المنوال ، مرة أخرى نعرف عن آليات عمل البروتين الصغيرة ، يمكن استغلال وظائفها لعلاج المرض. يمكن أن يكون لكل من النظائر الاصطناعية المستقرة للبروتينات التنظيمية الصغيرة والجزيئات التي تؤثر على ارتباط البروتين الصغير قيمة علاجية [تمت مراجعتها من أجل حقيقيات النوى في (13)]. على سبيل المثال ، يمكن أن يكون تثبيط البروتينات الصغيرة المتورطة في العدوى أو تقليدها ، مثل بروتين Prli42 الذي يجند الإجهاد أو مقاومة المضادات الحيوية ، مثل منظم مضخة تدفق الأدوية المتعددة AcrZ ، أدوات قيمة لمكافحة العدوى أو مقاومة الأدوية المتعددة ، خاصة مع علاجات أخرى.


مناقشة

هناك طلب متزايد على إنتاج جزيئات صغيرة جديدة ومواد حيوية بما في ذلك الأدوية والمواد الكيميائية والوقود الحيوي والبوليمرات الحيوية. لإنتاج هذه الجزيئات بكفاءة ولتقليل تكلفة إنتاج المركبات الموجودة في الخلايا الميكروبية المهندسة ، فإن التحدي الرئيسي هو تنظيم التعبير عن عدد كبير من الجينات لتحسين إنتاج مسار التخليق الحيوي. عادةً ما يتم تحقيق إدخال الجينات في مضيفات الإنتاج باستخدام البلازميدات التي تم تجميعها مسبقًا ونشرها في بكتريا قولونية. يمكن للبيولوجيا التركيبية أن تقدم مساهمة كبيرة في تسريع هذه العملية باستخدام البلازميدات المعيارية حيث يتم تصنيع جميع المكونات بتنسيقات قياسية لتسهيل التبادل والاختبار السهل [3 ، 30].

نقدم هنا إطار عمل البيولوجيا التركيبية للهندسة الوراثية لـ C. الجلوتاميك، وهو كائن حي دقيق ذو أهمية صناعية لم يتم تطوير أدوات البيولوجيا التركيبية له بعد. في التصميم الموصوف هنا ، كل مكونات البلازميد محاطة بمواقع تقييد فريدة لتمكين استبدال معياري للعناصر الجينية. في معظم الحالات ، تكون الأجزاء وجينات المسار المستخدمة في مختبرنا اصطناعية ومصممة بحيث تتجنب مواقع NdeI و EcoRI و XbaI و SpeI و NheI و AvrII ، على الرغم من أن التسلسلات الطبيعية التي تفتقر إلى هذه المواقع وتضخيم تفاعل البوليميراز المتسلسل لإضافة مواقع التقييد المرافقة هي تستخدم كذلك. يمكن إضافة التسلسلات التنظيمية القصيرة ، مثل المحفزات و RBS ، ببساطة عن طريق استخدام قليل النوكليوتيدات المتداخلة. يمكن تحسين استخدام Codon للجينات غير المتجانسة لتسهيل التعبير عنها في C. الجلوتاميك. يمكن تحقيق العملية الكاملة لتصميم الجينات ، بما في ذلك إنشاء / إزالة موقع التقييد وتحسين الكودون ، في خطوة واحدة باستخدام برامج مجانية قائمة على الويب مثل Optimizer [31 ، 32].

تم اقتراح العديد من الأشكال لبناء البلازميدات الاصطناعية ولتجميع الأجزاء [30 ، 33-36]. الطريقة الأكثر قبولًا في مجتمع البيولوجيا التركيبية ابتكرها نايت وزملاؤه [37]. اقترحوا معيار BioBrick لتجميع الأجزاء البيولوجية ، حيث يتم إحاطة جميع الأجزاء بمجموعة قياسية من مواقع التقييد للسماح بالانضمام والجمع مع أجزاء أخرى. يمكن تكييف البلازميدات الموصوفة هنا لتلائم طريقة التجميع BioBrick عن طريق استبدال مجموعة مواقع التقييد ، على الرغم من وصف بعض القيود لهذا التنسيق أيضًا [38].

