معلومة

كيف تم تعطيل الجين في عصر ما قبل كريسبر؟

كيف تم تعطيل الجين في عصر ما قبل كريسبر؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أحاول أن أفهم كيف جعلت كريسبر عملية تحرير الجينات أو تحرير الجينات أبسط لجعل الحيوانات المعدلة وراثيًا. هنا مخطط انسيابي قديم (ما قبل كريسبر) من Manis ، 2007 يوضح كيف يمكن تحقيق خروج المغلوب.

أفترض أن الكثير من هذه العملية لا يزال كما هو حتى مع تقنية كريسبر. لكني أريد أن أفهم أي جزء من هذا المخطط الانسيابي أصبح أسهل مع كريسبر؟ هل هو أننا لسنا بحاجة إلى انتظار حدوث حدث إعادة تركيب عشوائي؟ هل هو أن العائد قد زاد لأننا قطعنا الموقع مباشرة ونطلب أن يحدث HDR بدلاً من مجرد الجلوس وانتظار حدوث ذلك؟


تحث تقنية CRISPR / Cas9 بوساطة الضربة القاضية لجين VPREB1 على تأثير سام للخلايا في خلايا الورم النقوي

الورم النقوي المتعدد (MM) هو ورم دموي غير متجانس يمثل 2 ٪ من جميع السرطانات. على الرغم من أن زراعة الخلايا الجذعية الذاتية والعلاج الكيميائي هما العلاج الأكثر فعالية حاليًا ، إلا أنه يحمل مخاطر ملحوظة ، بالإضافة إلى كونه غير علاجي. في الآونة الأخيرة ، تم بنجاح تجربة التكرارات المتناظرة القصيرة المنتظمة المتباعدة (CRISPR-cas9) بنجاح على المستوى التجريبي ، لعلاج العديد من الأورام الخبيثة الدموية.

أهداف

كنا نهدف إلى التحقيق في في المختبر تأثير الضربة القاضية CRISPR-cas9 بوساطة السلسلة الخفيفة البديلة للخلية B من مجموعة V 1 "VPREB1"الجين على التكاثر الخبيث لخلايا المايلوما الأولية المستزرعة.

أساليب

تم إجراء تحليل المعلوماتية الحيوية لاستكشاف ملف التعبير الجيني لـ MM و VPREB1 تم اختيار الجين كجينة مستهدفة لهذه الدراسة. ضربنا VPREB1 الجين في خلايا المايلوما الأولية المستزرعة باستخدام CRISPR-cas9 ، و VPREB1 تم التحقق من فعالية التحرير الجيني عن طريق التحديد VPREB1 التعبير الجيني على كل من مستويات الرنا المرسال والبروتين بواسطة qPCR والتألق المناعي ، على التوالي. علاوة على ذلك ، تم تقييم التأثير السام للخلايا على تكاثر خلايا المايلوما الأولية باستخدام مقايسة السمية الخلوية.

نتائج

كان هناك انخفاض معتد به إحصائيا لكليهما VPREB1 مستويات التعبير عن مرنا والبروتين (p & lt0.01). الضربة القاضية VPREB1 الجين في خط خلايا الورم النقوي أدى إلى انخفاض معتد به إحصائيًا في تكاثر خلايا المايلوما.

استنتاج

ضربة قاضية لـ CRISPR-cas9 بوساطة VPREB1 الجين فعال في منع تكاثر خلايا الورم النقوي الأولي. سيوفر هذا أساسًا لاستراتيجية علاجية واعدة للمرضى الذين يعانون من المايلوما المتعددة.

الاقتباس: خالد م ، مصطفى ع ، الخزرجي ن ، أحمد م ، عبد الخالق م ، الصالحى إم (2021) كريسبر / كاس 9 بوساطة خروج الجين VPREB1 يؤدي إلى تأثير سام للخلايا في خلايا الورم النقوي. بلوس ون 16 (1): e0245349. https://doi.org/10.1371/journal.pone.0245349

محرر: Zhi-Yao He ، مستشفى غرب الصين ، جامعة سيتشوان ، الصين

تم الاستلام: 20 يونيو 2020 وافقت: 22 ديسمبر 2020 نشرت: 8 يناير 2021

حقوق النشر: © 2021 خالد وآخرون. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ في أي وسيط ، بشرط ذكر المؤلف والمصدر الأصليين.

توافر البيانات: جميع البيانات ذات الصلة موجودة داخل المخطوطة وملفات المعلومات الداعمة الخاصة بها.

التمويل: لم يتلق المؤلف (المؤلفون) أي تمويل محدد لهذا العمل.

تضارب المصالح: وقد أعلن الباحثون إلى أن لا المصالح المتنافسة موجودة.


كيف تم تعطيل الجين في عصر ما قبل كريسبر؟ - مادة الاحياء

وعدنا لكم:
جودة المنتج مضمونة ، دعم العملاء الخبراء.

توليد خط خلية الجينات الضربة القاضية

كأحد مقدمي الخدمات الرائدين في تحرير الجينوم ، منصة CRISPR / Cas9 CB يجلب للعملاء خدمة الضربة القاضية الجينية الأكثر شمولاً. نحن نركز على تطوير تقنية كريسبر لخدمة العملاء بمنتجات وخدمات راضية. فيما يتعلق بالمنصة الرائدة والعلماء ذوي الخبرة والموظفين المهرة ، فقد نجحنا في توليد خط خلوي معطل للجينات في أنواع متعددة ، مثل الخلايا البشرية وخلايا الفئران وخلايا الفئران وخلايا القرود.

الجين هو تسلسل DNA أو RNA يرمز لجزيء له وظيفة. يتكون الكروموسوم من خيط طويل من الحمض النووي يحتوي على العديد من الجينات. على سبيل المثال ، يمكن أن يحتوي الكروموسوم البشري على ما يصل إلى 500 مليون زوج أساسي من الحمض النووي مع آلاف الجينات. في الدراسة الجينية ، يتم تطبيق الضربة القاضية للجينات أو الإفراط في التعبير على نطاق واسع لدراسة الوظيفة. منذ تطوير نظام كريسبر ، أصبح من الأسهل الحصول على خط أو نموذج خلوي معطل للجينات لمزيد من البحث. باستخدام CRISPR / Cas9 للضربة القاضية للجينات ، يتم تقديم indel إلى الموقع المستهدف الذي ينتج عنه طفرة تحول الإطار. عند تطبيقه على الجينات الضربة القاضية ، تم تصميم sgRNA لاستهداف exons من الجين. ثم سيتم تجنيد Cas9 إلى الموقع المحدد والحث على DSB. يحدث Indels عند إصلاح كسر حبلا مزدوج الحمض النووي بطريقة عرضة للخطأ.

منصة CRISPR / Cas9 CB يقدم خدمة خروج المغلوب الجيني لخطوط الخلايا المختلفة ، بما في ذلك الخلايا سهلة التعامل والخلايا السرطانية والخلايا الجذعية والخلايا التي يصعب التعامل معها. بالنظر إلى أن كل حالة فريدة من نوعها ، فسنقدم استشارة مجانية في البداية. بعد تقديم معلومات الجينات والخط الخلوي ، سنضع خطة لمساعدتك في تحقيق أهدافك.


وافقت إدارة الغذاء والدواء الأمريكية على أول اختبار لـ CRISPR لتصحيح الخلل الجيني الذي يسبب مرض فقر الدم المنجلي

يتحدث مرضى الخلايا المنجلية مثل كاساندرا تريمنيل وإيفي جيمس جونيور وطبيب جامعة كاليفورنيا في سان فرانسيسكو مارك والترز عن الألم الشديد الذي يعاني منه المصابون بالمرض والفوائد المحتملة لعلاج كريسبر.

في عام 2014 ، بعد عامين من اختراعها الحائز على جائزة نوبل لتعديل الجينوم CRISPR-Cas9 ، اعتقدت جينيفر دودنا أن التكنولوجيا ناضجة بما يكفي لمعالجة اضطراب وراثي مدمر ، مرض فقر الدم المنجلي ، الذي يصيب ملايين الأشخاص حول العالم ، معظمهم من أصل أفريقي. حوالي 100000 شخص أسود في الولايات المتحدة مصابون بهذا المرض.

حشدوا الزملاء في معهد الجينوم المبتكر (IGI) الجديد آنذاك - وهو تعاون بحثي مشترك بين جامعة كاليفورنيا ، بيركلي ، وجامعة كاليفورنيا في سان فرانسيسكو - سعوا لإصلاح الطفرة المفردة التي تجعل خلايا الدم الحمراء تتشوه وتسد الشرايين ، مما يسبب ألمًا مؤلمًا الألم وغالبا الموت. عادةً ما تتضمن العلاجات المتاحة اليوم عمليات نقل دم منتظمة ، على الرغم من أن عمليات زرع نخاع العظم يمكن أن تعالج أولئك الذين يمكنهم العثور على متبرع مطابق.

بعد ست سنوات من العمل ، تمت الموافقة الآن على هذا العلاج التجريبي للتجارب السريرية من قبل إدارة الغذاء والدواء الأمريكية ، مما يتيح إجراء الاختبارات الأولى على البشر للعلاج المستند إلى CRISPR لتصحيح الطفرة في جين بيتا غلوبين المسؤول عن المنجل. مرض الخلية. بيتا غلوبين هو أحد البروتينات الموجودة في مركب الهيموغلوبين المسؤول عن حمل الأكسجين في جميع أنحاء الجسم.

التجارب ، التي من المتوقع أن تستغرق أربع سنوات ، سيقودها أطباء في مستشفى UCSF Benioff للأطفال في أوكلاند ومركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا ، الذين يخططون للبدء هذا الصيف لتسجيل ستة بالغين وثلاثة مراهقين يعانون من مرض فقر الدم المنجلي الحاد.

سوف يلعب مختبر التشخيص السريري التابع لـ IGI ، والذي تم بناؤه تحت قيادة Doudna لتوفير اختبار COVID-19 المجاني لمجتمع بيركلي ، دورًا رئيسيًا في الدعم التحليلي للتجربة من خلال تطوير التشخيصات لمراقبة رفاهية المريض وتتبع كفاءة علاج او معاملة.

قال دودنا ، أستاذ البيولوجيا الجزيئية والخلوية والكيمياء بجامعة كاليفورنيا في بيركلي ، وباحث في معهد هوارد هيوز الطبي: "نحن متحمسون للعمل نحو علاج يمكن أن يكون متاحًا وبأسعار معقولة للمرضى في جميع أنحاء العالم". "يعد إطلاق هذه التجربة خطوة أولى أساسية على هذا المسار."

يقود التجربة السريرية الدكتور مارك والترز ، أستاذ طب الأطفال في جامعة كاليفورنيا في سان فرانسيسكو ومدير الأسرة الأردنية لبرنامج زرع الدم والنخاع في مستشفى أوكلاند للأطفال بينيوف للأطفال.
الائتمان: UCSF

نجحت تجارب أخرى في استخدام تقنية CRISPR-Cas9 لإخراج الجين الذي يثبط جين الهيموجلوبين الجنيني ، والذي يتم إيقافه عادةً عند البشر. تعمل هذه التقنية على إعادة إيقاظ جين الجنين ، وقد خففت أعراض فقر الدم المنجلي لدى ثلاثة مرضى على الأقل.

التجربة الجديدة عبارة عن إدخال جيني: يستخدم الباحثون تقنية CRISPR-Cas9 لاستبدال جين بيتا غلوبين المعيب بنسخة تم إصلاحها ، بهدف تكوين خلايا دم حمراء طبيعية للبالغين وعلاج الاضطراب.

قال الدكتور مارك والترز ، أستاذ طب الأطفال في UCSF و الباحث الرئيسي في التجربة السريرية ومشروع تحرير الجينات. "إذا تم تطبيق هذا بنجاح على المرضى الصغار ، فمن المحتمل أن يمنع مضاعفات المرض التي لا رجعة فيها."

المرضى هم المتبرعون بالخلايا الجذعية الخاصة بهم

تتطلب هذه التقنية ، كما هو الحال مع النهج البديل الذي يعيد إيقاظ الهيموغلوبين الجنيني ، أن يتم حصاد بعض الخلايا الجذعية المكونة للدم للمريض - خلايا نخاع العظم التي تولد جميع خلايا الدم الحمراء في الجسم - لتحرير الجينات خارج الجسم. بعد إزالة هذه الخلايا ، يتم تدمير النخاع العظمي المتبقي بالعلاج الكيميائي للسماح بنمو الخلايا الجذعية التي تم إصلاحها وإعادة دمجها.

يشارك الدكتور دونالد كون ، الأستاذ المتميز في علم الأحياء الدقيقة والمناعة وعلم الوراثة الجزيئي وطب الأطفال وعلم الأدوية الجزيئي والطب في كلية ديفيد جيفن للطب بجامعة كاليفورنيا في لوس أنجلوس وعضو في مركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا في لوس أنجلوس ، في العديد من تجارب العلاج الجيني لأمراض مثل SCID ومرض فقر الدم المنجلي.
الائتمان: جامعة كاليفورنيا

والترز ، وهو أيضًا مدير عائلة الأردن لبرنامج زرع الدم والنخاع في مستشفى UCSF Benioff للأطفال في أوكلاند ، سيعمل مع الطبيب والعالم في جامعة كاليفورنيا في لوس أنجلوس الدكتور دونالد كون ، الذي طور علاجات جينية للعديد من اضطرابات الدم الوراثية ، بما في ذلك العلاج. لشكل من أشكال نقص المناعة المشترك الشديد (SCID). يقود كوهن أيضًا تجربة سريرية لنوع مختلف من العلاج الجيني لمرض الخلايا المنجلية ، والذي يتضمن إضافة جين جديد إلى الخلايا الجذعية للمرضى للتغلب على طفرة الخلايا المنجلية.

قال كون ، الأستاذ المتميز في علم الأحياء الدقيقة وعلم المناعة وعلم الوراثة الجزيئي وطب الأطفال وعلم العقاقير الجزيئي والطب في كلية ديفيد جيفن للطب بجامعة كاليفورنيا في لوس أنجلوس: "يسمح العلاج الجيني وتحرير الجينات لكل مريض بالعمل كمتبرع للخلايا الجذعية" عضو في مركز أبحاث الخلايا الجذعية العريضة بجامعة كاليفورنيا. "من الناحية النظرية ، يجب أن تكون هذه الأساليب أكثر أمانًا من عملية زرع من شخص آخر ويمكن أن تصبح متاحة عالميًا لأنها تلغي الحاجة إلى العثور على الإبرة في كومة قش متبرع مطابق للخلايا الجذعية."

سيقود كوهن أنشطة المختبرات والتجارب السريرية في جامعة كاليفورنيا وسيتولى الإشراف على جميع عمليات تصنيع المنتج الدوائي ، المسمى CRISPR_SCD001 ، للتجربة السريرية. تم تمويل العمل قبل السريري لتطوير هذا العلاج من قبل معهد كاليفورنيا للطب التجديدي ومبادرة علاج الخلايا المنجلية الوطنية للقلب والرئة والدم ومؤسسة دوريس ديوك الخيرية.

فيودور أورنوف ، مدير IGI للتكنولوجيا والترجمة وأستاذ البيولوجيا الجزيئية والخلوية بجامعة كاليفورنيا في بيركلي ، سوف يشرف على أنشطة المعلوماتية الحيوية والجينوميات للدراسة.

قال أورنوف: "من الجدير بالذكر أن هذه التجربة الجديدة تأتي من كونسورتيوم من المؤسسات الأكاديمية غير الهادفة للربح التي تم تحفيزها برؤية طويلة الأمد لعلاج المرض من خلال حل ميسور التكلفة يمكن أن يفيد كل من يحتاج إليه عالميًا".

قاد فيودور أورنوف ، المدير العلمي للتكنولوجيا والترجمة في معهد IGI ، الأبحاث الأساسية حول علاجات كريسبر لمرض الخلايا المنجلية.
الائتمان: كيجان هاوسر

ينتج مرض الخلايا المنجلية عن تغيير واحد في شفرة الحمض النووي لجين بيتا غلوبين. تستخدم التجربة الجديدة نوكلياز CRISPR-Cas9 - وهو بروتين Cas9 مجمّع بالكامل ويوجه تسلسل الحمض النووي الريبي الذي يستهدف المنطقة المعيبة من جين بيتا غلوبين ، مصحوبًا بجزء قصير من الحمض النووي يشفر التسلسل الصحيح - لتحفيز إصلاح الطفرة المنجلية عن طريق الاستعاضة جزء الحمض النووي الطبيعي للجزء غير الطبيعي. في هذا النهج ، يتم معالجة خلايا الدم الجذعية للمريض أولاً بنبضات كهربائية تخلق مسامًا في أغشيتها. تسمح هذه المسام لمنصة CRISPR-Cas9 بدخول الخلايا الجذعية والانتقال إلى نواتها لتصحيح طفرة الخلايا المنجلية.