يمكن تحقيق المستويات المثلى من الإنزيم لتعظيم الإنتاج من مسار التخليق الحيوي نتيجة لضبط التعبير الجيني عن طريق ، على سبيل المثال ، تعديل النسخ أو الترجمة. لهذا الغرض ، من المستحسن وجود مجموعة أدوات مع مجموعة من المروجين و RBS قادرة على توفير مستويات مختلفة من التعبير الجيني. قد يعمل نظام pTGR كاختبار معياري لتقييم قوة تسلسل المحفز. للتحقق من صحة هذا التطبيق ، تم اختبار ثلاثة مروجين باستخدام eGFP كجين مراسل. شظايا DNA الاصطناعية التي تحتوي على الإشريكية القولونية تاك المروج و الاحمق و cspB مروج من C. الجلوتاميك تم إدخالها باستخدام التنسيق القياسي. تم الحصول على ثلاثة مستويات من شدة التألق: تاك المروج قدم أقوى إشارة ، و الاحمق المروج أقل كمية من الأسفار و cspB شدة متوسطة. النتيجة ليست مفاجئة منذ ذلك الحين ، (ط) استخدمت مجموعات أخرى الإشريكية القولونية لاك المروجين المشتقة مثل تاك و trc للإفراط في التعبير عن الجينات في C. الجلوتاميك[15 ، 39 ، 40] ، و (2) تسلسل المربع 10 من تاك المروج مطابق لتلك الخاصة بالمروج الإجماعي لـ C. الجلوتاميك[23]. ومن المثير للاهتمام أن هذا المحفز قد يوفر مثالًا آخر لضبط التعبير الجيني باستخدام تركيزات مختلفة من محفز IPTG [41]. على الرغم من أن النهج القائم على GFP لتوصيف المروجين قد تم وصفه مسبقًا بواسطة Knoppova وزملاؤه [16] ، فإن المتجه الموصوف لا يمتلك تنوع منصة pTGR لاختبار التسلسلات التنظيمية المتعددة.

البدء هو خطوة تحديد معدل الترجمة. شريطة عدم وجود هياكل ثانوية بين RBS وتسلسل التشفير ، فقد تبين أنه يمكن استخدام RBS كجزء تنظيمي لأنها تؤثر على بدء الترجمة ، وبالتالي على التعبير الجيني [42 ، 43]. علاوة على ذلك ، تم وصف طريقة مؤخرًا للتصميم التلقائي لـ RBS الاصطناعية للتحكم في التعبير الجيني ، مما يوسع من إمكانات هذه التسلسلات لاستخدامها في الدوائر الجينية [44]. بهذه الطريقة ، يمكن أيضًا استخدام pTGR لاختبار تأثير مُعدِّل RBS على التعبير الجيني. للتحقق من صحة هذا التطبيق ، تم اختبار ثلاثة RBSs مختلفة باستخدام eGFP كمورث مراسل تحت تاك المروجين. قدمت التسلسلات كميات متغيرة من شدة التألق ، مما يثبت صحة استخدام النظام لملء مجموعة من هذه التسلسلات التنظيمية للتعبير الجيني.

يوفر pTGR وسيلة سريعة لإنشاء منشآت للتعبير عن جينات متعددة. يسمح التصميم بتجميع التركيبات - الأوبيرونات أو مجموعات الجينات - في العديد من خطوات الاستنساخ كما يتم تجميع الجينات عن طريق: (1) إدخال جميع الجينات المراد التعبير عنها في ناقل pTGR مع التسلسلات التنظيمية المرغوبة و (2) النقل المتسلسل من الجينات ذات تسلسل المنظم المقابل إلى ناقل يحتوي على جين (جينات) آخر لتوسيع أوبرون أو مجموعة جينية كما هو موضح في الشكل 1 ب.

من المغري أن نتوقع أن ناتج المروجين و RBS في تجارب التعبير الجيني الفردي من ناقلات المسبار قد يتوقع أداء هذه الأجزاء في سياق أكثر تعقيدًا مثل المشغلات أو مجموعات الجينات المتعددة. على سبيل المثال ، يشبه مستوى التعبير عن كلا البروتينين في التجارب الموضحة في الشكل 4 المستوى المتوقع من التعبير الفردي لكل بروتين (الشكل 3). هذا من شأنه أن يسهل تصنيف الأجزاء التنظيمية لتنظيم التعبير الجيني بدقة في المسارات التي تتطلب بروتينات متعددة. ومع ذلك ، قد يكون ناتج العديد من الأجزاء يعتمد على السياق. وبالتالي ، فإن الحصول على التوازن الأمثل لجميع البروتينات ، خاصة بالنسبة للمسارات التي تحتوي على عدد كبير من الجينات ، قد يتطلب اختبارات متعددة للعثور على التسلسلات التنظيمية المناسبة. علاوة على ذلك ، في معظم الحالات ، يكون المستوى الأمثل للتعبير عن بروتين معين في مسار ما غير معروف ، ومن الضروري إنشاء تركيبات اندماجية باستخدام مجموعة متنوعة من المتواليات التنظيمية للعثور على التركيبة الصحيحة [45-47]. قد تساهم منصة pTGR في تسريع هذه الاختبارات من خلال تسهيل التجميع السريع للتركيبات الاندماجية وتبادل الأجزاء المشاركة في تنظيم التعبير الجيني.