قال والترز: "الهدف من هذا الشكل من العلاج بتحرير الجينوم هو تصحيح الطفرة في عدد كافٍ من الخلايا الجذعية ، بحيث يصحح الدم الناتج في الدورة الدموية خلايا الدم الحمراء". "استنادًا إلى خبرتنا في عمليات زرع نخاع العظم ، نتوقع أن تصحيح 20٪ من الجينات يجب أن يكون كافيًا للتنافس على الخلايا المنجلية الأصلية وله فائدة سريرية قوية."

يستخدم بروتوكول التصنيع النهائي طريقة خالية من الفيروسات لتحرير خلايا الدم الجذعية وتم التحقق من صحتها في دراسات السلامة / علم السموم قبل السريرية التي أجريت بعد التشاور مع إدارة الغذاء والدواء.

علاجات كريسبر المستقبلية

بينما يأخذ أطباء جامعة كاليفورنيا علاج كريسبر الحالي في التجارب السريرية ، يعمل علماء معهد IGI على تحسين التقنية بحيث يمكن في النهاية تصحيح طفرة الخلايا المنجلية داخل الجسم ، دون إزالة الخلايا الجذعية أو تدمير نخاع العظام. نظرًا لأن نخاع العظم ينتج أيضًا خلايا الدم البيضاء التي تحمينا من الأمراض ، فإن تدميرها يثبط جهاز المناعة ويعرض المرضى لخطر الإصابة بالعدوى أو حتى السرطان حتى تتكاثر الخلايا الجذعية المصححة والمُصححة وتتكاثر.

ينتج مرض الخلايا المنجلية عن طفرة في جين بيتا غلوبين تجعل خلايا الدم الحمراء تتشوه إلى شكل منجل (في المقدمة) مقارنة بالشكل الدائري الطبيعي الذي يظهر في الخلفية. تسد الخلايا المنجلية الشرايين ، مما يؤدي إلى ألم شديد وتلف في الأعضاء.
الائتمان: معهد الجينوميات المبتكرة ، جامعة كاليفورنيا في بيركلي

قال روس ويلسون ، مدير التوصيل العلاجي في معهد IGI: "حاليًا ، نجري علاجًا خارج الجسم الحي ، حيث يتم إخراج الخلايا من نخاع العظام لتصحيح الطفرة خارج الجسم". لكن خلال هذا الوقت - قد يستغرق شهورًا - تمتلئ النخاع العظمي مرة أخرى. ونتيجة لذلك ، عندما يحين وقت حقن الخلايا المصححة ، يجب أن يخضع المريض للعلاج الكيميائي القوي الذي يزيل النخاع العظمي ويسمح لتلك الخلايا المصححة بالعثور على منزل ".

يشعر ويلسون بالتفاؤل بأنه هو وعلماء IGI يمكنهم إيجاد طريقة لإرسال علاج CRISPR مباشرةً إلى نخاع العظام داخل الجسم ، باستخدام الأجسام المضادة لتوجيه إنزيم كريسبر إلى الخلايا الجذعية الصحيحة. العلماء الآخرون ، الذين يستخدمون الفيروسات المهندسة أو القطرات الدهنية - الجسيمات النانوية الدهنية - لنقل إنزيم كريسبر إلى الجسم ، فشلوا حتى الآن.

وقال: "الجزيء الذي نحاول إيصاله أصغر ماديًا - يبلغ قطره ثُمن الجسيمات النانوية التي يحاول الأشخاص الآخرون إيصالها إلى نخاع العظام - وهذا يمكن أن يوفر فوائد كبيرة". "يجب أن يكون الإنزيم الذي يتم توصيله ذاتيًا قادرًا على الوصول إلى نخاع العظام."

التمثيل الرسومي لـ CRISPR-Cas9 لإصلاح الطفرة في الجين الذي يسبب مرض فقر الدم المنجلي (يظهر باللون الأزرق الفاتح).
الائتمان: صورة جامعة كاليفورنيا في بيركلي بإذن من معهد الجينوميات المبتكرة

مهما كانت الاستراتيجية الناجحة ، سواء خارج الجسم الحي أو في الجسم الحي ، فإن منصة كريسبر التي تم تطويرها لمرض الخلايا المنجلية يمكن أن تحول العلاج الجيني لأمراض أخرى.

"هذه هي رؤية IGI: الخلية المنجلية الأولى ، لكن جهودنا سيكون لها تأثير مضاعف لتمكين علاج اضطرابات الدم بشكل عام ، مثل الثلاسيميا بيتا ، وكذلك أمراض الجهاز المناعي ،" قال. "الخلايا الجذعية المكونة للدم هي بذرة الجهاز المناعي بأكمله ، لذلك يمكن نظريًا علاج جميع اضطرابات الدم عن طريق علاج الخلايا الجذعية مثل هذا."


تحرير الجينوم قبل الميلاد (قبل كريسبر)

تم إنشاء تحرير الجينوم باستخدام نوكليازات هندسية ، وهي أداة قوية لفهم الوظيفة البيولوجية والكشف عن السببية ، في جهد مشترك من قبل الأوساط الأكاديمية والصناعية في 1994-2010. يعد استخدام CRISPR / Cas9 هو أحدث تطبيق (2013–) ، وسهل ، لمربع أدوات التحرير الناتج. تظل مبادئ وطرق تحرير الجينوم من حقبة ما قبل كريسبر ذات صلة ولا تزال مفيدة.

في البداية…

... كان كسر الخيط المزدوج (DSB). مستحث في موضع محدد لكروموسوم الثدييات بواسطة ماريا جاسين في عام 1994 (19 قبل الميلاد [قبل كريسبر *]) ، 1 شرعت في سلسلة من الأحداث ، بما في ذلك الدراسات التاريخية التي أجرتها دانا كارول (2000-2003 13-10 قبل الميلاد) ، 2–4 التي أوصلتنا جميعًا بشكل مباشر ، في عام 2018 ، إلى البطاطس المعدلة جينومًا ، 5 و الناس، 6 وسفينة نوح من الخلايا والكائنات الحية المعدلة.

نتيجة لذلك ، أصبح لدى علماء الطب الحيوي الآن علاج قوي لمشكلة معرفية معطلة سابقًا (شكل 1): في غياب المعلومات يملأ العقل البشري الثغرات بالأشياء إنه يختلق ببساطة. تحرير الجينوم هو أداة للابتعاد عن هذه "القصص فقط" وأقرب إلى الواقع البيولوجي. إنها أيضًا الأداة النهائية لتحديد السببية.

تم تطوير صندوق أدوات التحرير بين عامي 1994 و 2010 في جهد مشترك بين الأوساط الأكاديمية والصناعية ، باستخدام الميغانوكلايز لإثبات المفهوم 7 و نوكليازات إصبع الزنك (ZFNs) لتحرير المواقع الأصلية. 8 في 2010-2012 ، تم نقل صندوق الأدوات سريعًا ، بالجملة ، إلى فئة نوكلياز ثالثة - فئة تعتمد على مجال المستجيب TAL. 9

يحتوي تاريخ التقدم الصناعي على عدة أمثلة على تأثير "1 + 1 = 7" من التقاء خطوط الجهد التي لم تكن مترابطة من قبل. اكتشف الألمنيوم ، الذي تم اكتشافه في عام 1825 وتم تنقيته على نطاق واسع في عام 1886 ، استخدامه على نطاق واسع مع اختراع الطائرة وظهور الطيران في العقد الأول من القرن الماضي. طورت شركة Corning "زجاج الغوريلا" في الستينيات لاستخدامه المحتمل في الزجاج الأمامي للسيارات والطائرات ، وأصبح منتشرًا في كل مكان كسطح iPhone بعد نصف قرن.

في 1987-1989 ، لوحظ "ترتيب غير عادي مع تسلسل متكرر" في موضع معين في الإشريكية القولونيةالجينوم- ترتيب يُعرف الآن باسم "تكرار قصير متناوب متناوب مترابط بشكل منتظم ،" أو CRISPR. 10 ,11 أطلق هذا ربع قرن من الدراسات ليس في هندسة الجينوم ، ولكن في المناعة البكتيرية التي تركز على مواقع كريسبر. 12 ,13 كما هو موضح أدناه ، أدى هذا العمل في النهاية إلى اكتشاف ، في عام 2012 ، أن الإنزيم الرئيسي لنظام معين قائم على كريسبر ، Cas9 ، هو نوكلياز داخلي موجه من الحمض النووي الريبي. 14 تردد صدى هذا الاكتشاف بطريقة خاصة ، لا علاقة لها بالمناعة البكتيرية ، بسبب السابقة التي استمرت عقدًا من الزمن لتحرير الجينوم باستخدام ZFNs ، ومؤخراً ، نوكلياز المستجيب TAL (TALENs). وهكذا ، في عام 2012 ، كتب مارتن جينيك ، وجينيفر دودنا ، وإيمانويل شاربنتير ، وزملاؤهم: "لقد جذبت نوكليازات إصبع الزنك ونوكليازات المستجيب الشبيهة بالنسخ المنشط اهتمامًا كبيرًا لأن الإنزيمات الاصطناعية المهندسة للتلاعب بالجينومات. نقترح منهجية بديلة تعتمد على Cas9 المبرمج من RNA والذي يمكن أن يوفر إمكانات كبيرة لاستهداف الجينات وتطبيقات تحرير الجينوم ". 14 بعد وقت قصير ، Gasiunas وآخرون. كتب: "مجتمعة ، تمهد هذه النتائج الطريق لتطوير أدوات جزيئية فريدة لجراحة الحمض النووي الريبي الموجهة." 15 في يناير 2013 ، قدمت منشورات من أربعة مختبرات - تلك الخاصة بجورج تشيرش ودودنا وجين سو كيم وفينج زانج - بيانات تقلل من هذا الاقتراح إلى الممارسة. 16–19

لقد تلقى التاريخ المختصر لتعديل الجينات CRISPR-Cas9 تحليلًا كبيرًا بالفعل. هنا ، أهدف إلى مناقشة النتائج المستخلصة من الجهود التي استمرت 18 عامًا تقريبًا لبناء تحرير الجينوم الذي سبق عصر كريسبر (الشكل 2). إنه يركز على المبادئ والطرق التي تظل ذات صلة ومفيدة لمحرري الجينوم اليوم.


شكل. 2. جدول زمني للخلايا والكائنات الحية المعدلة وتحرير النتائج والأنوية من عصر "BC". الكائنات الحية ، من اليسار إلى اليمين ، هي: الخميرة الناشئة والفئران (استهداف الجينات) خلايا زراعة الأنسجة Xenopus oocytes Drosophila melanogaster خلايا زراعة الأنسجة البشرية أسماك الزرد والذرة والفأر وعثة الحرير C. elegans و Xenopus Tropis والأرانب وأرز الخنازير. 2–4،22–24،42،66–69،73،74،115–119 هذه قائمة تمثيلية تهدف إلى عرض النطاق التصنيفي لتحرير قائمة شاملة من الكائنات الحية التي تم تحرير جينومها في ما قبل قبل الميلاد. يمكن العثور على العمر في الجدول 2 من المرجع. 9. العمل الفني: (هياكل تانيا شيريميتا وراي سيناريغي نوكلياز بإذن من J. Keith Joung.

الهندسة الوراثية قبل التحرير: للفئران والخميرة

بين اختراع الحمض النووي المؤتلف 20 وتسلسل الحمض النووي 21 في السبعينيات ، وحتى اكتمال صندوق أدوات التحرير بشكل أساسي بحلول عام 2010 ، 8 كانت الهندسة الوراثية المستهدفة مجالًا لمجموعة مختارة من الكائنات الحية النموذجية ، وكان التقدم في دراستها أسرع بكثير من الأنظمة الأخرى المستعصية وراثيًا.

ولد الاستهداف الجيني. أظهرت مختبرات Gerry Fink & # 39s و Ron Davis & # 39s 22 ,23 أنه يمكن استبدال جين الخميرة بعلامة اختيار وبالتالي التخلص منها. على سبيل المثال ، قام معمل ديفيس بتحويل خلايا الخميرة بالبلازميد الذي يوجد فيه العلامة (URA3) محاط بمناطق التماثل مع الجين المعني (HIS3). يظهر ذلك التحديد للخلايا الإيجابية للعلامة URA3- الخلايا الإيجابية تحمل العلامة عند HIS3. أصبحت هذه الطريقة مصدرًا رئيسيًا لـ "القوة الهائلة لعلم الوراثة الفطرية" ، وعلى مدى العقود الثلاثة اللاحقة ، يستخدمها مجتمع أبحاث الخميرة ، من بين أشياء أخرى ، لتكوين مجموعة من الأليلات الصفرية ونقص الشكل عبر جينوم الخميرة بأكمله ، على نطاق واسع تستخدم للشاشات الجينية العكسية.

يعمل الاستهداف الجيني في الخلايا الجذعية الجنينية للفأر. أظهر ماريو كابيتشي أنه مستوحى من سابقة الخميرة 24 أن الجين الذي يمكن اختياره ضد في خلايا الماوس ES (HPRT) من خلال استهداف جين مختلف لها - علامة يمكن اختيارها ل (نيو ص ). في عام 1992 ، اكتشف مايكل رودنيكي ورودولف جانيش ، 25 في سياق الجهود المبذولة للقضاء على الجينات التي لا يمكن اختيارها ، فإن الامتدادات الطويلة من الحمض النووي المتساوي المنشأ مطلوبة للاستهداف الفعال. تم اختراع العديد من التحسينات التقنية الأنيقة من قبل مجتمع أبحاث الفئران ، وكما هو الحال في الخميرة ، يصبح استهداف الجينات الكلاسيكي (استخدام الانتقاء لنقل جين إلى آخر) أساسًا لمجموعات شاملة من الخلايا الجذعية الجنينية للفئران ، والفئران المعدلة وراثيًا. بطرق متطورة. لا يزال استخدام الاستهداف الجيني الكلاسيكي في إعدادات أخرى غير خلايا الفئران الجذعية الجنينية ، حتى يومنا هذا ، يمثل تحديًا تجريبيًا (انظر أدناه).

يمكن أن يعمل الاستهداف الجيني في إعدادات أخرى غير الخلايا الجذعية الجنينية للماوس. جون سيديفي ، من بين آخرين ، يستخدم "نواقل استهداف الجينات" للقضاء على الجينات ذات الصلة بالتحكم في دورة الخلية في الخلايا الليفية البشرية الأولية. 26 النتائج مثيرة للتفكير ، مما يجعل التحديات التقنية المرتبطة باستهداف الجينات سمة مؤسفة لحالة المجال في ذلك الوقت.

يمكن تحسين استهداف الجينات عن طريق استخدام ناقلات الفيروسات المرتبطة بالغدة (AAV). قام ديفيد راسل بهذا الاكتشاف المهم 27 أنه إذا استخدم المرء AAV لتقديم "بناء استهداف الجينات" ، تتحسن كفاءته. قام بيرت فوجلشتاين ، في عام 2004 ، بتوسيع هذه الملاحظة لإظهارها 28 أنه في خلايا HCT116 ، ينتج عن استخدام الاستهداف الجيني المستند إلى AAV ، بعد الاختيار ، 13 من أصل 244 استنساخًا مقاومًا للأدوية يحتوي على أليل واحد من الجين التمثيلي (CCR5) هزيمه.

جعل استهداف الجينات الخميرة والفئران في النظم الجينية السائدة المستخدمة بين عامي 1980 و 2012. ومع ذلك ، بحلول عام 2005 ، بعد 11 عامًا من الجهد (انظر أدناه) ، لم يجد مهندسو الجينوم مجرد "مصيدة فئران أفضل". وجدوا أ قط: طريقة جديدة بشكل أساسي لتغيير الجينوم ، طريقة لا تتطلب استهداف النواقل أو الانتقاء ، طريقة يمكن أن تولد أي أليل في خطوة واحدة ، وطريقة تعمل في الكائنات الحية وكذلك في الخلايا. هذا "القط" بالطبع هو تعديل الجينوم. كما سنرى أدناه ، فإن فائدتها الحالية ووجودها في كل مكان مستمدان من التعاون المدروس مع الطبيعة الأم ، على وجه التحديد ، مع عملية إصلاح DSB المنتشرة في كل مكان.