قد توفر الميزات الأخرى لمنصة pTGR مستويات إضافية من التنظيم. على سبيل المثال ، يمكن تنظيم رقم نسخة مجموعة جينية أو أوبرون باستخدام أصول النسخ المتماثل من بلازميدات ذات عدد نسخ متوسط ​​أو منخفض. يمكن تحقيق ذلك بسهولة في خطوة استنساخ واحدة باستخدام مواقع KpnI و PstI التي تحيط بأصل النسخ المتماثل. بدلاً من ذلك ، يمكن إدخال تسلسل لإدخال الجينات في الكروموسوم في هذا المكان.

من حيث المبدأ ، المنصة الموصوفة هنا ل C. الجلوتاميك يمكن أن تمتد لتشمل الكائنات الحية الدقيقة الأخرى عن طريق استبدال أصلها المتماثل بنظير مناسب من ، على سبيل المثال ، عصية و ستربتوميسيس. مثل هذه التجارب قيد التقدم في مختبرنا للتحقق من صحة استخدام نظام pTGR في الكائنات الحية الدقيقة الأخرى ذات المصالح الصناعية.


عدم احتضان التعقيد البيولوجي يعيق علماء الأحياء الاصطناعية

الجينات الاصطناعية المصممة في المادة الوراثية للخلية والتي يمكن تحريضها أو كبتها عند الإرادة لديها مشكلة رئيسية واحدة: التحكم الدقيق. حيث يمكن حتى للكميات الضئيلة من البروتين أن تعني الفرق بين الحياة والموت ، فإن التحكم الجيني الصارم والدقيق والثنائي ، تمامًا مثل تشغيل الضوء أو إيقاف تشغيله ، أمر بالغ الأهمية. لا يوجد مكان للتسريبات في النظام.

يتم تحقيق الإنتاج المستدام والنظيف للوقود والمواد الكيميائية والأدوية بشكل متزايد من خلال هندسة الجينات الاصطناعية والدوائر الوراثية في الكائنات الحية الدقيقة. وهذا يتطلب تحكمًا دقيقًا في مجموعات الجينات.

وجد المهندسون الحيويون في جامعة بريستول حلاً بسيطًا لمشكلة التنظيم الدقيق للتعبير عن الجينات المحفزة الاصطناعية من خلال تسخير العقيدة المركزية على مستويات كل من الحمض النووي الريبي وتخليق البروتين.

تم نشر هذه النتائج في المقالة & # 8220 تسخير العقيدة المركزية للتحكم الصارم متعدد المستويات في التعبير الجيني & # 8221 في المجلة اتصالات الطبيعة. تم تمويل الدراسة من قبل الجمعية الملكية وجمعية ماكس بلانك والمنظمة الأوروبية للبيولوجيا الجزيئية (EMBO) و BBSRC و EPSRC بدعم من معهد Bristol BioDesign (BBI).

& # 8220 على الرغم من أن تشغيل "تشغيل" أو "إيقاف تشغيل" الجين يبدو أمرًا بسيطًا ، إلا أن الحصول على خلية حية للقيام بذلك بناءً على الأمر يمثل تحديًا حقيقيًا. كل خلية مختلفة قليلاً ، والعمليات المعنية ليست موثوقة بنسبة 100٪ ، & # 8221 تقول فيرونيكا جريكو ، طالبة دكتوراه في Bristol & # 8217s School of Biological Sciences والمؤلفة الرئيسية للدراسة.