الدروس الدائمة من قبل الميلاد سن

18 قبل الميلاد (1994): DSB هو تحرير المنشأ في خلايا الثدييات

كان هذا أول اكتشاف رئيسي لعصر التحرير. وجدت ماريا جاسين أن DSB واحد يتم توصيله بواسطة إنزيم إلى كروموسوم الثدييات في الخلايا المنقسمة الانقسامية يتم إصلاحه بكفاءة إما عن طريق الإصلاح الموجه بالتماثل (HDR) من قالب مقدم من المحقق ، أو عن طريق الانضمام إلى طرف غير متماثل (NHEJ). 1

لتقدير هذه النتيجة ، بعض السياق. في عام 1982 ، جيفري ستراثيرن وآخرون. اكتشف أن DSB يبدأ في نقل المعلومات الجينية أثناء تبديل نوع التزاوج في الخميرة الناشئة ، 29 وعلى مدى العقود اللاحقة ، تم الحصول على ثروة من المعرفة حول دور DSBs في التبادل الجيني ، ولا سيما بواسطة Jim Haber ، 30 من دراسة هذا النظام . 31 في عام 1983 ، اقترح جاك زوستاك وتيري أور ويفر ورودني روثستين وفرانكلين ستال أن DSB هو الحدث البادئ في إعادة التركيب الانقسام. 32 بحلول أواخر الثمانينيات من القرن الماضي ، اعتبرت العقيدة في مجال إصلاح الحمض النووي أن الانضمام ، بدلاً من HDR ، هو مسار DSB المهيمن في الانقسام الانقسامي لخلايا الثدييات في الثقافة (كان هذا يعتمد جزئيًا على الكفاءة المنخفضة لاستهداف الجينات الكلاسيكي).

بدأ اهتمام Jasin & # 39s بهذه المشكلة عندما كانت زميلة ما بعد الدكتوراه مع Paul Berg في أواخر الثمانينيات. بدأت مختبرها في Memorial Sloan Kettering في عام 1990 ، حيث استنتجت (انظر مربع البيانات التكميلية 1 "The Book of Jasin" تتوفر البيانات التكميلية عبر الإنترنت على www.liebertpub.com/crispr) أنه يمكن حل هذه المشكلة باستخدام نوكلياز (1) من شأنه أن يحفز DSB واحدًا في كروموسوم خلية الثدييات و (2) يمكن لتلك الخلية أن تتسامح معه. في أول عدة "قفزات عبر الأنواع" الرائعة التي استفاد منها مجال تحرير الجينوم ، أعادت استخدام إنزيم اكتشفه برنارد دوجون في عام 1985: نوكلياز ، I-SceI ، والذي تطور ليعمل داخل ميتوكوندريا الخميرة لقطع 18 أزواج القاعدة (bp) الموقع المستهدف وبالتالي تنشر إطار القراءة المفتوح الخاص بها. استفادت التجربة من جين مراسل الكروموسومات حيث تم مقاطعة علامة انتقائية من خلال موقع التعرف على I-SceI ، وبالتالي يمكن استخدام الاختيار لتعقب الخلايا النادرة ذات الأهمية. الخلايا المنقولة بجزء 700 زوج قاعدي يحمل تسلسل علامة من النوع البري لم ينتج عنه ذرية من النوع البري. أنتجت المشاركة في تسليم نوكلياز تحفيز DSB ثروة من هذه ، ومع ذلك ، أظهر تحليل تسلسل الحمض النووي الخاصة بهم أنها نتجت عن الاستبدال المستند إلى HDR للموقع المستهدف للنوكلياز بحمض نووي من النوع البري. أدى توصيل النيوكلياز وحده أيضًا إلى إنتاج خلايا من النوع البري ، مع تحليل التسلسل الذي يُظهر أنها نتجت عن إزالة موقع نوكلياز من الجين المراسل مدفوعًا بعلم الأحياء الدقيقة. من تجربة واحدة مع بناء المراسل ، جاءت ثلاثة استنتاجات يتردد صداها حتى يومنا هذا: (1) في الانقسام الانقسامي لخلايا الثدييات في الثقافة ، يعزز DSB الناجم عن نوكلياز - من غير قابل للكشف إلى كشف بسهولة عن طريق الانتقاء - نقل الجينات المستند إلى HDR المعلومات في الكروموسوم من جزء خارج الرحم (2) NHEJ هو مسار منافس لإصلاح DSB هذا ، والذي ينتج عمليات إدخال وحذف صغيرة (indels) في هدف نوكلياز و (3) يتم تحمل التعبير عن مثل هذا نوكلياز بواسطة خلايا الثدييات.

هوراس جودسون وتاريخ لا يُضاهى في البيولوجيا الجزيئية ، اليوم الثامن من الخلق، يروي اللحظة التي جاء فيها فرانسيس كريك إلى المختبر حيث حصلت ليزلي بارنيت للتو على النتائج من تجربة "الأعمام والعمات" الأسطورية التي سألت عن عدد أزواج القواعد التي تشكل كل "حرف" من الشفرة الجينية. 34 نظر كريك إلى الصفائح التي تحتوي على لويحات الملتهمة ، ثم نظر إلى بارنيت وقال ، "أنت وأنا الشخصان الوحيدان على وجه الأرض اللذان يعرفان أن الشفرة الجينية ثلاثية." كان فيليب رويت ، وفاطمة سميح ، وجاسين ، في فحص الكروموسومات المستحثة عن طريق I-SceI ، والكروموسومات التي تم إصلاحها بدقة ، في تلك اللحظة في عام 1993 أو أوائل 1994 في تلك الفئة النادرة من العلماء: فريدون في معرفتهم بحقيقة مهمة بشكل أساسي.

13-10 قبل الميلاد (2000-2003): يمكن هندسة إنزيم للحث على DSB وتحريك التحرير في موضع الاهتمام بالخلايا حقيقية النواة

كان هذا هو الاكتشاف الرئيسي الثاني لعصر التحرير. نظرًا لإدراكه للآثار المترتبة على نتائج Jasin (الهدف DSB = التحرير!) والتحديات المتعلقة بإعادة هندسة الجينات الضخمة للجينات ذات الأهمية ، فقد وضع دانا كارول نصب عينيه على إنزيم التقييد الهندسي الذي تم اختراعه مؤخرًا: ZFN (اندماج بين إصبع الزنك- مجال ربط الحمض النووي المستند إلى مجال الانقسام من إنزيم تقييد ، فوكأنا). تم بناء ZFNs في الأصل ، بناءً على اقتراح هاميلتون سميث ، من قبل مختبر Chandrasegaran ، لاستخدامها كأنزيمات تقييدية جديدة. 35 في مثال معبر عن مدى صعوبة التنبؤ بمسار التطور التكنولوجي ، وجدت هذه الإنزيمات المهندسة هدفها الحقيقي في بيئة لا علاقة لها تمامًا بما تم اختراعها من أجله.

تدرب دانا كارول مع دون براون ، وكان مدركًا جيدًا ، عند إنشاء مختبر أبحاث خاص به في جامعة يوتا ، القوة الفريدة لـ Xenopus البويضة كنظام نموذجي: يسمح بالتقييم السريع داخل الخلية لعمل عدد كبير من البروتينات المرتبطة بالحمض النووي على أي عدد من القوالب المهندسة. 36 علاوة على ذلك ، اكتشف آرون كلوغ أصابع الزنك Xenopus، 37 وبينما يمثلون الفئة المهيمنة من مجالات ربط الحمض النووي عبر جميع الميتازوا ، 38 إذا كان هناك نوع واحد حيث كان الإنزيم الجديد القائم على إصبع الزنك لديه فرصة ، فقد كان Xenopus. استخدم كارول هذا النظام بكل قوته ، حيث حدد المعلمات البيوكيميائية التي تحكم التعرف الفعال على الهدف والقطع وإعادة التركيب على قالب بلازميد بواسطة ZFNs في البويضة. 2 تم الآن تحديد المرحلة (انظر مربع البيانات التكميلية 1: "كتاب كارول") لتحرير الجين.


المواد والأساليب

البناء البلازميد

تم إنشاء pEntry-sgRNA بواسطة Mutagenex (530 Highland Station Dr. ، Suwanee ، GA) على النحو التالي. تم تضخيم جزء U6-sgRNA من pU6- (BbsI) _Cbh-Cas9-T2A-mCherry plasmid (Addgene # 64324 46) بواسطة PCR باستخدام الاشعال بتسلسل attL1 و attL2 واستنساخه جزئيًا في pEAR A1A (الشكل التكميلي 9).

تم بناء بلازميد pShuttle-Cas9-DEST بخطوتين من الاستنساخ الفرعي. أولاً ، تم استنساخ جزء Cbh-Cas9-T2A-mCherry-polyA من pU6- (BbsI) _Cbh-Cas9-T2A-mCherry plasmid (Addgene # 64324) في مواقع XbaI و NotI الخاصة بـ pShuttle (Addgene # 16402 21). بعد ذلك ، تم استنساخ جزء R1-Cm R -ccdB-R2 من البوابة pDEST (ThermoFisher Scientific ، Hampton ، NH) في المتجه الوسيط (الشكل التكميلي 10).

تم إنشاء pAdTrack-Cas9-Dest عن طريق الاستنساخ الفرعي لشظايا Cbh-Cas9 و polyA من pU6- (BbsI) _Cbh-Cas9-T2A-mCherry plasmid (Addgene # 64324) ، وجزء R1-Cm R -ccdB-R2 من البوابة pDEST في مواقع KpnI / HidIII و HindIII و KpnI الخاصة بـ pAdTrack (Addgene # 16404 21) ، على التوالي (الشكل التكميلي 11).

توليد أمبليكونس pEntry-sgRNA بخطوتين استنساخ PCR و LR

تم إجراء الجولة الأولى من PCR باستخدام مجموعتين من البادئات كما هو موضح في الجدول 1. تم إجراء الجولة الثانية من PCR باستخدام خليط من منتجي PCR (1 ul من منتج PCR المخفف 100 مرة) كقوالب و L1 + L2 الاشعال (الجدول 1). تم استخدام نفس ظروف الدراجات الحرارية. لاحظ أنه تم إلحاق c و g الإضافيين (الأحرف الصغيرة) ببادئ U6-Rev و Scaff-fwd للسماح لـ sgRNA بالبدء بـ "G" إذا لم يبدأ التسلسل المستهدف بـ "G" كما أوصى Ran وآخرون. 4 تمت تنقية منتجات PCR النهائية وخلطها إما باستخدام pShuttle-Cas9-DEST أو pAdTrack-Cas9-DEST جنبًا إلى جنب مع LR clonase (Thermo Fisher Scientific # 11791020) لإنشاء ناقلات نهائية شاملة. Bacterial colonies transformed with the reaction mixture were screened by colony PCR that amplifies DNA region flanked by R1 and R2 (negative clones), or B1 and B2 (positive recombinants). Two different sets of primers were used for pShuttle and pAdTrack as follows.

attR1 Up Fwd: 5′-GAGCCCACTGCTTACTGGCTTATC-3′

Cbh Rev: 5′-CGTACTTGGCATATGATACACTTGA-3′

Size of PCR amplicons: 1,966 bp negative clone and 691 bp for positive recombinant.

Size of PCR amplicons: 1820 bp for negative clone and 545 bp for positive recombinant.

Transfection and T7E1 assay

A U2OS cell line expressing luciferase under a Bmal1 promoter was described previously. For transfection with the all-in-one plasmids, cells were plated into 6 cm dishes to be approximately 60% confluent on the day of transfection. Cells were transfected with Polyfect (Qiagen, Hilden, Germany) according to the manufacturer’s protocol and incubated for 2 days before they were subjected to trypsinization and FACS sorting using BD FACSAria SORP equipped with an Automated Cell Deposition Unit (ACDU) for sorting into 96 well plates. Cells were trypsinized with Trypsin (0.25%)-EDTA (2.21 mM) for 3 min and were filtered through mesh with 50um pores. FACS-sorted cells were collected into three groups: negative, intermediate and bright mCherry, and plated into 35 mm dishes and grown for 2 days before harvest and genomic DNA extraction. Before the cells were harvested, they were inspected for mCherry expression. Even the bright mCherry group included 10–30% of non-mCherry cells. Harvested cell pellets were homogenized in 250 ul solution A containing 0.1 M Tris-HCl pH = 9.0, 0.1 M EDTA, and 1% SDS, and incubated at 70 °C for 30 minutes. 35 ul 8 M potassium acetate was added and incubated at room temperature for 5 minutes. The samples were centrifuged at 13,000 rpm for 15 minutes and genomic DNA was purified by subjecting the supernatant to phenol-chloroform extraction and ethanol precipitation. The extracted genomic DNA pellet was dissolved in 100 ul water and used as a template to PCR amplify the target genomic locus with a set of primers (Table 2) flanking the target region. Amplicons were confirmed by agarose electrophoresis, and purified with PCR purification kit (QIAGEN Cat.28104). 200 ng DNA samples were denatured and annealed according to the protocol in Ran وآخرون. and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.

TOPO-PCR cloning and sequencing

PCR amplicons obtained above were cloned into plasmids using the TOPO-PCR cloning kit (Invitrogen #K2800), and inserts were sequenced from 20 colonies each for Bmal1 exon 7 and بير 2 exon 15. Wt contamination was confirmed: 4 out of 16 were wt for Bmal1 exon 6 and 2 out of 15 were wt for بير 2.

Single cell isolation and expansion, bioluminescence monitoring and immunoblotting

mCherry-expressing cells were singly sorted into 96 well plates by FACS and expanded serially into 24 well plates, 6 well plates, and then 10 cm dishes. A few dozen clones for each of Bmal1 exon 6, 8 and 9, and بير 2 exon 5 were set up for bioluminescence monitoring as described previously 19 . For immunoblotting for BMAL1, a previously described anti-BMAL1 antibody (GP3) was used 47 . For human PER2, novel polyclonal anti human PER2 antibodies were generated in guinea pigs using aa 1–200 peptide by Cocalico Biologicals, Inc (449 Stevens Rd, Reamstown, PA). hP2-GP49 was used in the current study. The antibody was validated by oscillations of human PER2 in U2OS cells and a novel monoclonal antibody against human PER2 (hP2-C6A3). The monoclonal antibody was selected from clones of antibodies raised against aa 1–200 of human PER2 by Boreda Biotech (Seongnam, Gyeonggi-Do, Korea). The monoclonal antibody was also able to detect oscillations of PERs in U2OS cells similarly (Supplementary Fig. 7). Uncropped immunoblot images are shown in Supplementary Fig. 12.

Generation of adenovirus

Adenoviruses expressing mutant BMAL1 lacking the DNA-binding domain or wt BMAL1 were described previously 19,38 . To generate adenovirus expressing Cas9 and sgRNA targeting Bmal1 exon 6, pAdTrack-Cas9-U6-Bmal1E6 sgRNA plasmid was used to transform electrocompetent BJ5183 cells harboring pAdEasy1 by electroporation. Positive recombinants were selected by PacI digestion and transfected into the packaging cell line 293A in a T25 flask. Cells were harvested along with the medium 10–12 days later. Adenovirus was released from the cells by freezing and thawing cells + medium three times and harvested by centrifugation. The supernatant was used to infect confluent 293 cells in two T75 flasks. Final adenoviral prep was obtained by 3 cycles of freezing-thawing cell + medium from two T75 flasks and centrifugation. The final lysate contains

3 × 10 7 transducing units (TU). When compared with 293 cells, expression forming units (efu) of the adenovirus was 5–10 fold lower for U2OS cells. However, U2OS cells could be infected with

100% efficiency without further purification, unlike infection for MEFs 19 . To ensure 100% infection in U2OS cells with the all-in-one adenovirus, the cells were infected at MOI of 50 twice, two days apart.


Biological Intervention of CRISPR/Cas9 in Clinical Trials

Cancer Immunotherapy

The first CRISPR Phase 1 clinical trial in the US opened in 2018 with the intent to use CRISPR/Cas9 to edit autologous T cells for cancer immunotherapy against several cancers with relapsed tumors and no further curative treatment options. These include multiple myeloma, melanoma, synovial sarcoma and myxoid/round cell liposarcoma. This trial was approved by the United States Food and Drug Administration (FDA) after careful consideration of the risk to benefit ratios of this first application of CRISPR gene therapy into the clinic. During this trial, T lymphocytes were collected from the patients' blood and خارج الجسم الحي engineered with CRISPR/Cas9 to knockout the α and β chains of the endogenous T cell receptor (TCR), which recognizes a specific antigen to mediate an immune response, and the programmed cell death-1 (PD-1) protein, which attenuates immune response. The cells were then transduced with lentivirus to deliver a gene encoding a TCR specific for a NY-ESO-1 antigen, which has been shown to be highly upregulated in the relapsed tumors and thus can serve as a therapeutic target. Since then, many trials have opened for CRISPR-mediated cancer immunotherapy and is currently the most employed strategy for CRISPR gene therapy ( Table 2 ). A trial implementing this strategy using other tools had already been conducted in both pre-clinical and clinical settings, but this was the first time CRISPR/Cas9 was used to generate the genetically modified T cells (97). The moderate transition of switching only the tool used for an already approved therapeutic strategy may have been key to paving the road for using CRISPR's novel abilities for gene manipulation, such as targeted gene disruption.