تقوم الطبيعة عمومًا ببناء التكرار في جميع العمليات الحيوية الحرجة. هذا التصميم الطبيعي فوضوي ولكنه يسمح للأنظمة البيولوجية بتجاوز الأخطاء والبقاء على قيد الحياة. استلهم الفريق من هذا الفهم الأساسي للطبيعة ودرس بشكل منهجي الاستخدام المشترك لمنظمات النسخ (تخليق الحمض النووي الريبي) والترجمة (تخليق البروتين) على التعبير البروتيني.

& # 8220 إذا نظرت إلى فينوس صائدة الذباب تجد أن المصيدة ستغلق فقط عندما يتم تشغيل عدة شعيرات معًا. هذا يساعد على تقليل فرصة إغلاق المصيدة عن طريق الصدفة. أردنا أن نفعل شيئًا مشابهًا عند التحكم في تعبير الجين داخل الخلية ، مضيفًا مستويات متعددة من التنظيم للتأكد من أنه يأتي فقط عندما نريده بالضبط ، & # 8221 يقول Greco.

& # 8220 ما كان رائعًا في هذا المشروع هو مدى نجاحه في تسخير اثنين من العمليات الأساسية الموجودة في كل خلية والتي تدعم كل الحياة — النسخ والترجمة ، & # 8221 تقول كلير غريرسون ، دكتوراه ، أستاذة ورئيسة المدرسة من العلوم البيولوجية في بريستول ، وأحد كبار المؤلفين في الدراسة.

تُظهر الأدلة الواردة في هذه الدراسة أنه من خلال التنظيم متعدد المستويات ، يمكن للمرء إنشاء بعض المفاتيح الأكثر تنظيمًا بدقة للتعبير الجيني التي تم إنشاؤها حتى الآن.

بالتعاون مع أمير باندي ، دكتوراه ، وتوبياس إيرب ، دكتوراه ، من معهد ماكس بلانك بريستول & # 8217s لعلم الأحياء الدقيقة الأرضية ، أظهر الفريق أنه حتى عند استخدامها خارج الخلايا الحية (في المختبر) ، فإن هذه الأنظمة متعددة المستويات توفر تحكمًا صارمًا في الجينات التعبير.

& # 8220 عندما نقوم بهندسة الميكروبات ، نحاول غالبًا تبسيط أنظمتنا قدر الإمكان ، معتقدين أننا & # 8217 سنتحكم بشكل أفضل في ما يحدث. لكن ما أظهرناه & # 8217 هو أن احتضان بعض التعقيد المتأصل في علم الأحياء قد يكون المفتاح لإطلاق العنان لإمكاناته الكاملة للتقنيات الحيوية عالية الدقة في المستقبل ، & # 8221 يقول Thomas Gorochowski ، دكتوراه ، مؤلف مناظر كبير في الدراسة و زميل أبحاث جامعي في الجمعية الملكية في بريستول.

منذ أن تم تصميم أول أنظمة وراثية محفزة في الثمانينيات ، تم إحداث ثورة في التحكم في التعبير الجيني في التكنولوجيا الحيوية باستخدام الجزيئات الصغيرة (علم الوراثة الكيميائية) والضوء (علم البصريات الوراثي) وإشارات أخرى. في الآونة الأخيرة ، طور علماء الأحياء التركيبية طرقًا أكثر تقدمًا للتحكم في التعبير الجيني باستخدام المنظمين بناءً على بروتينات ربط الحمض النووي ، مثل أصابع الزنك ، وتالين ، وكريسبري ، وتفاعلات RNA-RNA ، وعمليات ما بعد النسخ / الترجمة مثل RNA وتدهور البروتين والتطور الموجه .

بدلاً من استخدام خيار واحد فقط من الخيارات المتاحة للتحكم في التعبير الجيني ، تُظهر هذه الدراسة أنه للتنظيم الصارم للتعبير الجيني ، يجب على المرء أن يقرن أشكالًا متعددة من التنظيم لتقليل التعبير غير المرغوب فيه وتحسين متانة النظام. تم تنفيذ عدد قليل من الأنظمة التنظيمية متعددة المستويات حتى الآن. من خلال تبني هذا التكرار المتأصل في الطبيعة قد يكون تصميمًا فوضويًا ولكن يمكن أن يوضح الصواميل والمسامير حول كيفية تحقيق تحكم صارم متعدد المستويات ، والمفاضلات الموجودة بين الأداء والتعقيد التنظيمي والعبء الخلوي.


شاهد الفيديو: Open Reading Frame ORF - Definition, Role in Protein Synthesis and difference between ORF and CDS (شهر اكتوبر 2022).