الجدول 2

Biological intervention of CRISPR gene therapy in clinical trials.

Sponsor/affiliationمرضGene targetClinial Trial IDCRISPR-Cas9 mediated intervention
University of Pennsylvania/Parker Institute for Cancer Immunotherapy/TmunityMultiple Myeloma, Melanoma, Synovial Sarcoma, Myxoid/Round Cell LiposarcomaTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03399448","term_id":"NCT03399448">> NCT03399448NY-ESO-1 redirected autologous T cells with CRISPR edited endogenous TCR and PD-1
Affiliated Hospital to Academy of Military Medical Sciences/Peking University/Capital Medical Universityفيروس نقص المناعة البشرية -1CCR5 <"type":"clinical-trial","attrs":<"text":"NCT03164135","term_id":"NCT03164135">> NCT03164135CD34+ hematopoietic stem/progenitor cells from donor are treated with CRISPR/Cas9 targeting CCR5 gene
CRISPR Therapeutics AGMultiple MyelomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT04244656","term_id":"NCT04244656">> NCT04244656CTX120 B-cell maturation antigen (BCMA)-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified خارج الجسم الحي using CRISPR-Cas9 gene editing components
Crispr Therapeutics/VertexBeta-Thalassemia, Thalassemia, Genetic Diseases Inborn, Hematologic Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03655678","term_id":"NCT03655678">> NCT03655678CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Crispr TherapeuticsB-cell MalignancyNon-Hodgkin LymphomaB-cell LymphomaTCRα, TCRβ <"type":"clinical-trial","attrs":<"text":"NCT04035434","term_id":"NCT04035434">> NCT04035434CTX110 (CD19-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified خارج الجسم الحي using CRISPR-Cas9 gene editing components)
Editas Medicine, Inc./AllerganLeber Congenital Amaurosis 10CEP290 <"type":"clinical-trial","attrs":<"text":"NCT03872479","term_id":"NCT03872479">> NCT03872479Single escalating doses of AGN-151587 (EDIT-101) administered via subretinal injection
Vertex Pharmaceuticals Incorporated/CRISPR TherapeuticsSickle Cell Disease, Hematological Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Allife Medical Science and Technology Co., Ltd.الثلاسيمياHBB <"type":"clinical-trial","attrs":<"text":"NCT03728322","term_id":"NCT03728322">> NCT03728322Investigate the safety and efficacy of the gene correction of HBB in patient-specific iHSCs using CRISPR/Cas9
Yang Yang, The Affiliated Nanjing Drum Tower Hospital of Nanjing University Medical SchoolStage IV Gastric Carcinoma, Stage IV Nasopharyngeal Carcinoma, T-Cell Lymphoma Stage IV, Stage IV Adult Hodgkin Lymphoma, Stage IV Diffuse Large B-Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03044743","term_id":"NCT03044743">> NCT03044743CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
First Affiliated Hospital, Sun Yat-Sen University/Jingchu University of TechnologyHuman Papillomavirus-Related Malignant NeoplasmHPV16 and HPV18 E6/E7 DNA <"type":"clinical-trial","attrs":<"text":"NCT03057912","term_id":"NCT03057912">> NCT03057912Evaluate the safety and efficacy of TALEN-HPV E6/E7 and CRISPR/Cas9-HPV E6/E7 in treating HPV Persistency and HPV-related Cervical Intraepithelial NeoplasiaI
Sichuan University/Chengdu MedGenCell, Co., Ltd.Metastatic Non-small Cell Lung CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02793856","term_id":"NCT02793856">> NCT02793856CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityMetastatic Renal Cell CarcinomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867332","term_id":"NCT02867332">> NCT02867332CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityHormone Refractory Prostate CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867345","term_id":"NCT02867345">> NCT02867345CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityInvasive Bladder Cancer Stage IVPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02863913","term_id":"NCT02863913">> NCT02863913CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Hangzhou Cancer Hospital/Anhui Kedgene Biotechnology Co., LtdEsophageal CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03081715","term_id":"NCT03081715">> NCT03081715CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Chinese PLA General HospitalSolid Tumor, AdultTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03545815","term_id":"NCT03545815">> NCT03545815Evaluate the feasibility and safety of CRISPR-Cas9 mediated PD-1 and TCR gene-knocked out chimeric antigen receptor (CAR) T cells in patients with mesothelin positive multiple solid tumors
Baylor College of Medicine/The Methodist Hospital SystemT-cell Acute Lymphoblastic Leukemia, T-cell Acute Lymphoblastic Lymphoma, T-non-Hodgkin LymphomaCD7 <"type":"clinical-trial","attrs":<"text":"NCT03690011","term_id":"NCT03690011">> NCT03690011CRISPR-Cas9 mediated CD7 knockout-T cells from autologous origin
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03398967","term_id":"NCT03398967">> NCT03398967Determine the safety of the allogenic CRISPR-Cas9 gene-edited dual specificity CD19 and CD20 or CD22 CAR-T cells
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT03166878","term_id":"NCT03166878">> NCT03166878CRISPR-Cas9 mediated TCR and B2M knockout-T cells from allogenic origin for CD19 CAR-T
Chinese PLA General HospitalSolid Tumor, AdultPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03747965","term_id":"NCT03747965">> NCT03747965CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Xijing Hospital/Xi'An Yufan Biotechnology Co., LtdLeukemia, LymphomaHPK1 <"type":"clinical-trial","attrs":<"text":"NCT04037566","term_id":"NCT04037566">> NCT04037566CRISPR Gene Edited to Eliminate Endogenous HPK1 (XYF19 CAR-T Cells)

Gene Disruption

The first clinical trial in the US using CRISPR to catalyze gene disruption for therapeutic benefit were for patients with sickle-cell anemia (SCD) and later β-thalassemia, by Vertex Pharmaceuticals and CRISPR Therapeutics. This therapy, named CTX001, increases fetal hemoglobin (HbF) levels, which can occupy one or two of four hemoglobin binding pockets on erythrocytes and thereby provides clinical benefit for major β-hemoglobin diseases such as SCD and β-thalassemia (103). The trial involved collecting autologous hematopoietic stem and progenitor cells from peripheral blood and using CRISPR/Cas9 to disrupt the intronic erythroid-specific enhancer for the BCL11A gene ( <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287) as disruption of this gene increases HbF expression (104�). Genetically modified hematopoietic stem cells with BCL11A disruption are delivered by IV infusion after myeloablative conditioning with busulfan to destroy unedited hematopoietic stem cells in the bone marrow. Preliminary findings from two patients receiving this treatment seem promising. One SCD patient was reported to have 46.6% HbF and 94.7% erythrocytes expressing HbF after 4 months of CTX001 transfusions and one β-thalassemia patient is expressing 10.1 g/dL HbF out of 11.9 g/dL total hemoglobin, and 99.8% erythrocytes expressing HbF after 9 months of the therapy. Results from the clinical trial that has opened for this therapy ( <"type":"clinical-trial","attrs":<"text":"NCT04208529","term_id":"NCT04208529">> NCT04208529) to assess the long-term risks and benefits of CTX001 will dictate whether this approach can provide a novel therapeutic opportunity for a disease that otherwise has limited treatment options.

في الجسم الحي CRISPR Gene Therapy

While the aforementioned trials rely on خارج الجسم الحي editing and subsequent therapy with modified cells, في الجسم الحي approaches have been less extensively employed. An exciting step forward with CRISPR gene therapy has been recently launched with a clinical trial using في الجسم الحي delivery of CRISPR/Cas9 for the first time in patients. في حين في الجسم الحي editing has been largely limited by inadequate accessibility to the target tissue, a few organs, such as the eye, are accessible. Leber congenital amaurosis (LCA) is a debilitating monogenic disease that results in childhood blindness caused by a bi-allelic loss-of-function mutation in the CEP290 gene, with no treatment options. This therapy, named EDIT-101, delivers CRISPR/Cas9 directly into the retina of LCA patients specifically with the intronic IVS26 mutation, which drives aberrant splicing resulting in a non-functional protein. The therapy uses an AAV5 vector to deliver nucleic acid instructions for المكورات العنقودية الذهبية Cas9 and two guides targeting the ends of the CEP290 locus containing the IVS26 mutation. The DSB induced by Cas9 and both guides result in either a deletion or inversion of the IVS26 intronic region, thus preventing the aberrant splicing caused by the genetic mutation and enabling subsequent translation of the functional protein (107). Potential immunotoxicity or OTEs arising from nucleic acid viral delivery will have to be closely monitored. Nonetheless, a possibly curative medicine for genetic blindness using an في الجسم الحي approach marks an important advancement for CRISPR gene therapy.

CRISPR Editing in Human Embryos and Ethical Considerations

While somatic editing for CRISPR therapy has been permitted after careful consideration, human germline editing for therapeutic intent remains highly controversial. With somatic edition, any potential risk would be contained within the individual after informed consent to partake in the therapy. Embryonic editing not only removes autonomy in the decision-making process of the later born individuals, but also allows unforeseen and permanent side effects to pass down through generations. This very power warrants proceeding with caution to prevent major setbacks as witnessed by traditional gene therapy. However, a controversial CRISPR trial in human embryos led by Jiankui He may have already breached the ethical standards set in place for such trials. This pilot study involved genetic engineering of the C-C chemokine receptor type 5 (CCR5) gene in human embryos, with the intention of conferring HIV-resistance, as seen by a naturally occurring CCR5Δ32 mutation in a few individuals (108). However, based on the limited evidence, CRISPR/Cas9 was likely used to target this gene, but rather than replicate the naturally observed and beneficial 32-base deletion, the edits merely induced DSBs at one end of the deletion, allowing NHEJ to repair the damaged DNA while introducing random, uncharacterized mutations. Thus, it is unknown whether the resultant protein will function similarly to the naturally occurring CCR5Δ32 protein and confer HIV resistance. In addition, only one of the two embryos, termed with the pseudonym Nana, had successful edits in both copies of the CCR5 gene, whereas the other embryo, with pseudonym Lulu, had successful editing in only one copy. Despite these findings, both embryos were implanted back into their mother, knowing that the HIV-resistance will be questionable in Nana and non-existent in Lulu (109, 110).

Furthermore, recent studies have shown that the mechanism for infection of some variants of the highly mutable HIV virus may heavily rely on the C-X-C chemokine receptor type 4 (CXCR4) co-receptor (108, 111). With no attempts at editing CXCR4, this adds yet another layer of skepticism toward achieving HIV resistance by this strategy. In addition, OTEs, particularly over the lifetime of an individual, remain a major concern for applying this technology in humans. The recent advances in the editing tool to limit OTEs, such as using high fidelity Cas9 variants, has not been exploited. Furthermore, the rationale for selecting HIV prevention for the first use of CRISPR in implanted human embryos contributes to the poor risk to benefit ratio of this study, considering HIV patients can live long, healthy lives on a drug regimen. A more appropriate first attempt would have been to employ this technology for a more severe disease. For example, correction of the MYBPC3 gene is arguably a better target for embryonic gene editing, as mutations in MYBPC3 can cause hypertrophic cardiomyopathy (HCM), a heart condition responsible for most sudden cardiac deaths in people under the age of 30. Gene correction for this pathological mutation was achieved recently for the first time in the US in viable human embryos using the HDR-mediated CRISPR/Cas9 system. However, these embryos were edited for basic research purposes and not intended for implantation. In this study, sperm carrying the pathogenic MYBPC3 mutation and the CRISPR/Cas9 machinery as an RNP complex were microinjected into healthy donor oocytes arrested at MII, achieving 72.4% homozygous wildtype embryos as opposed to 47.4% in untreated embryos. The HDR-mediated gene correction was observed at considerably high frequencies with no detectable OTEs in selected blastomeres, likely owing to the direct microinjection delivery of the RNP complex in the early zygote. Interestingly, the maternal wildtype DNA was used preferentially for templated repair over the provided exogenous ssODN template (112). While evidence for gene correction was promising, NHEJ mediated DNA repair was still observed in many embryos, highlighting the need to improve HDR efficiency before clinical application can be considered. Although strategies have been developed to improve HDR, such as chemical inhibitors of NHEJ (77�), such techniques may have varying outcomes in embryonic cells and side effects that may arise from treatment needs to be investigated. Germline gene editing will remain to be ethically unfavorable at its current state and its discussions may not be considered until sufficient long-term studies of the ongoing somatic CRISPR therapy clinical trials are evaluated.


Gene Drives

Yet another fascinating application of CRISPR is a tool called a gene drive. Originally conceived by Harvard biologist Kevin Esvelt, a gene drive is a synthetic segment of DNA that includes the Cas9 gene and a guideRNA gene, along with a particular gene of interest (also called payload DNA), all in one self-functioning unit (Esvelt et al., 2014). The payload DNA can be a new gene or a modified version of an existing gene.

Once a gene drive is introduced into the chromosome of a diploid organism, the drive will generate a Cas9/guideRNA complex that will cut the homologous chromosome and then copy the gene drive into the break via HDR. With the gene drive now present in both chromosomes, the organism is homozygous for the drive, including the payload DNA (Figure 8).

Structure of a CRISPR gene drive. (أ) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (ب) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (ج) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Structure of a CRISPR gene drive. (أ) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (ب) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (ج) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Gene drives are capable of knocking-in or knocking-out genes in an organism. More importantly, gene drives can be propagated into an entire population of organisms via sexual reproduction, thus allowing for genetic modification at the population level.

Consider Figure 9A, which shows how a gene is propagated in a population via normal inheritance – that is, with no gene drives involved. If one of the original parents is heterozygous for a gene of interest, then the gene should statistically be transmitted to half of the offspring. This pattern of inheritance would continue in subsequent generations with the gene never accumulating to an appreciable level within the population.

WTvhUkCteg0tUw9cs3JGHWqWdw9F8zV-qwoTKX5WVSQAzgISOD6ZhB-t1DdB9QS0rryNrBEw0yZIVVaaQ0mMj9o0RIOdStWb1hQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA" alt="Normal vs. gene-drive-based inheritance. (A) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

Normal vs. gene-drive-based inheritance. (أ) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

50% of the offspring but will never accumulate in the population at large. (ب) One of the original parents is heterozygous for the gene of interest, which is located within a gene drive. The gene drive copies the drive and gene of interest into the other homologous chromosome, thus making the parent homozygous. As such, the gene drive is passed to 100% of the offspring. The offspring are initially heterozygous for the gene and drive but, like the parent, become homozygous. Thus, the gene of interest is rapidly propagated into the population.

Now look at how the gene could be propagated using a gene drive (Figure 9B). The original parent would initially be heterozygous for the gene drive (including the gene of interest), but the drive itself would ensure that it is copied into the homologous chromosome, thus making the parent homozygous for the drive and payload gene. Zygotes in the first generation of offspring would initially be heterozygous for the gene drive, but once again, the drive would copy itself into the homologous chromosome, ensuring that the offspring become homozygous. This pattern of inheritance would continue in subsequent generations with the drive and gene of interest becoming increasingly present within the population. So, how might this technology be used?

In one interesting application, scientists are hoping to use gene drives to eliminate malaria, a disease that continues to kill over a million people every year. The malarial parasite is transmitted by the Anopholes البعوض. Researchers created a gene drive that makes females of the species reproductively sterile (Hammond et al., 2015). Introducing the gene drive into the environment could conceivably drive the mosquito species to extinction and help eradicate the disease. In February 2019, researchers in Italy began a large-scale release of the CRISPR-edited mosquitos into a controlled high-security environment. If the technology works, gene drives could be used to address other insect-borne diseases, such as Zika virus. Moreover, gene drives could help eradicate invasive pests and create more efficient crops.

Gene drives represent an extremely powerful technology with the potential to alter entire populations of organisms. Indeed, the enormous power of gene drives has not gone unnoticed by the U.S. government. In 2016, the director of national intelligence added gene editing to a list of threats posed by “Weapons of Mass Destruction and Proliferation.” Ironically, Esvelt's lab is already working on an antidote to gene drives: a gene drive programmed to remove another gene drive.


HnRNP A2B1 (HNRNPA2B1) Human Gene Knockout Kit (CRISPR)

HNRNPA2B1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

Product images

تحديد

KN419318G1, HNRNPA2B1 gRNA vector 1 in pCas-Guide CRISPR vector

KN419318G2, HNRNPA2B1 gRNA vector 2 in pCas-Guide CRISPR vector

KN419318D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


Celf3 Mouse Gene Knockout Kit (CRISPR)

Celf3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.

Product images

تحديد

KN503115G1, Celf3 gRNA vector 1 in pCas-Guide CRISPR vector

KN503115G2, Celf3 gRNA vector 2 in pCas-Guide CRISPR vector

KN503115D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


شاهد الفيديو: تقنية كريسبر والتعديل الجيني (شهر نوفمبر 2022).